pycom17g03310

Uncharacterized protein K02A2.6-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
2175510 .. 2175890
381 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 381 bp
ATGATTGACTCGGCCCTGAAGAAAGGGCCGAAGTTTCCAAAATTTATCCATCCATACCCGGCTTATGTAGAAAGGTTTGAATACCCAAGAGGATTTAAGATCCCTGATTTCAGCCTCTTCGCCGGGGAATCGTCTTTATCCTCATTAGAACATGTGGCTCGGTTCACAGCACAGTGTGGAGACGTCAATAGCGACTTCTACAAATTACGGCTGTTTAACTTTTCACTGACAGGCTCAGCTTTCGCCTGGTACATTAATCTTCCACCCAACTCCGTGCAGAGTTGGGAAGAGTTAGTCGAAAAGTTCCATGAACAATTCTATCGGCCAGGGATGGAGATGTCCGTATCATCGTTGGCCAGGATGGCTCAAGCATCCGACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

127

Amino Acids

14.48

Weight (kDa)

6.29

Isoelectric Point (pI)

33.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 70 - 123 1.5e-06 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 186
AclWI GGATC 1 cut(s) 94
AcoI YGGCCR 2 cut(s) 323, 354
AcsI RAATTY 1 cut(s) 41
AcuI CTGAAG 1 cut(s) 38
AcyI GRCGYC 1 cut(s) 183
AdeI CACNNNGTG 1 cut(s) 176
AfaI GTAC 1 cut(s) 251
AflIII ACRYGT 1 cut(s) 151
AgsI TTSAA 1 cut(s) 80
AjnI CCWGG 3 cut(s) 245, 325, 356
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
Alw26I GTCTC 1 cut(s) 174
AlwI GGATC 1 cut(s) 94
AoxI GGCC 4 cut(s) 12, 26, 323, 354
ApoI RAATTY 1 cut(s) 41
AseI ATTAAT 1 cut(s) 255
AspS9I GGNCC 2 cut(s) 13, 26
AsuC2I CCSGG 2 cut(s) 59, 124
BalI TGGCCA 1 cut(s) 356
BccI CCATC 3 cut(s) 57, 325, 355
BceAI ACGGC 1 cut(s) 224
BciT130I CCWGG 3 cut(s) 247, 327, 358
BcnI CCSGG 2 cut(s) 59, 124
BcoDI GTCTC 1 cut(s) 174
BglI GCCNNNNNGGC 1 cut(s) 362
BlpI GCTNAGC 1 cut(s) 235
Bme1390I CCNGG 5 cut(s) 59, 124, 247, 327, 358
BmgT120I GGNCC 2 cut(s) 13, 26
BmrFI CCNGG 5 cut(s) 59, 124, 247, 327, 358
Bpu1102I GCTNAGC 1 cut(s) 235
BpuEI CTTGAG 1 cut(s) 351
BpuMI CCSGG 2 cut(s) 59, 124
BsaHI GRCGYC 1 cut(s) 183
BsaJI CCNNGG 2 cut(s) 123, 326
BseBI CCWGG 3 cut(s) 247, 327, 358
BseDI CCNNGG 2 cut(s) 123, 326
BseGI GGATG 4 cut(s) 49, 336, 366, 371
BseMII CTCAG 1 cut(s) 249
BsgI GTGCAG 1 cut(s) 296
BshFI GGCC 4 cut(s) 14, 28, 325, 356
BsiSI CCGG 2 cut(s) 59, 123
BsmAI GTCTC 1 cut(s) 174
BsmBI CGTCTC 1 cut(s) 174
BsnI GGCC 4 cut(s) 14, 28, 325, 356
Bsp143I GATC 1 cut(s) 99
Bsp1720I GCTNAGC 1 cut(s) 235
BspANI GGCC 4 cut(s) 14, 28, 325, 356
BspCNI CTCAG 1 cut(s) 248
BspPI GGATC 1 cut(s) 94
BssECI CCNNGG 2 cut(s) 123, 326
BssMI GATC 1 cut(s) 99
BssNI GRCGYC 1 cut(s) 183
Bst2UI CCWGG 3 cut(s) 247, 327, 358
Bst4CI ACNGT 1 cut(s) 174
Bst6I CTCTTC 2 cut(s) 122, 282
BstACI GRCGYC 1 cut(s) 183
BstDEI CTNAG 1 cut(s) 235
BstF5I GGATG 4 cut(s) 49, 336, 366, 371
BstKTI GATC 1 cut(s) 102
BstMAI GTCTC 1 cut(s) 174
BstMBI GATC 1 cut(s) 99
BstMWI GCNNNNNNNGC 1 cut(s) 362
BstNI CCWGG 3 cut(s) 247, 327, 358
BstNSI RCATGY 1 cut(s) 155
BstSCI CCNGG 5 cut(s) 57, 122, 245, 325, 356
BstX2I RGATCY 1 cut(s) 99
BstYI RGATCY 1 cut(s) 99
BsuRI GGCC 4 cut(s) 14, 28, 325, 356
BtsCI GGATG 4 cut(s) 49, 336, 366, 371
BtsIMutI CAGTG 2 cut(s) 179, 224
Cfr13I GGNCC 2 cut(s) 13, 26
Csp6I GTAC 1 cut(s) 250
CviAII CATG 2 cut(s) 152, 308
CviQI GTAC 1 cut(s) 250
DdeI CTNAG 1 cut(s) 235
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
DraIII CACNNNGTG 1 cut(s) 176
EaeI YGGCCR 2 cut(s) 323, 354
Eam1104I CTCTTC 2 cut(s) 122, 282
EarI CTCTTC 2 cut(s) 122, 282
Eco57I CTGAAG 1 cut(s) 38
EcoRII CCWGG 3 cut(s) 245, 325, 356
Esp3I CGTCTC 1 cut(s) 174
FaeI CATG 2 cut(s) 155, 311
FaiI YATR 4 cut(s) 55, 66, 153, 309
FatI CATG 2 cut(s) 151, 307
FokI GGATG 4 cut(s) 36, 343, 358, 373
HaeIII GGCC 4 cut(s) 14, 28, 325, 356
HapII CCGG 2 cut(s) 59, 123
Hin1I GRCGYC 1 cut(s) 183
Hin1II CATG 2 cut(s) 155, 311
HinfI GANTC 2 cut(s) 8, 128
HpaII CCGG 2 cut(s) 59, 123
Hpy166II GTNNAC 1 cut(s) 165
Hpy188I TCNGA 1 cut(s) 376
Hpy8I GTNNAC 1 cut(s) 165
HpyCH4III ACNGT 1 cut(s) 174
HpyCH4IV ACGT 1 cut(s) 183
HpyCH4V TGCA 1 cut(s) 277
HpyF10VI GCNNNNNNNGC 1 cut(s) 362
HpyF3I CTNAG 1 cut(s) 235
HpySE526I ACGT 1 cut(s) 183
Hsp92I GRCGYC 1 cut(s) 183
Hsp92II CATG 2 cut(s) 155, 311
Kzo9I GATC 1 cut(s) 99
MaeII ACGT 1 cut(s) 183
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MboII GAAGA 4 cut(s) 31, 109, 251, 299
MflI RGATCY 1 cut(s) 99
MlsI TGGCCA 1 cut(s) 356
MluCI AATT 3 cut(s) 41, 203, 314
MluNI TGGCCA 1 cut(s) 356
MlyI GAGTC 1 cut(s) 2
MnlI CCTC 3 cut(s) 83, 125, 151
Mox20I TGGCCA 1 cut(s) 356
MscI TGGCCA 1 cut(s) 356
MseI TTAA 3 cut(s) 96, 216, 255
Msp20I TGGCCA 1 cut(s) 356
MspI CCGG 2 cut(s) 59, 123
MspR9I CCNGG 5 cut(s) 59, 124, 247, 327, 358
MvaI CCWGG 3 cut(s) 247, 327, 358
MwoI GCNNNNNNNGC 1 cut(s) 362
NciI CCSGG 2 cut(s) 59, 124
NdeII GATC 1 cut(s) 99
NlaIII CATG 2 cut(s) 155, 311
NspI RCATGY 1 cut(s) 155
PciI ACATGT 1 cut(s) 151
PcsI WCGNNNNNNNCGW 1 cut(s) 189
PfeI GAWTC 1 cut(s) 128
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
PscI ACATGT 1 cut(s) 151
PshBI ATTAAT 1 cut(s) 255
Psp6I CCWGG 3 cut(s) 245, 325, 356
PspGI CCWGG 3 cut(s) 245, 325, 356
PspPI GGNCC 2 cut(s) 13, 26
PsuI RGATCY 1 cut(s) 99
RsaI GTAC 1 cut(s) 251
RsaNI GTAC 1 cut(s) 250
SaqAI TTAA 3 cut(s) 96, 216, 255
Sau3AI GATC 1 cut(s) 99
Sau96I GGNCC 2 cut(s) 13, 26
SchI GAGTC 1 cut(s) 2
ScrFI CCNGG 5 cut(s) 59, 124, 247, 327, 358
SetI ASST 3 cut(s) 77, 186, 241
SmlI CTYRAG 1 cut(s) 366
SmoI CTYRAG 1 cut(s) 366
Sse9I AATT 3 cut(s) 41, 203, 314
StyD4I CCNGG 5 cut(s) 57, 122, 245, 325, 356
TaaI ACNGT 1 cut(s) 174
TaiI ACGT 1 cut(s) 186
TaqI TCGA 1 cut(s) 297
TasI AATT 3 cut(s) 41, 203, 314
TfiI GAWTC 1 cut(s) 128
Tru1I TTAA 3 cut(s) 96, 216, 255
Tru9I TTAA 3 cut(s) 96, 216, 255
TscAI CASTG 2 cut(s) 179, 231
TspDTI ATGAA 1 cut(s) 324
TspGWI ACGGA 2 cut(s) 262, 331
TspRI CASTG 2 cut(s) 179, 231
VspI ATTAAT 1 cut(s) 255
XapI RAATTY 1 cut(s) 41
XceI RCATGY 1 cut(s) 155
ZraI GACGTC 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.