pycom17g06230

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
4374729 .. 4377110
2382 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1599 bp
ATGAATTTTTTTTTCCTTCTAGATCTTGAGTGCATATTCACTGTTATCTGCAATGTTGTTACAAAGTCTGAAAGTCCAGATGAAGCACTGGAGATGGCAAAACTTATATCCTCAAAGATTACTCAAAAACCAACCGACAAGCCTGCATTGCGCTTAAAGATTTTGTTCAATCTGTACAACCTACTGGAGAACCCATATAGCCGGTTCTTAGTCTACTTGAGTGCTCTTAATTTGGCTATCCATGGGAAGGTCACTGAACATGTCATCCCTTCAATCAAAAATGTGGAAAGTTTTTTGGAAGAGTGGAATATTGAGATCTCTGATCAGAGGCAGTTATTTCTGACCATCGCTAATGTTCTGAAAGAACACAAAAACTTGGCAAAGGAGTCTTTCAAATTCCTGACCAAGTACTTGGCGACATTTTCTGGTGAAGATGTGCATACGTTGAGTGAAGCCAAAGAGGAAGCTAGACGTACAATTGTGGAATTTGTGAAGGCCCCAGACATGTTTCAGTGTGATTTGCTTAATTTGCCCGCTGTAGAGCAACTGGAGAAGGATGCTAAGCATGCATTGGCATATCAGCTTTTGAAGATCTTTCTGACTCAGAGGCTGGATGCTTACTTGGAGTTTCAGGCTGCAAATTCTGATTTACTGAAAAGCTACGGTAAAGAAGATTTTGAAATCCATAATGCTATCACTTTGGGAAGTGCTATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACAGAGCCTAGAAGTGGATGAAGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTAAGCCCTCTAAACCACCCACCACCAGTAAGGACGTCCCAATTCCATGTTATTCTGATGTTATTCCATCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGAGCAAAATGCTATTCAAATTCTTGGTGCAACACAAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACATATTTGAAACCACAATTCCCAAGGAAGTTGGATTTTATGACACGGGACAAGTCATAACTTTCGAAGGGGTGTTTATTCTGGAGTTCATTTTGGAGCACACAGGTAAGCCGCCTCCCCGAATTTCAATTTTCTTTTATACTAACATGTGGTTAATGATTCAGGCACCCAATCTGGAATTTAAACTATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATGCCACTAAACATGGAGAAAGGTGGAGCTTCACAAAGGTTGTTTACGTGAAGCCCCACTACGAGGCGCAGAAGCGGAAGCGGGAGGCATCGGAGCTAGAGCATTCCAGGCCTCAATACTTGGCCAAGCGCTGGATGACCCAGGAAAAAGGTGCCTCTGGAGATAAGACGCAAGCCTTTGACGGTCATTGTGAATTCGACCCTCAGATTCTTGCAGCTCATCAAGCTTCCTCTTCATGCCCGACGAATAGTTATTTGCAAGCACATGCAAACTTCTATTCTCATACTTAA

Protein Analysis

533

Amino Acids

61.05

Weight (kDa)

5.54

Isoelectric Point (pI)

43.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 873
Acc36I ACCTGC 1 cut(s) 915
AccB1I GGYRCC 2 cut(s) 1240, 1460
AccB7I CCANNNNNTGG 1 cut(s) 1440
AccI GTMKAC 1 cut(s) 213
AciI CCGC 6 cut(s) 534, 827, 1187, 1288, 1384, 1390
AclWI GGATC 1 cut(s) 1278
AcoI YGGCCR 1 cut(s) 1431
AcsI RAATTY 9 cut(s) 4, 395, 485, 640, 1002, 1197, 1253, 1304, 1502
AcyI GRCGYC 1 cut(s) 870
AfaI GTAC 3 cut(s) 176, 410, 475
AfeI AGCGCT 1 cut(s) 1439
AfiI CCNNNNNNNGG 4 cut(s) 247, 757, 1372, 1440
AflIII ACRYGT 3 cut(s) 259, 504, 1221
AjnI CCWGG 2 cut(s) 1415, 1449
AloI GAACNNNNNNTCC 2 cut(s) 249, 281
AluBI AGCT 9 cut(s) 467, 583, 660, 725, 769, 1338, 1405, 1526, 1535
AluI AGCT 9 cut(s) 467, 583, 660, 725, 769, 1338, 1405, 1526, 1535
Alw21I GWGCWC 2 cut(s) 226, 1176
AlwI GGATC 1 cut(s) 1278
AlwNI CAGNNNCTG 1 cut(s) 610
Aor51HI AGCGCT 1 cut(s) 1439
AoxI GGCC 3 cut(s) 495, 1418, 1431
ApeKI GCWGC 4 cut(s) 635, 769, 829, 1523
ApoI RAATTY 9 cut(s) 4, 395, 485, 640, 1002, 1197, 1253, 1304, 1502
AspLEI GCGC 3 cut(s) 153, 1378, 1440
AspS9I GGNCC 1 cut(s) 496
AsuHPI GGTGA 2 cut(s) 440, 1277
AsuII TTCGAA 1 cut(s) 1140
BalI TGGCCA 1 cut(s) 1433
BanI GGYRCC 2 cut(s) 1240, 1460
BarI GAAGNNNNNNTAC 2 cut(s) 1352, 1384
BbsI GAAGAC 1 cut(s) 798
Bbv12I GWGCWC 2 cut(s) 226, 1176
BbvI GCAGC 4 cut(s) 622, 756, 841, 1535
BccI CCATC 3 cut(s) 88, 353, 910
BceAI ACGGC 1 cut(s) 819
BcgI CGANNNNNNTGC 2 cut(s) 125, 159
BciT130I CCWGG 2 cut(s) 1417, 1451
BclI TGATCA 1 cut(s) 322
BfaI CTAG 5 cut(s) 20, 468, 752, 921, 1406
BfmI CTRYAG 1 cut(s) 537
BfoI RGCGCY 1 cut(s) 1441
BfuAI ACCTGC 1 cut(s) 915
BglII AGATCT 3 cut(s) 22, 315, 591
BisI GCNGC 6 cut(s) 636, 770, 827, 830, 1187, 1524
BlpI GCTNAGC 1 cut(s) 561
BlsI GCNGC 6 cut(s) 637, 771, 828, 831, 1188, 1525
BmcAI AGTACT 1 cut(s) 410
Bme1390I CCNGG 2 cut(s) 1417, 1451
BmgT120I GGNCC 1 cut(s) 496
BmiI GGNNCC 3 cut(s) 498, 1242, 1462
BmrFI CCNGG 2 cut(s) 1417, 1451
BmsI GCATC 4 cut(s) 547, 604, 1074, 1406
BpiI GAAGAC 1 cut(s) 798
BpmI CTGGAG 6 cut(s) 110, 206, 569, 1068, 1178, 1488
Bpu10I CCTNAGC 1 cut(s) 837
Bpu1102I GCTNAGC 1 cut(s) 561
Bpu14I TTCGAA 1 cut(s) 1140
BpuEI CTTGAG 2 cut(s) 47, 238
BsaAI YACGTR 1 cut(s) 1357
BsaHI GRCGYC 1 cut(s) 870
BsaJI CCNNGG 3 cut(s) 241, 1098, 1449
BsaWI WCCGGW 1 cut(s) 1267
BsaXI ACNNNNNCTCC 2 cut(s) 1041, 1071
Bsc4I CCNNNNNNNGG 4 cut(s) 247, 757, 1372, 1440
Bse118I RCCGGY 1 cut(s) 201
Bse1I ACTGG 4 cut(s) 93, 189, 552, 861
Bse3DI GCAATG 2 cut(s) 58, 146
BseBI CCWGG 2 cut(s) 1417, 1451
BseDI CCNNGG 3 cut(s) 241, 1098, 1449
BseGI GGATG 6 cut(s) 264, 562, 619, 766, 902, 1449
BseLI CCNNNNNNNGG 4 cut(s) 247, 757, 1372, 1440
BseMI GCAATG 2 cut(s) 58, 146
BseMII CTCAG 2 cut(s) 617, 1526
BseNI ACTGG 4 cut(s) 93, 189, 552, 861
BseRI GAGGAG 2 cut(s) 794, 797
BseXI GCAGC 4 cut(s) 622, 756, 841, 1535
BshFI GGCC 3 cut(s) 497, 1420, 1433
BshNI GGYRCC 2 cut(s) 1240, 1460
BsiHKAI GWGCWC 2 cut(s) 226, 1176
BsiSI CCGG 2 cut(s) 202, 1268
BslFI GGGAC 3 cut(s) 857, 896, 1137
BslI CCNNNNNNNGG 4 cut(s) 247, 757, 1372, 1440
BsmFI GGGAC 3 cut(s) 857, 896, 1137
BsmI GAATGC 1 cut(s) 1411
BsnI GGCC 3 cut(s) 497, 1420, 1433
Bsp119I TTCGAA 1 cut(s) 1140
Bsp1286I GDGCHC 2 cut(s) 226, 1176
Bsp1407I TGTACA 1 cut(s) 174
Bsp143I GATC 5 cut(s) 22, 315, 322, 591, 1270
Bsp1720I GCTNAGC 1 cut(s) 561
Bsp19I CCATGG 1 cut(s) 241
BspACI CCGC 6 cut(s) 534, 827, 1187, 1288, 1384, 1390
BspANI GGCC 3 cut(s) 497, 1420, 1433
BspCNI CTCAG 2 cut(s) 616, 1525
BspLI GGNNCC 3 cut(s) 498, 1242, 1462
BspMI ACCTGC 1 cut(s) 915
BspPI GGATC 1 cut(s) 1278
BspQI GCTCTTC 1 cut(s) 759
BspT104I TTCGAA 1 cut(s) 1140
BspT107I GGYRCC 2 cut(s) 1240, 1460
BsrDI GCAATG 2 cut(s) 58, 146
BsrFI RCCGGY 1 cut(s) 201
BsrGI TGTACA 1 cut(s) 174
BsrI ACTGG 4 cut(s) 93, 189, 552, 861
BssAI RCCGGY 1 cut(s) 201
BssECI CCNNGG 3 cut(s) 241, 1098, 1449
BssMI GATC 5 cut(s) 22, 315, 322, 591, 1270
BssNI GRCGYC 1 cut(s) 870
BssT1I CCWWGG 2 cut(s) 241, 1098
Bst2UI CCWGG 2 cut(s) 1417, 1451
Bst4CI ACNGT 3 cut(s) 43, 665, 1493
Bst6I CTCTTC 4 cut(s) 294, 759, 942, 1546
BstACI GRCGYC 1 cut(s) 870
BstAUI TGTACA 1 cut(s) 174
BstBAI YACGTR 1 cut(s) 1357
BstBI TTCGAA 1 cut(s) 1140
BstC8I GCNNGC 5 cut(s) 144, 534, 567, 1482, 1569
BstDEI CTNAG 5 cut(s) 208, 561, 603, 837, 1512
BstDSI CCRYGG 1 cut(s) 241
BstF5I GGATG 6 cut(s) 264, 562, 619, 766, 902, 1449
BstH2I RGCGCY 1 cut(s) 1441
BstHHI GCGC 3 cut(s) 153, 1378, 1440
BstKTI GATC 5 cut(s) 25, 318, 325, 594, 1273
BstMBI GATC 5 cut(s) 22, 315, 322, 591, 1270
BstMWI GCNNNNNNNGC 6 cut(s) 148, 529, 566, 838, 1417, 1532
BstNI CCWGG 2 cut(s) 1417, 1451
BstNSI RCATGY 6 cut(s) 263, 508, 569, 799, 1225, 1577
BstSCI CCNGG 2 cut(s) 1415, 1449
BstSFI CTRYAG 1 cut(s) 537
BstV1I GCAGC 4 cut(s) 622, 756, 841, 1535
BstV2I GAAGAC 1 cut(s) 798
BstX2I RGATCY 3 cut(s) 22, 315, 591
BstXI CCANNNNNNTGG 1 cut(s) 412
BstYI RGATCY 3 cut(s) 22, 315, 591
BsuRI GGCC 3 cut(s) 497, 1420, 1433
BtgI CCRYGG 1 cut(s) 241
BtgZI GCGATG 1 cut(s) 331
BtsCI GGATG 6 cut(s) 264, 562, 619, 766, 902, 1449
BtsIMutI CAGTG 4 cut(s) 39, 86, 252, 518
BveI ACCTGC 1 cut(s) 915
Cac8I GCNNGC 5 cut(s) 144, 534, 567, 1482, 1569
CaiI CAGNNNCTG 1 cut(s) 610
CfoI GCGC 3 cut(s) 153, 1378, 1440
Cfr10I RCCGGY 1 cut(s) 201
Cfr13I GGNCC 1 cut(s) 496
CseI GACGC 1 cut(s) 1486
Csp6I GTAC 3 cut(s) 175, 409, 474
CviQI GTAC 3 cut(s) 175, 409, 474
DdeI CTNAG 5 cut(s) 208, 561, 603, 837, 1512
DpnI GATC 5 cut(s) 24, 317, 324, 593, 1272
DpnII GATC 5 cut(s) 22, 315, 322, 591, 1270
DraI TTTAAA 1 cut(s) 1258
EaeI YGGCCR 1 cut(s) 1431
Eam1104I CTCTTC 4 cut(s) 294, 759, 942, 1546
EarI CTCTTC 4 cut(s) 294, 759, 942, 1546
Eco130I CCWWGG 2 cut(s) 241, 1098
Eco147I AGGCCT 1 cut(s) 1420
Eco47III AGCGCT 1 cut(s) 1439
EcoO109I RGGNCCY 1 cut(s) 496
EcoRI GAATTC 1 cut(s) 1502
EcoRII CCWGG 2 cut(s) 1415, 1449
EcoT14I CCWWGG 2 cut(s) 241, 1098
EcoT22I ATGCAT 1 cut(s) 571
ErhI CCWWGG 2 cut(s) 241, 1098
FaqI GGGAC 3 cut(s) 857, 896, 1137
FauI CCCGC 2 cut(s) 541, 1383
FbaI TGATCA 1 cut(s) 322
FblI GTMKAC 1 cut(s) 213
Fnu4HI GCNGC 6 cut(s) 636, 770, 827, 830, 1187, 1524
FokI GGATG 6 cut(s) 251, 569, 626, 773, 889, 1456
Fsp4HI GCNGC 6 cut(s) 636, 770, 827, 830, 1187, 1524
FspBI CTAG 5 cut(s) 20, 468, 752, 921, 1406
GlaI GCGC 3 cut(s) 152, 1377, 1439
GluI GCNGC 6 cut(s) 636, 770, 827, 830, 1187, 1524
GsuI CTGGAG 6 cut(s) 110, 206, 569, 1068, 1178, 1488
HaeII RGCGCY 1 cut(s) 1441
HaeIII GGCC 3 cut(s) 497, 1420, 1433
HapII CCGG 2 cut(s) 202, 1268
HgaI GACGC 1 cut(s) 1486
HhaI GCGC 3 cut(s) 153, 1378, 1440
Hin1I GRCGYC 1 cut(s) 870
Hin6I GCGC 3 cut(s) 151, 1376, 1438
HinP1I GCGC 3 cut(s) 151, 1376, 1438
HindIII AAGCTT 1 cut(s) 1533
HinfI GANTC 6 cut(s) 386, 601, 934, 1027, 1234, 1516
HpaII CCGG 2 cut(s) 202, 1268
HphI GGTGA 2 cut(s) 440, 1277
Hpy166II GTNNAC 2 cut(s) 214, 1354
Hpy188III TCNNGA 8 cut(s) 20, 26, 77, 400, 1031, 1157, 1250, 1467
Hpy8I GTNNAC 2 cut(s) 214, 1354
Hpy99I CGWCG 1 cut(s) 1555
HpyAV CCTTC 9 cut(s) 26, 241, 279, 487, 547, 985, 1030, 1055, 1136
HpyCH4III ACNGT 3 cut(s) 43, 665, 1493
HpyCH4IV ACGT 4 cut(s) 443, 472, 870, 1356
HpyF10VI GCNNNNNNNGC 6 cut(s) 148, 529, 566, 838, 1417, 1532
HpyF3I CTNAG 5 cut(s) 208, 561, 603, 837, 1512
HpySE526I ACGT 4 cut(s) 443, 472, 870, 1356
Hsp92I GRCGYC 1 cut(s) 870
HspAI GCGC 3 cut(s) 151, 1376, 1438
Ksp22I TGATCA 1 cut(s) 322
Kzo9I GATC 5 cut(s) 22, 315, 322, 591, 1270
LguI GCTCTTC 1 cut(s) 759
LmnI GCTCC 5 cut(s) 722, 985, 1171, 1335, 1402
Lsp1109I GCAGC 4 cut(s) 622, 756, 841, 1535
LweI GCATC 4 cut(s) 547, 604, 1074, 1406
MaeI CTAG 5 cut(s) 20, 468, 752, 921, 1406
MaeII ACGT 4 cut(s) 443, 472, 870, 1356
MaeIII GTNAC 2 cut(s) 58, 250
MalI GATC 5 cut(s) 24, 317, 324, 593, 1272
MboI GATC 5 cut(s) 22, 315, 322, 591, 1270
MfeI CAATTG 1 cut(s) 477
MflI RGATCY 3 cut(s) 22, 315, 591
MhlI GDGCHC 2 cut(s) 226, 1176
MlsI TGGCCA 1 cut(s) 1433
MluNI TGGCCA 1 cut(s) 1433
MlyI GAGTC 2 cut(s) 395, 595
MmeI TCCRAC 2 cut(s) 700, 1087
Mox20I TGGCCA 1 cut(s) 1433
Mph1103I ATGCAT 1 cut(s) 571
MscI TGGCCA 1 cut(s) 1433
MseI TTAA 6 cut(s) 155, 228, 525, 1229, 1257, 1597
Msp20I TGGCCA 1 cut(s) 1433
MspA1I CMGCKG 1 cut(s) 536
MspI CCGG 2 cut(s) 202, 1268
MspR9I CCNGG 2 cut(s) 1417, 1451
MunI CAATTG 1 cut(s) 477
Mva1269I GAATGC 1 cut(s) 1411
MvaI CCWGG 2 cut(s) 1417, 1451
MwoI GCNNNNNNNGC 6 cut(s) 148, 529, 566, 838, 1417, 1532
NcoI CCATGG 1 cut(s) 241
NdeII GATC 5 cut(s) 22, 315, 322, 591, 1270
NlaIV GGNNCC 3 cut(s) 498, 1242, 1462
NmuCI GTSAC 1 cut(s) 250
NsiI ATGCAT 1 cut(s) 571
NspI RCATGY 6 cut(s) 263, 508, 569, 799, 1225, 1577
NspV TTCGAA 1 cut(s) 1140
PaeI GCATGC 1 cut(s) 569
PceI AGGCCT 1 cut(s) 1420
PciI ACATGT 3 cut(s) 259, 504, 1221
PciSI GCTCTTC 1 cut(s) 759
PctI GAATGC 1 cut(s) 1411
PfeI GAWTC 4 cut(s) 934, 1027, 1234, 1516
PflMI CCANNNNNTGG 1 cut(s) 1440
PkrI GCNGC 6 cut(s) 637, 771, 828, 831, 1188, 1525
PleI GAGTC 2 cut(s) 394, 595
PpsI GAGTC 2 cut(s) 394, 595
Ppu21I YACGTR 1 cut(s) 1357
PscI ACATGT 3 cut(s) 259, 504, 1221
Psp6I CCWGG 2 cut(s) 1415, 1449
PspGI CCWGG 2 cut(s) 1415, 1449
PspN4I GGNNCC 3 cut(s) 498, 1242, 1462
PspPI GGNCC 1 cut(s) 496
PstNI CAGNNNCTG 1 cut(s) 610
PsuI RGATCY 3 cut(s) 22, 315, 591
RsaI GTAC 3 cut(s) 176, 410, 475
RsaNI GTAC 3 cut(s) 175, 409, 474
SapI GCTCTTC 1 cut(s) 759
SaqAI TTAA 6 cut(s) 155, 228, 525, 1229, 1257, 1597
SatI GCNGC 6 cut(s) 636, 770, 827, 830, 1187, 1524
Sau3AI GATC 5 cut(s) 22, 315, 322, 591, 1270
Sau96I GGNCC 1 cut(s) 496
ScaI AGTACT 1 cut(s) 410
SchI GAGTC 2 cut(s) 395, 595
ScrFI CCNGG 2 cut(s) 1417, 1451
SduI GDGCHC 2 cut(s) 226, 1176
SfaNI GCATC 4 cut(s) 547, 604, 1074, 1406
SfcI CTRYAG 1 cut(s) 537
SfuI TTCGAA 1 cut(s) 1140
SmlI CTYRAG 2 cut(s) 26, 217
SmoI CTYRAG 2 cut(s) 26, 217
SphI GCATGC 1 cut(s) 569
SseBI AGGCCT 1 cut(s) 1420
SsiI CCGC 6 cut(s) 534, 827, 1187, 1288, 1384, 1390
SspI AATATT 1 cut(s) 310
SspMI CTAG 5 cut(s) 20, 468, 752, 921, 1406
StuI AGGCCT 1 cut(s) 1420
StyD4I CCNGG 2 cut(s) 1415, 1449
StyI CCWWGG 2 cut(s) 241, 1098
TaaI ACNGT 3 cut(s) 43, 665, 1493
TaiI ACGT 4 cut(s) 446, 475, 873, 1359
TaqI TCGA 2 cut(s) 1140, 1506
TatI WGTACW 2 cut(s) 174, 408
TauI GCSGC 2 cut(s) 829, 1189
TfiI GAWTC 4 cut(s) 934, 1027, 1234, 1516
Tru1I TTAA 6 cut(s) 155, 228, 525, 1229, 1257, 1597
Tru9I TTAA 6 cut(s) 155, 228, 525, 1229, 1257, 1597
TscAI CASTG 4 cut(s) 46, 93, 259, 518
TseFI GTSAC 1 cut(s) 250
TseI GCWGC 4 cut(s) 635, 769, 829, 1523
Tsp45I GTSAC 1 cut(s) 250
TspDTI ATGAA 5 cut(s) 17, 96, 777, 1153, 1533
TspRI CASTG 4 cut(s) 46, 93, 259, 518
Van91I CCANNNNNTGG 1 cut(s) 1440
XapI RAATTY 9 cut(s) 4, 395, 485, 640, 1002, 1197, 1253, 1304, 1502
XbaI TCTAGA 1 cut(s) 19
XceI RCATGY 6 cut(s) 263, 508, 569, 799, 1225, 1577
XmiI GTMKAC 1 cut(s) 213
XspI CTAG 5 cut(s) 20, 468, 752, 921, 1406
ZraI GACGTC 1 cut(s) 871
ZrmI AGTACT 1 cut(s) 410
Zsp2I ATGCAT 1 cut(s) 571
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.