pycom17g17660

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
15279464 .. 15280899
1436 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1260 bp
ATGTGTGGAAAAGAACCCCTTGGCTATTCCATCATCCATATTTTCATCACATTCATATTTACATTTTTGTTCAATTTAATTAGAAATCAATTTAGTTTATGTTTTAAAGTATTTTTGAATTCTTTGACCCTCCTAATCCCCGGTCCAGAACGATCCCTACTTATACTTATACTACAATTGTCAAAAAGAGGGTTTAATTTGTGCGCGTATAAATTCCCGCATCAAATTTTGGCGCCGTTGCCGGGGATTAGAAAATTTGCTAATCCCTTGGATTGTTTGTTTCTGTATTGTCTTTTAGATTTAGTTTTTATTTGTGTTTTGTTTGTTAAGAACAACATGGCACTTGATAACGCTTCTCTTTTGTCACAGCTCATGGAAAGGTCCCAAATGCAAAGAGTTGATATATCTAATCTTCAATCAAGGAATAACGTGTTTTCCAATACTTACAATTCGGATTGGAGTGATCATTCAAACTCTATGTGGTGGGAACCTCAAAATGCTCAACAAGGAGGATATTGGCAGCCACCACAACCTCATATTCAATATGCCCAACCAAACTCAAGTTCGTCAATAGATTATAATCAAAAGCTTAATGAATTAATTTGTTTGGTGCAGGGCTCACAAAATCAAGACAATGAGGCTCAACAAGAAGGATATTGGTTGGACCACTTGGATAAGCAAATTGGACAGATCGCGGAGTTTGTAGGACAGTTTCGAGACCAAGGCGAACTCCCTAGTTCAACAATTGTAAATCCGAAGGGAGGATTTGAAGCACCTTTGCCGGAAGCACTTATTGCTCCTACGCCATCTAATTCAAGTAAGGTTGTTCCAATTAGTTCTAACCCCATTCCACCTAATATCCCTATTCCTTGCAGGTTCATGAATTCCAAGGAAGAAGAAAGTGAAAAAGACATCTTGGAAGACCTTCCAAAGGTGCAAAGTAGGGAATTTCATGAATTCATCAAAGGGGATATACTTGAGACAACAATGCCCAAAGAAGTTGAATTTGATGACATTGGACAAGTCATAACCATCACATGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTGTCAGACAAAACAAGTAAGTCATTTTTTTCAAATTCCATTACATTTTATACTAACTTGTTGTTTTTTATGAATCAGGCACCTACATTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGACCAATTCCATGCCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

420

Amino Acids

47.9

Weight (kDa)

5.43

Isoelectric Point (pI)

44.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 579
Acc36I ACCTGC 1 cut(s) 864
AccB1I GGYRCC 2 cut(s) 232, 1180
AccII CGCG 2 cut(s) 206, 695
AciI CCGC 2 cut(s) 218, 695
AclWI GGATC 1 cut(s) 147
AcoI YGGCCR 1 cut(s) 1047
AcyI GRCGYC 1 cut(s) 233
AfiI CCNNNNNNNGG 3 cut(s) 242, 761, 931
AflIII ACRYGT 1 cut(s) 429
AjuI GAANNNNNNNTTGG 2 cut(s) 547, 579
AluBI AGCT 2 cut(s) 370, 589
AluI AGCT 2 cut(s) 370, 589
Alw26I GTCTC 2 cut(s) 711, 974
AlwI GGATC 1 cut(s) 147
AoxI GGCC 1 cut(s) 1047
ApeKI GCWGC 1 cut(s) 520
AseI ATTAAT 1 cut(s) 599
Asp700I GAANNNNTTC 1 cut(s) 924
AspLEI GCGC 2 cut(s) 206, 235
AspS9I GGNCC 4 cut(s) 143, 381, 664, 1240
AsuC2I CCSGG 2 cut(s) 141, 243
AsuHPI GGTGA 1 cut(s) 1217
AvaII GGWCC 4 cut(s) 143, 381, 664, 1240
BalI TGGCCA 1 cut(s) 1049
BanI GGYRCC 2 cut(s) 232, 1180
BanII GRGCYC 1 cut(s) 620
BbsI GAAGAC 1 cut(s) 927
BbvI GCAGC 1 cut(s) 532
BccI CCATC 3 cut(s) 38, 814, 1040
BceAI ACGGC 2 cut(s) 220, 1238
BclI TGATCA 1 cut(s) 463
BcnI CCSGG 2 cut(s) 141, 243
BcoDI GTCTC 2 cut(s) 711, 974
BfaI CTAG 1 cut(s) 735
BfoI RGCGCY 1 cut(s) 236
BfuAI ACCTGC 1 cut(s) 864
BisI GCNGC 1 cut(s) 521
BlsI GCNGC 1 cut(s) 522
Bme1390I CCNGG 2 cut(s) 141, 243
Bme18I GGWCC 4 cut(s) 143, 381, 664, 1240
BmgT120I GGNCC 4 cut(s) 143, 381, 664, 1240
BmiI GGNNCC 4 cut(s) 234, 383, 489, 1182
BmrFI CCNGG 2 cut(s) 141, 243
BmsI GCATC 1 cut(s) 229
BpiI GAAGAC 1 cut(s) 927
BpuEI CTTGAG 2 cut(s) 544, 998
BpuMI CCSGG 2 cut(s) 141, 243
BsaBI GATNNNNATC 1 cut(s) 579
BsaHI GRCGYC 1 cut(s) 233
BsaI GGTCTC 1 cut(s) 711
BsaJI CCNNGG 6 cut(s) 19, 139, 242, 267, 721, 888
Bsc4I CCNNNNNNNGG 3 cut(s) 242, 761, 931
Bse118I RCCGGY 1 cut(s) 1207
Bse8I GATNNNNATC 1 cut(s) 579
BseDI CCNNGG 6 cut(s) 19, 139, 242, 267, 721, 888
BseGI GGATG 1 cut(s) 33
BseJI GATNNNNATC 1 cut(s) 579
BseLI CCNNNNNNNGG 3 cut(s) 242, 761, 931
BseXI GCAGC 1 cut(s) 532
BsgI GTGCAG 1 cut(s) 632
Bsh1236I CGCG 2 cut(s) 206, 695
BshFI GGCC 1 cut(s) 1049
BshNI GGYRCC 2 cut(s) 232, 1180
BsiSI CCGG 4 cut(s) 141, 242, 782, 1208
BslFI GGGAC 1 cut(s) 367
BslI CCNNNNNNNGG 3 cut(s) 242, 761, 931
BsmAI GTCTC 2 cut(s) 711, 974
BsmFI GGGAC 1 cut(s) 367
BsnI GGCC 1 cut(s) 1049
Bso31I GGTCTC 1 cut(s) 711
Bsp1286I GDGCHC 1 cut(s) 620
Bsp143I GATC 3 cut(s) 152, 463, 690
BspACI CCGC 2 cut(s) 218, 695
BspANI GGCC 1 cut(s) 1049
BspFNI CGCG 2 cut(s) 206, 695
BspHI TCATGA 2 cut(s) 879, 952
BspLI GGNNCC 4 cut(s) 234, 383, 489, 1182
BspMI ACCTGC 1 cut(s) 864
BspPI GGATC 1 cut(s) 147
BspT107I GGYRCC 2 cut(s) 232, 1180
BspTNI GGTCTC 1 cut(s) 711
BsrFI RCCGGY 1 cut(s) 1207
BssAI RCCGGY 1 cut(s) 1207
BssECI CCNNGG 6 cut(s) 19, 139, 242, 267, 721, 888
BssMI GATC 3 cut(s) 152, 463, 690
BssNI GRCGYC 1 cut(s) 233
BssT1I CCWWGG 4 cut(s) 19, 267, 721, 888
Bst4CI ACNGT 1 cut(s) 711
BstACI GRCGYC 1 cut(s) 233
BstAPI GCANNNNNTGC 1 cut(s) 794
BstENI CCTNNNNNAGG 1 cut(s) 929
BstF5I GGATG 1 cut(s) 33
BstFNI CGCG 2 cut(s) 206, 695
BstH2I RGCGCY 1 cut(s) 236
BstHHI GCGC 2 cut(s) 206, 235
BstKTI GATC 3 cut(s) 155, 466, 693
BstMAI GTCTC 2 cut(s) 711, 974
BstMBI GATC 3 cut(s) 152, 463, 690
BstMWI GCNNNNNNNGC 1 cut(s) 794
BstNSI RCATGY 1 cut(s) 1041
BstSCI CCNGG 2 cut(s) 139, 241
BstUI CGCG 2 cut(s) 206, 695
BstV1I GCAGC 1 cut(s) 532
BstV2I GAAGAC 1 cut(s) 927
BsuRI GGCC 1 cut(s) 1049
BtsCI GGATG 1 cut(s) 33
BveI ACCTGC 1 cut(s) 864
CciI TCATGA 2 cut(s) 879, 952
CfoI GCGC 2 cut(s) 206, 235
Cfr10I RCCGGY 1 cut(s) 1207
Cfr13I GGNCC 4 cut(s) 143, 381, 664, 1240
CviAII CATG 6 cut(s) 337, 373, 880, 953, 1038, 1250
CviJI RGCY 7 cut(s) 24, 370, 523, 589, 618, 641, 1049
CviKI_1 RGCY 7 cut(s) 24, 370, 523, 589, 618, 641, 1049
DinI GGCGCC 1 cut(s) 234
DpnI GATC 3 cut(s) 154, 465, 692
DpnII GATC 3 cut(s) 152, 463, 690
DraI TTTAAA 1 cut(s) 106
EaeI YGGCCR 1 cut(s) 1047
Eco130I CCWWGG 4 cut(s) 19, 267, 721, 888
Eco24I GRGCYC 1 cut(s) 620
Eco31I GGTCTC 1 cut(s) 711
Eco47I GGWCC 4 cut(s) 143, 381, 664, 1240
EcoNI CCTNNNNNAGG 1 cut(s) 929
EcoO109I RGGNCCY 1 cut(s) 381
EcoRI GAATTC 4 cut(s) 118, 883, 956, 1193
EcoT14I CCWWGG 4 cut(s) 19, 267, 721, 888
EcoT38I GRGCYC 1 cut(s) 620
EgeI GGCGCC 1 cut(s) 234
EheI GGCGCC 1 cut(s) 234
ErhI CCWWGG 4 cut(s) 19, 267, 721, 888
FaeI CATG 6 cut(s) 340, 376, 883, 956, 1041, 1253
FalI AAGNNNNNCTT 1 cut(s) 35
FaqI GGGAC 1 cut(s) 367
FatI CATG 6 cut(s) 336, 372, 879, 952, 1037, 1249
FauI CCCGC 1 cut(s) 225
FbaI TGATCA 1 cut(s) 463
Fnu4HI GCNGC 1 cut(s) 521
FokI GGATG 1 cut(s) 20
FriOI GRGCYC 1 cut(s) 620
Fsp4HI GCNGC 1 cut(s) 521
FspBI CTAG 1 cut(s) 735
GlaI GCGC 2 cut(s) 205, 234
GluI GCNGC 1 cut(s) 521
HaeII RGCGCY 1 cut(s) 236
HaeIII GGCC 1 cut(s) 1049
HapII CCGG 4 cut(s) 141, 242, 782, 1208
HhaI GCGC 2 cut(s) 206, 235
Hin1I GRCGYC 1 cut(s) 233
Hin1II CATG 6 cut(s) 340, 376, 883, 956, 1041, 1253
Hin6I GCGC 2 cut(s) 204, 233
HinP1I GCGC 2 cut(s) 204, 233
HindIII AAGCTT 1 cut(s) 587
HinfI GANTC 1 cut(s) 1174
HpaII CCGG 4 cut(s) 141, 242, 782, 1208
HphI GGTGA 1 cut(s) 1217
Hpy166II GTNNAC 1 cut(s) 1213
Hpy188I TCNGA 3 cut(s) 454, 756, 1108
Hpy188III TCNNGA 5 cut(s) 146, 629, 716, 880, 953
Hpy8I GTNNAC 1 cut(s) 1213
HpyAV CCTTC 4 cut(s) 644, 751, 935, 1238
HpyCH4III ACNGT 1 cut(s) 711
HpyCH4IV ACGT 1 cut(s) 429
HpyCH4V TGCA 5 cut(s) 391, 613, 873, 937, 1041
HpyF10VI GCNNNNNNNGC 1 cut(s) 794
HpySE526I ACGT 1 cut(s) 429
Hsp92I GRCGYC 1 cut(s) 233
Hsp92II CATG 6 cut(s) 340, 376, 883, 956, 1041, 1253
HspAI GCGC 2 cut(s) 204, 233
KasI GGCGCC 1 cut(s) 232
Ksp22I TGATCA 1 cut(s) 463
Kzo9I GATC 3 cut(s) 152, 463, 690
LmnI GCTCC 1 cut(s) 802
Lsp1109I GCAGC 1 cut(s) 532
LweI GCATC 1 cut(s) 229
MaeI CTAG 1 cut(s) 735
MaeII ACGT 1 cut(s) 429
MaeIII GTNAC 1 cut(s) 363
MalI GATC 3 cut(s) 154, 465, 692
MboI GATC 3 cut(s) 152, 463, 690
MboII GAAGA 4 cut(s) 404, 905, 908, 932
MfeI CAATTG 2 cut(s) 176, 744
MhlI GDGCHC 1 cut(s) 620
MlsI TGGCCA 1 cut(s) 1049
MluNI TGGCCA 1 cut(s) 1049
Mly113I GGCGCC 1 cut(s) 233
MmeI TCCRAC 1 cut(s) 642
MnlI CCTC 7 cut(s) 140, 182, 501, 503, 543, 631, 755
Mox20I TGGCCA 1 cut(s) 1049
MroXI GAANNNNTTC 1 cut(s) 924
MscI TGGCCA 1 cut(s) 1049
MseI TTAA 6 cut(s) 77, 105, 195, 327, 591, 599
Msp20I TGGCCA 1 cut(s) 1049
MspI CCGG 4 cut(s) 141, 242, 782, 1208
MspR9I CCNGG 2 cut(s) 141, 243
MunI CAATTG 2 cut(s) 176, 744
MvnI CGCG 2 cut(s) 206, 695
MwoI GCNNNNNNNGC 1 cut(s) 794
NarI GGCGCC 1 cut(s) 233
NciI CCSGG 2 cut(s) 141, 243
NdeII GATC 3 cut(s) 152, 463, 690
NlaIII CATG 6 cut(s) 340, 376, 883, 956, 1041, 1253
NlaIV GGNNCC 4 cut(s) 234, 383, 489, 1182
NmuCI GTSAC 1 cut(s) 363
NspI RCATGY 1 cut(s) 1041
PagI TCATGA 2 cut(s) 879, 952
PdmI GAANNNNTTC 1 cut(s) 924
PfeI GAWTC 1 cut(s) 1174
PkrI GCNGC 1 cut(s) 522
PluTI GGCGCC 1 cut(s) 236
PpuMI RGGWCCY 1 cut(s) 381
PshBI ATTAAT 1 cut(s) 599
PsiI TTATAA 1 cut(s) 579
Psp5II RGGWCCY 1 cut(s) 381
PspN4I GGNNCC 4 cut(s) 234, 383, 489, 1182
PspPI GGNCC 4 cut(s) 143, 381, 664, 1240
PspPPI RGGWCCY 1 cut(s) 381
PsrI GAACNNNNNNTAC 2 cut(s) 141, 173
SaqAI TTAA 6 cut(s) 77, 105, 195, 327, 591, 599
SatI GCNGC 1 cut(s) 521
Sau3AI GATC 3 cut(s) 152, 463, 690
Sau96I GGNCC 4 cut(s) 143, 381, 664, 1240
ScrFI CCNGG 2 cut(s) 141, 243
SduI GDGCHC 1 cut(s) 620
SfaNI GCATC 1 cut(s) 229
SfoI GGCGCC 1 cut(s) 234
SinI GGWCC 4 cut(s) 143, 381, 664, 1240
SmlI CTYRAG 2 cut(s) 559, 977
SmoI CTYRAG 2 cut(s) 559, 977
SsiI CCGC 2 cut(s) 218, 695
SspDI GGCGCC 1 cut(s) 232
SspMI CTAG 1 cut(s) 735
StyD4I CCNGG 2 cut(s) 139, 241
StyI CCWWGG 4 cut(s) 19, 267, 721, 888
TaaI ACNGT 1 cut(s) 711
TaiI ACGT 1 cut(s) 432
TaqI TCGA 1 cut(s) 715
TfiI GAWTC 1 cut(s) 1174
Tru1I TTAA 6 cut(s) 77, 105, 195, 327, 591, 599
Tru9I TTAA 6 cut(s) 77, 105, 195, 327, 591, 599
TseFI GTSAC 1 cut(s) 363
TseI GCWGC 1 cut(s) 520
Tsp45I GTSAC 1 cut(s) 363
TspDTI ATGAA 9 cut(s) 34, 43, 609, 868, 896, 941, 949, 969, 1187
VpaK11BI GGWCC 4 cut(s) 143, 381, 664, 1240
VspI ATTAAT 1 cut(s) 599
XagI CCTNNNNNAGG 1 cut(s) 929
XceI RCATGY 1 cut(s) 1041
XmnI GAANNNNTTC 1 cut(s) 924
XspI CTAG 1 cut(s) 735
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.