pycom17g16620

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
14688621 .. 14693610
4990 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 969 bp
ATGAAATGGGAAAGCATGTGCAAGGTTTTGGTCCAAAGGGCTAAAGGAGCAAAAAGATGCATTTTGGAGACTTTTGGAGCACTTTTGGTGGAGCCAAAGTGTTGGAACCTTGTTCTCTTTAGTTTTAGGACATTTAAACCTTTCCTAATCCCAATCATGCCATGCATAACACACATCCATTCTAACACTTTGTCATTGTGTTTCTTTGATTTCAATGCTATCACTTTGGGAAGTGCTATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGAGGAAGAGCTGCTAATTGAGGAGGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTAAGCCCTCTAAACCACCCACCACCAGTAAGGACGTCCCAATTCCATGTTATTCTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAGAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAAAATGCTATTCAAATTCTTGGTGCAACACAAAGAATGATTCAAGAGAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACATATTTGAAACCACAATTCCCAAGGAAGTTGGATTTTATGACACGGGACAAGTCATAACTTTCGAAGGGGTGTTTATTCTACAGTTCATTTTGGAGCACACAGGTAAGCCGCCTCCCCGAATTTCAATTTTCTTTTATACTAACATGTGGTTAATGATTCAGGCACCCAATCTGGAATTTAAACTATTACCAGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATAGAAACTCACGGCTAGAGAAGGAATGGAGTGTTTGTGTTGCAAGGGTATTTGATAGGAGCATATTTATGCGACTTAAATGGCTTGTTCTCGTACATTTACGTTATGTTTCTTTAGTTATTTTAGTACTTTAA

Protein Analysis

323

Amino Acids

37.25

Weight (kDa)

6.52

Isoelectric Point (pI)

44.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 399
Acc36I ACCTGC 1 cut(s) 441
AccB1I GGYRCC 1 cut(s) 766
AciI CCGC 3 cut(s) 353, 713, 814
AcsI RAATTY 4 cut(s) 528, 723, 779, 830
AcyI GRCGYC 1 cut(s) 396
AfaI GTAC 2 cut(s) 930, 963
AfiI CCNNNNNNNGG 1 cut(s) 283
AflIII ACRYGT 1 cut(s) 747
AgsI TTSAA 7 cut(s) 214, 527, 557, 611, 729, 805, 823
AluBI AGCT 2 cut(s) 251, 295
AluI AGCT 2 cut(s) 251, 295
Alw21I GWGCWC 2 cut(s) 82, 702
Alw26I GTCTC 1 cut(s) 62
ApeKI GCWGC 2 cut(s) 295, 355
ApoI RAATTY 4 cut(s) 528, 723, 779, 830
AspS9I GGNCC 1 cut(s) 31
AsuHPI GGTGA 1 cut(s) 803
AsuII TTCGAA 1 cut(s) 666
AvaII GGWCC 1 cut(s) 31
BanI GGYRCC 1 cut(s) 766
BbsI GAAGAC 1 cut(s) 324
Bbv12I GWGCWC 2 cut(s) 82, 702
BbvI GCAGC 2 cut(s) 282, 367
BceAI ACGGC 2 cut(s) 345, 863
BcoDI GTCTC 1 cut(s) 62
BfaI CTAG 3 cut(s) 278, 447, 851
BfmI CTRYAG 1 cut(s) 683
BfuAI ACCTGC 1 cut(s) 441
BisI GCNGC 4 cut(s) 296, 353, 356, 713
BlsI GCNGC 4 cut(s) 297, 354, 357, 714
BmcAI AGTACT 1 cut(s) 963
Bme18I GGWCC 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 31
BmiI GGNNCC 3 cut(s) 93, 107, 768
BmsI GCATC 2 cut(s) 47, 600
BpiI GAAGAC 1 cut(s) 324
BpmI CTGGAG 1 cut(s) 594
Bpu10I CCTNAGC 1 cut(s) 363
Bpu14I TTCGAA 1 cut(s) 666
BsaHI GRCGYC 1 cut(s) 396
BsaJI CCNNGG 1 cut(s) 624
BsaXI ACNNNNNCTCC 6 cut(s) 83, 113, 567, 597, 856, 886
Bsc4I CCNNNNNNNGG 1 cut(s) 283
Bse1I ACTGG 1 cut(s) 387
BseDI CCNNGG 1 cut(s) 624
BseGI GGATG 1 cut(s) 174
BseLI CCNNNNNNNGG 1 cut(s) 283
BseNI ACTGG 1 cut(s) 387
BseRI GAGGAG 2 cut(s) 320, 323
BseXI GCAGC 2 cut(s) 282, 367
BshNI GGYRCC 1 cut(s) 766
BsiHKAI GWGCWC 2 cut(s) 82, 702
BslFI GGGAC 3 cut(s) 383, 422, 663
BslI CCNNNNNNNGG 1 cut(s) 283
BsmAI GTCTC 1 cut(s) 62
BsmFI GGGAC 3 cut(s) 383, 422, 663
Bsp119I TTCGAA 1 cut(s) 666
Bsp1286I GDGCHC 2 cut(s) 82, 702
Bsp143I GATC 1 cut(s) 796
BspACI CCGC 3 cut(s) 353, 713, 814
BspLI GGNNCC 3 cut(s) 93, 107, 768
BspMI ACCTGC 1 cut(s) 441
BspQI GCTCTTC 1 cut(s) 285
BspT104I TTCGAA 1 cut(s) 666
BspT107I GGYRCC 1 cut(s) 766
BsrI ACTGG 1 cut(s) 387
BssECI CCNNGG 1 cut(s) 624
BssMI GATC 1 cut(s) 796
BssNI GRCGYC 1 cut(s) 396
BssT1I CCWWGG 1 cut(s) 624
Bst4CI ACNGT 1 cut(s) 687
Bst6I CTCTTC 2 cut(s) 285, 468
BstACI GRCGYC 1 cut(s) 396
BstBI TTCGAA 1 cut(s) 666
BstDEI CTNAG 1 cut(s) 363
BstF5I GGATG 1 cut(s) 174
BstKTI GATC 1 cut(s) 799
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 1 cut(s) 796
BstMWI GCNNNNNNNGC 2 cut(s) 47, 364
BstNSI RCATGY 3 cut(s) 19, 325, 751
BstSFI CTRYAG 1 cut(s) 683
BstV1I GCAGC 2 cut(s) 282, 367
BstV2I GAAGAC 1 cut(s) 324
BstXI CCANNNNNNTGG 1 cut(s) 102
BtsCI GGATG 1 cut(s) 174
BveI ACCTGC 1 cut(s) 441
Cfr13I GGNCC 1 cut(s) 31
Csp6I GTAC 2 cut(s) 929, 962
CviAII CATG 6 cut(s) 16, 157, 162, 322, 408, 748
CviQI GTAC 2 cut(s) 929, 962
DdeI CTNAG 1 cut(s) 363
DpnI GATC 1 cut(s) 798
DpnII GATC 1 cut(s) 796
DraI TTTAAA 2 cut(s) 136, 784
Eam1104I CTCTTC 2 cut(s) 285, 468
EarI CTCTTC 2 cut(s) 285, 468
Eco130I CCWWGG 1 cut(s) 624
Eco47I GGWCC 1 cut(s) 31
EcoT14I CCWWGG 1 cut(s) 624
EcoT22I ATGCAT 2 cut(s) 62, 167
ErhI CCWWGG 1 cut(s) 624
FaeI CATG 6 cut(s) 19, 160, 165, 325, 411, 751
FaqI GGGAC 3 cut(s) 383, 422, 663
FatI CATG 6 cut(s) 15, 156, 161, 321, 407, 747
Fnu4HI GCNGC 4 cut(s) 296, 353, 356, 713
FokI GGATG 1 cut(s) 161
Fsp4HI GCNGC 4 cut(s) 296, 353, 356, 713
FspBI CTAG 3 cut(s) 278, 447, 851
GluI GCNGC 4 cut(s) 296, 353, 356, 713
GsuI CTGGAG 1 cut(s) 594
Hin1I GRCGYC 1 cut(s) 396
Hin1II CATG 6 cut(s) 19, 160, 165, 325, 411, 751
HinfI GANTC 3 cut(s) 460, 553, 760
HphI GGTGA 1 cut(s) 803
Hpy188I TCNGA 1 cut(s) 418
Hpy188III TCNNGA 2 cut(s) 557, 776
HpyAV CCTTC 5 cut(s) 511, 556, 581, 662, 850
HpyCH4III ACNGT 1 cut(s) 687
HpyCH4IV ACGT 2 cut(s) 396, 937
HpyCH4V TGCA 7 cut(s) 21, 60, 165, 325, 514, 539, 878
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 364
HpyF3I CTNAG 1 cut(s) 363
HpySE526I ACGT 2 cut(s) 396, 937
Hsp92I GRCGYC 1 cut(s) 396
Hsp92II CATG 6 cut(s) 19, 160, 165, 325, 411, 751
Kzo9I GATC 1 cut(s) 796
LguI GCTCTTC 1 cut(s) 285
LmnI GCTCC 6 cut(s) 47, 77, 91, 248, 697, 894
LpnPI CCDG 7 cut(s) 400, 436, 558, 690, 749, 761, 807
Lsp1109I GCAGC 2 cut(s) 282, 367
LweI GCATC 2 cut(s) 47, 600
MaeI CTAG 3 cut(s) 278, 447, 851
MaeII ACGT 2 cut(s) 396, 937
MalI GATC 1 cut(s) 798
MboI GATC 1 cut(s) 796
MboII GAAGA 5 cut(s) 302, 326, 329, 485, 590
MhlI GDGCHC 2 cut(s) 82, 702
MluCI AATT 8 cut(s) 300, 402, 528, 618, 723, 729, 779, 830
MmeI TCCRAC 3 cut(s) 83, 226, 613
MnlI CCTC 8 cut(s) 235, 280, 298, 301, 304, 379, 592, 726
Mph1103I ATGCAT 2 cut(s) 62, 167
MseI TTAA 5 cut(s) 135, 755, 783, 912, 967
MslI CAYNNNNRTG 1 cut(s) 902
MwoI GCNNNNNNNGC 2 cut(s) 47, 364
NdeII GATC 1 cut(s) 796
NlaIII CATG 6 cut(s) 19, 160, 165, 325, 411, 751
NlaIV GGNNCC 3 cut(s) 93, 107, 768
NsiI ATGCAT 2 cut(s) 62, 167
NspI RCATGY 3 cut(s) 19, 325, 751
NspV TTCGAA 1 cut(s) 666
PciI ACATGT 1 cut(s) 747
PciSI GCTCTTC 1 cut(s) 285
PfeI GAWTC 3 cut(s) 460, 553, 760
PkrI GCNGC 4 cut(s) 297, 354, 357, 714
PscI ACATGT 1 cut(s) 747
PspN4I GGNNCC 3 cut(s) 93, 107, 768
PspPI GGNCC 1 cut(s) 31
RsaI GTAC 2 cut(s) 930, 963
RsaNI GTAC 2 cut(s) 929, 962
RseI CAYNNNNRTG 1 cut(s) 902
SapI GCTCTTC 1 cut(s) 285
SaqAI TTAA 5 cut(s) 135, 755, 783, 912, 967
SatI GCNGC 4 cut(s) 296, 353, 356, 713
Sau3AI GATC 1 cut(s) 796
Sau96I GGNCC 1 cut(s) 31
ScaI AGTACT 1 cut(s) 963
SduI GDGCHC 2 cut(s) 82, 702
SfaNI GCATC 2 cut(s) 47, 600
SfcI CTRYAG 1 cut(s) 683
SfuI TTCGAA 1 cut(s) 666
SinI GGWCC 1 cut(s) 31
SmiMI CAYNNNNRTG 1 cut(s) 902
Sse9I AATT 8 cut(s) 300, 402, 528, 618, 723, 729, 779, 830
SsiI CCGC 3 cut(s) 353, 713, 814
SspMI CTAG 3 cut(s) 278, 447, 851
StyI CCWWGG 1 cut(s) 624
TaaI ACNGT 1 cut(s) 687
TaiI ACGT 2 cut(s) 399, 940
TaqI TCGA 1 cut(s) 666
TasI AATT 8 cut(s) 300, 402, 528, 618, 723, 729, 779, 830
TatI WGTACW 1 cut(s) 961
TauI GCSGC 2 cut(s) 355, 715
TfiI GAWTC 3 cut(s) 460, 553, 760
Tru1I TTAA 5 cut(s) 135, 755, 783, 912, 967
Tru9I TTAA 5 cut(s) 135, 755, 783, 912, 967
TseI GCWGC 2 cut(s) 295, 355
TspDTI ATGAA 2 cut(s) 17, 679
VpaK11BI GGWCC 1 cut(s) 31
XapI RAATTY 4 cut(s) 528, 723, 779, 830
XceI RCATGY 3 cut(s) 19, 325, 751
XspI CTAG 3 cut(s) 278, 447, 851
ZraI GACGTC 1 cut(s) 397
ZrmI AGTACT 1 cut(s) 963
Zsp2I ATGCAT 2 cut(s) 62, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.