pycom1729g00130

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001729
Physical Location & Seq
Forward (+)
190826 .. 191374
549 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 549 bp
ATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAACAGGAGATCAAACTGCTTAAGCATGAGAATAGAAGTTTGCACGTGCTTGCCAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAACTGCAAGAGTCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACCTTTTTCCTGGATCATCCAGCGTTTGGCCAAGTATTGAGGCCTCGAATGCTCTATCTTCGATGCCTCTATCTCCGATGCCTTCCGCTCCTATGTCTTCTGCCCCGATGCCTTCCGTCTCGATGCCTTCCGCTTCAAGAGTTTTGCCACGTAGTGGGTCTTTAAGTAAACAACCTTTGTGA

Protein Analysis

183

Amino Acids

19.89

Weight (kDa)

9.79

Isoelectric Point (pI)

75.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 366
AccB7I CCANNNNNTGG 2 cut(s) 393, 521
AccBSI CCGCTC 2 cut(s) 168, 455
AciI CCGC 3 cut(s) 166, 453, 498
AclWI GGATC 1 cut(s) 388
AcoI YGGCCR 2 cut(s) 90, 395
AcuI CTGAAG 1 cut(s) 336
AcvI CACGTG 1 cut(s) 256
AcyI GRCGYC 1 cut(s) 9
AdeI CACNNNGTG 2 cut(s) 116, 521
AfiI CCNNNNNNNGG 3 cut(s) 178, 393, 521
AflII CTTAAG 1 cut(s) 230
AgsI TTSAA 3 cut(s) 98, 329, 504
AjnI CCWGG 1 cut(s) 376
AluBI AGCT 3 cut(s) 20, 32, 295
AluI AGCT 3 cut(s) 20, 32, 295
Alw26I GTCTC 1 cut(s) 490
AlwI GGATC 1 cut(s) 388
AoxI GGCC 4 cut(s) 90, 148, 395, 408
ApeKI GCWGC 1 cut(s) 64
ArsI GACNNNNNNTTYG 2 cut(s) 322, 354
AspS9I GGNCC 2 cut(s) 78, 148
AvaII GGWCC 1 cut(s) 78
BalI TGGCCA 1 cut(s) 397
BanI GGYRCC 1 cut(s) 366
BbrPI CACGTG 1 cut(s) 256
BbsI GAAGAC 1 cut(s) 456
BbvI GCAGC 1 cut(s) 51
BccI CCATC 1 cut(s) 184
BceAI ACGGC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 378
BcoDI GTCTC 1 cut(s) 490
BfaI CTAG 1 cut(s) 33
BfrI CTTAAG 1 cut(s) 230
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
Bme1390I CCNGG 1 cut(s) 378
Bme18I GGWCC 1 cut(s) 78
BmgT120I GGNCC 2 cut(s) 78, 148
BmiI GGNNCC 2 cut(s) 38, 368
BmrFI CCNGG 1 cut(s) 378
BmsI GCATC 4 cut(s) 420, 435, 465, 480
BpiI GAAGAC 1 cut(s) 456
BpmI CTGGAG 1 cut(s) 344
BsaAI YACGTR 2 cut(s) 256, 518
BsaHI GRCGYC 1 cut(s) 9
Bsc4I CCNNNNNNNGG 3 cut(s) 178, 393, 521
BseBI CCWGG 1 cut(s) 378
BseGI GGATG 1 cut(s) 383
BseLI CCNNNNNNNGG 3 cut(s) 178, 393, 521
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 1 cut(s) 51
BshFI GGCC 4 cut(s) 92, 150, 397, 410
BshNI GGYRCC 1 cut(s) 366
BslFI GGGAC 1 cut(s) 88
BslI CCNNNNNNNGG 3 cut(s) 178, 393, 521
BsmAI GTCTC 1 cut(s) 490
BsmBI CGTCTC 1 cut(s) 490
BsmFI GGGAC 1 cut(s) 88
BsmI GAATGC 1 cut(s) 421
BsnI GGCC 4 cut(s) 92, 150, 397, 410
Bsp143I GATC 2 cut(s) 219, 380
BspACI CCGC 3 cut(s) 166, 453, 498
BspANI GGCC 4 cut(s) 92, 150, 397, 410
BspLI GGNNCC 2 cut(s) 38, 368
BspPI GGATC 1 cut(s) 388
BspT107I GGYRCC 1 cut(s) 366
BspTI CTTAAG 1 cut(s) 230
BsrBI CCGCTC 2 cut(s) 168, 455
BssMI GATC 2 cut(s) 219, 380
BssNI GRCGYC 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 378
Bst4CI ACNGT 2 cut(s) 78, 338
Bst6I CTCTTC 1 cut(s) 281
BstACI GRCGYC 1 cut(s) 9
BstAFI CTTAAG 1 cut(s) 230
BstBAI YACGTR 2 cut(s) 256, 518
BstC8I GCNNGC 4 cut(s) 158, 162, 166, 261
BstDEI CTNAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 383
BstKTI GATC 2 cut(s) 222, 383
BstMAI GTCTC 1 cut(s) 490
BstMBI GATC 2 cut(s) 219, 380
BstMWI GCNNNNNNNGC 2 cut(s) 17, 416
BstNI CCWGG 1 cut(s) 378
BstSCI CCNGG 1 cut(s) 376
BstV1I GCAGC 1 cut(s) 51
BstV2I GAAGAC 1 cut(s) 456
BsuRI GGCC 4 cut(s) 92, 150, 397, 410
BtsCI GGATG 1 cut(s) 383
BtsIMutI CAGTG 1 cut(s) 128
Cac8I GCNNGC 4 cut(s) 158, 162, 166, 261
Cfr13I GGNCC 2 cut(s) 78, 148
CpoI CGGWCCG 1 cut(s) 78
CseI GACGC 1 cut(s) 17
CspI CGGWCCG 1 cut(s) 78
CviAII CATG 3 cut(s) 145, 236, 283
CviJI RGCY 8 cut(s) 20, 32, 64, 92, 150, 295, 397, 410
CviKI_1 RGCY 8 cut(s) 20, 32, 64, 92, 150, 295, 397, 410
DdeI CTNAG 1 cut(s) 113
DpnI GATC 2 cut(s) 221, 382
DpnII GATC 2 cut(s) 219, 380
DraIII CACNNNGTG 2 cut(s) 116, 521
EaeI YGGCCR 2 cut(s) 90, 395
Eam1104I CTCTTC 1 cut(s) 281
EarI CTCTTC 1 cut(s) 281
Eco147I AGGCCT 1 cut(s) 410
Eco47I GGWCC 1 cut(s) 78
Eco57I CTGAAG 1 cut(s) 336
Eco72I CACGTG 1 cut(s) 256
EcoRII CCWGG 1 cut(s) 376
Esp3I CGTCTC 1 cut(s) 490
FaeI CATG 3 cut(s) 148, 239, 286
FaiI YATR 4 cut(s) 146, 237, 284, 461
FaqI GGGAC 1 cut(s) 88
FatI CATG 3 cut(s) 144, 235, 282
FauI CCCGC 1 cut(s) 173
Fnu4HI GCNGC 1 cut(s) 65
FokI GGATG 1 cut(s) 370
Fsp4HI GCNGC 1 cut(s) 65
FspBI CTAG 1 cut(s) 33
GluI GCNGC 1 cut(s) 65
GsuI CTGGAG 1 cut(s) 344
HaeIII GGCC 4 cut(s) 92, 150, 397, 410
HgaI GACGC 1 cut(s) 17
Hin1I GRCGYC 1 cut(s) 9
Hin1II CATG 3 cut(s) 148, 239, 286
HindIII AAGCTT 1 cut(s) 293
HinfI GANTC 4 cut(s) 101, 182, 311, 325
Hpy166II GTNNAC 1 cut(s) 536
Hpy188I TCNGA 4 cut(s) 82, 316, 324, 444
Hpy188III TCNNGA 5 cut(s) 72, 98, 361, 487, 504
Hpy8I GTNNAC 1 cut(s) 536
Hpy99I CGWCG 1 cut(s) 280
HpyAV CCTTC 4 cut(s) 311, 459, 489, 504
HpyCH4III ACNGT 2 cut(s) 78, 338
HpyCH4IV ACGT 2 cut(s) 255, 517
HpyCH4V TGCA 3 cut(s) 4, 253, 307
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 416
HpyF3I CTNAG 1 cut(s) 113
HpySE526I ACGT 2 cut(s) 255, 517
Hsp92I GRCGYC 1 cut(s) 9
Hsp92II CATG 3 cut(s) 148, 239, 286
Kzo9I GATC 2 cut(s) 219, 380
LmnI GCTCC 2 cut(s) 173, 460
LpnPI CCDG 8 cut(s) 57, 161, 170, 200, 363, 374, 390, 400
Lsp1109I GCAGC 1 cut(s) 51
LweI GCATC 4 cut(s) 420, 435, 465, 480
MaeI CTAG 1 cut(s) 33
MaeII ACGT 2 cut(s) 255, 517
MaeIII GTNAC 1 cut(s) 332
MalI GATC 2 cut(s) 221, 382
MbiI CCGCTC 2 cut(s) 168, 455
MboI GATC 2 cut(s) 219, 380
MboII GAAGA 3 cut(s) 298, 417, 456
MlsI TGGCCA 1 cut(s) 397
MluNI TGGCCA 1 cut(s) 397
MlyI GAGTC 2 cut(s) 110, 320
MmeI TCCRAC 2 cut(s) 165, 302
Mox20I TGGCCA 1 cut(s) 397
MscI TGGCCA 1 cut(s) 397
MseI TTAA 3 cut(s) 210, 231, 530
Msp20I TGGCCA 1 cut(s) 397
MspCI CTTAAG 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 378
Mva1269I GAATGC 1 cut(s) 421
MvaI CCWGG 1 cut(s) 378
MwoI GCNNNNNNNGC 2 cut(s) 17, 416
NdeII GATC 2 cut(s) 219, 380
NlaIII CATG 3 cut(s) 148, 239, 286
NlaIV GGNNCC 2 cut(s) 38, 368
NmuCI GTSAC 1 cut(s) 332
PceI AGGCCT 1 cut(s) 410
PctI GAATGC 1 cut(s) 421
PfeI GAWTC 2 cut(s) 182, 325
PflMI CCANNNNNTGG 2 cut(s) 393, 521
PfoI TCCNGGA 1 cut(s) 376
PkrI GCNGC 1 cut(s) 66
PleI GAGTC 2 cut(s) 109, 319
PmaCI CACGTG 1 cut(s) 256
PmlI CACGTG 1 cut(s) 256
PpsI GAGTC 2 cut(s) 109, 319
Ppu21I YACGTR 2 cut(s) 256, 518
Psp6I CCWGG 1 cut(s) 376
PspCI CACGTG 1 cut(s) 256
PspGI CCWGG 1 cut(s) 376
PspN4I GGNNCC 2 cut(s) 38, 368
PspPI GGNCC 2 cut(s) 78, 148
Rsr2I CGGWCCG 1 cut(s) 78
RsrII CGGWCCG 1 cut(s) 78
SaqAI TTAA 3 cut(s) 210, 231, 530
SatI GCNGC 1 cut(s) 65
Sau3AI GATC 2 cut(s) 219, 380
Sau96I GGNCC 2 cut(s) 78, 148
SchI GAGTC 2 cut(s) 110, 320
ScrFI CCNGG 1 cut(s) 378
SfaNI GCATC 4 cut(s) 420, 435, 465, 480
SinI GGWCC 1 cut(s) 78
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
SseBI AGGCCT 1 cut(s) 410
SsiI CCGC 3 cut(s) 166, 453, 498
SspMI CTAG 1 cut(s) 33
StuI AGGCCT 1 cut(s) 410
StyD4I CCNGG 1 cut(s) 376
TaaI ACNGT 2 cut(s) 78, 338
TaiI ACGT 2 cut(s) 258, 520
TaqI TCGA 4 cut(s) 275, 413, 428, 488
TfiI GAWTC 2 cut(s) 182, 325
Tru1I TTAA 3 cut(s) 210, 231, 530
Tru9I TTAA 3 cut(s) 210, 231, 530
TscAI CASTG 1 cut(s) 128
TseFI GTSAC 1 cut(s) 332
TseI GCWGC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 332
TspDTI ATGAA 2 cut(s) 299, 315
TspGWI ACGGA 1 cut(s) 472
TspRI CASTG 1 cut(s) 128
Van91I CCANNNNNTGG 2 cut(s) 393, 521
Vha464I CTTAAG 1 cut(s) 230
VpaK11BI GGWCC 1 cut(s) 78
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.