pycom17g18150

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
15601943 .. 15605075
3133 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 2517 bp
ATGCCACAATACTCAAAAACCACCACCCTCTACCACAAATTCACACCACACCATCCACCACACCTCAAGAGCCTAAATTCACACAAAGCCCCATTGTTGGCAGCAAGGAAGGAAGAAGGAGCCACCTGGAGCGTTTCTAGGTGTATTCAATCTTTGTTTTCAATGTTTAATTTATATTCTCTTTGTTTTGTTTTGCAATATGAATTGATTAATTCCAGTTGTGATTTCATAAATTGTGAATGCATTTTACTTAACCGTTTGATGGATAACTTATTCTTATTTAAGGGAGTTTCACATAATCGTTACAAACTTATATTCACAAGTAGTAAGGTTGTTTTCACAATCATGTTAAGTAAATTCCTAAACGTAATGATCCTTGATTGTATCTCTATTATGATGTCATGTAGGGGACTTTTGAAGAATGCTTTGGGTTGTCGTATGATGTCACGGTTAATCTGGGGTGTTGAGGTTCATGGCTTATCGGAAAAGCAACCGGAAATCAATTTGTATGCAAGTGTGTCATGTGTGGAGAAGAATCCTCTATTACTTGTTTTTATCTTAAATTCGTCAAAAACCCAATCCGCTTTATTTAGTTGTGTCAAATCTGTCCTAATTAGTGTTTTTGAGTGTTTTGAGTCAAAACCAAACCTATTTTCTTCCAAGTTGAGTCTTAGATCTTTTAAGTTTGTTTTGAGTCATATAAGTTTAGTTAAGAGTCTTTTGAGTTTGTTTAAGTGTTTTGAAGCATATTTTTGTATCTTTGAGTCAGTTTTCATTAGATTAGCAGTCCCTCCTAATCCCCAGCCTAGAACGATCCCTACTTATATCTATACTACAATTCAAATTTTGGCGCCGTTGCCGGGGATTAGTAAAATTACTAATCCCTCTGTTTGTTTGTTTATTTTTCTTTTGATATTTGATTTATTGTCACAGTATGCCGAAGGGTCCACAATGCAAAGTGTCCCTACATTTGGTGCTTCTTATAGGCAAGAATATCAAGCAAATCAATGTGGACAAAGAGATTGGAGTGATCATTCAAACTCTATGTGGTGGGAATTTGAACAAGTTGAACACAAAGGATATTGGCAGCCATATGAGGAGTTCTATTCAACGCCTATGCAGCCAACACAACCTCATATACAATATGCCCAACCAAACTCAGGTTCGTCAATAGATTATAATCAAATTCTTAATGAATTAATTTCTTTGGTGCAGGGCTCACAAAATCAAGTCAAGGAGGCTCAACAAGGAGAATATTGGCAGCCATATGAGGAGTTTTATACAACACCTATGCAGCCACCACAACCTGCCCAAACAAATTCAGGTACGTCTTTGTATAATGATACGCTTATTAAGTTACTCACCAATTTGTCTCAGGGGCAAGAAAGTCAAAACAAAGCAATGCAAAATCAAGACAAAGCAATGCAAAATCAAGAAAAAAGGTTGGACCACTTGGAAAAGCAAATTGGGCAGATAGCGGAGTTCGTAGGACAATTTCGAGACCAAGGCAAACTCCCTATTTCAACCATTGCAAATCCGAATGGAGGATTTGAAACTGCCAAGGAAATCATCTTGAGAAGTAGCAAGGAGGTTAAAACAGACCGTAAACCATCAAAATCAAATTACAAGGAAGATGAAAGATTGCAATTTAAGGAAGAGGAACACACCCAACCCACGGCAAGGGTGGAAACACCTTTGCCGCAGGCACCTATTGCTCCTACGCCATCGAATTCAGGTAAGGTTGTTCCAAATTTAATTATTTCTAGCCCCTTTCCACCAAATGTCCCTATTCCTTACAGGATCATGCAATCCAAGGAAGAAGAAGGTGAGAAAGGCATCTTCGAATCCTTTCCAAAGAATCAAGAGCAAGATGTGGCTGGGGAATGTCTAGAATTCATTAAAGAGGATATACTTGAGACAACAATTCGCAAAGAAATTGGATTTTATGACACGGGACAAGTCATAACTCTCAAAACACCAAATCTAGCTGAATTTTCTAGTCCTACAACTTACGAAGGGGTGTTTATTCTTGAGTTCATGTCGGAGCACACAAGTAAGCCACCTCCTCAAATTTCAATTTTGTTTTATACTAATATGTTGTTGATGATTCAGGCACCCAATCTTGAATTTAAACCATTACCGGATCATTTCAAGTATCACCTTCCATTCAAAGATCAATTCCATGTCGTGGGCTCCAATGAACGCTTCTTGGGAGGCAACCCATGCATATTTGCGTTCCTAAACCCTACTCTTTATTGCTTTTACTTTGCCATGATTGTCGTGTTTGTTAGTTGTGTTATTTGGTTGTTTGTTTGTGAGTCTATGCTTAAAACATTGAGGACAATGTTTGTCATGGGATTTTATCACCTATCACTTCTAAAGTTTATTTTTATGTGTCTTAAACAGAAAATCCGAAAATTTGAAAAAGAAAAAAAAAGATCGAAAAAGAGTGTTTTAAAAACCCAAAAAGAGTTGTTTTTAGAGTCGTTTTTGTTTTTGTGTTTGTTTGTGTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

839

Amino Acids

96.33

Weight (kDa)

8.18

Isoelectric Point (pI)

42.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1179
Acc36I ACCTGC 1 cut(s) 1315
AccB1I GGYRCC 3 cut(s) 850, 1705, 2113
AccB7I CCANNNNNTGG 1 cut(s) 2188
AciI CCGC 3 cut(s) 582, 1478, 1700
AclWI GGATC 4 cut(s) 367, 808, 1808, 2151
AcyI GRCGYC 1 cut(s) 851
AfaI GTAC 1 cut(s) 1327
AfiI CCNNNNNNNGG 9 cut(s) 97, 262, 860, 971, 1160, 1544, 1675, 1680, 2188
AjnI CCWGG 1 cut(s) 125
AluBI AGCT 1 cut(s) 1988
AluI AGCT 1 cut(s) 1988
Alw21I GWGCWC 1 cut(s) 2049
Alw26I GTCTC 3 cut(s) 1377, 1494, 1910
AlwI GGATC 4 cut(s) 367, 808, 1808, 2151
ApeKI GCWGC 5 cut(s) 101, 1087, 1120, 1261, 1294
AseI ATTAAT 2 cut(s) 210, 1199
Asp700I GAANNNNTTC 1 cut(s) 1848
AspLEI GCGC 1 cut(s) 853
AspS9I GGNCC 2 cut(s) 945, 1447
AsuC2I CCSGG 1 cut(s) 861
AsuHPI GGTGA 4 cut(s) 1354, 1838, 2150, 2357
AsuII TTCGAA 1 cut(s) 1842
AvaII GGWCC 2 cut(s) 945, 1447
BanI GGYRCC 3 cut(s) 850, 1705, 2113
BanII GRGCYC 2 cut(s) 1220, 2195
Bbv12I GWGCWC 1 cut(s) 2049
BbvI GCAGC 5 cut(s) 113, 1099, 1132, 1273, 1306
BccI CCATC 4 cut(s) 60, 256, 1618, 1732
BceAI ACGGC 2 cut(s) 838, 1692
BciT130I CCWGG 1 cut(s) 127
BclI TGATCA 1 cut(s) 1030
BcnI CCSGG 1 cut(s) 861
BcoDI GTCTC 3 cut(s) 1377, 1494, 1910
BfaI CTAG 6 cut(s) 138, 807, 1764, 1889, 1985, 1998
BfoI RGCGCY 1 cut(s) 854
BfuAI ACCTGC 1 cut(s) 1315
BglII AGATCT 1 cut(s) 674
BisI GCNGC 6 cut(s) 102, 1088, 1121, 1262, 1295, 1700
BlsI GCNGC 6 cut(s) 103, 1089, 1122, 1263, 1296, 1701
Bme1390I CCNGG 2 cut(s) 127, 861
Bme18I GGWCC 2 cut(s) 945, 1447
BmgT120I GGNCC 2 cut(s) 945, 1447
BmiI GGNNCC 6 cut(s) 121, 852, 946, 1707, 2115, 2194
BmrFI CCNGG 2 cut(s) 127, 861
BmsI GCATC 1 cut(s) 1845
BpmI CTGGAG 1 cut(s) 148
Bpu14I TTCGAA 1 cut(s) 1842
BpuEI CTTGAG 4 cut(s) 50, 1594, 1934, 2051
BpuMI CCSGG 1 cut(s) 861
BsaBI GATNNNNATC 1 cut(s) 1179
BsaHI GRCGYC 1 cut(s) 851
BsaI GGTCTC 1 cut(s) 1494
BsaJI CCNNGG 5 cut(s) 860, 1504, 1560, 1674, 1812
BsaWI WCCGGW 2 cut(s) 493, 2140
Bsc4I CCNNNNNNNGG 9 cut(s) 97, 262, 860, 971, 1160, 1544, 1675, 1680, 2188
Bse1I ACTGG 1 cut(s) 216
Bse3DI GCAATG 3 cut(s) 1407, 1428, 1527
Bse8I GATNNNNATC 1 cut(s) 1179
BseBI CCWGG 1 cut(s) 127
BseDI CCNNGG 5 cut(s) 860, 1504, 1560, 1674, 1812
BseGI GGATG 1 cut(s) 52
BseJI GATNNNNATC 1 cut(s) 1179
BseLI CCNNNNNNNGG 9 cut(s) 97, 262, 860, 971, 1160, 1544, 1675, 1680, 2188
BseMI GCAATG 3 cut(s) 1407, 1428, 1527
BseMII CTCAG 2 cut(s) 1173, 1388
BseNI ACTGG 1 cut(s) 216
BseRI GAGGAG 3 cut(s) 1112, 1286, 2055
BseXI GCAGC 5 cut(s) 113, 1099, 1132, 1273, 1306
BseYI CCCAGC 2 cut(s) 801, 1877
BsgI GTGCAG 1 cut(s) 1232
BshNI GGYRCC 3 cut(s) 850, 1705, 2113
BsiHKAI GWGCWC 1 cut(s) 2049
BsiSI CCGG 3 cut(s) 494, 860, 2141
BslFI GGGAC 5 cut(s) 423, 773, 947, 1769, 1968
BslI CCNNNNNNNGG 9 cut(s) 97, 262, 860, 971, 1160, 1544, 1675, 1680, 2188
BsmAI GTCTC 3 cut(s) 1377, 1494, 1910
BsmFI GGGAC 5 cut(s) 423, 773, 947, 1769, 1968
BsmI GAATGC 2 cut(s) 245, 427
Bso31I GGTCTC 1 cut(s) 1494
Bsp119I TTCGAA 1 cut(s) 1842
Bsp1286I GDGCHC 3 cut(s) 1220, 2049, 2195
Bsp143I GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
BspACI CCGC 3 cut(s) 582, 1478, 1700
BspCNI CTCAG 2 cut(s) 1172, 1387
BspLI GGNNCC 6 cut(s) 121, 852, 946, 1707, 2115, 2194
BspMI ACCTGC 1 cut(s) 1315
BspPI GGATC 4 cut(s) 367, 808, 1808, 2151
BspT104I TTCGAA 1 cut(s) 1842
BspT107I GGYRCC 3 cut(s) 850, 1705, 2113
BspTNI GGTCTC 1 cut(s) 1494
BsrDI GCAATG 3 cut(s) 1407, 1428, 1527
BsrI ACTGG 1 cut(s) 216
BssECI CCNNGG 5 cut(s) 860, 1504, 1560, 1674, 1812
BssMI GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
BssNI GRCGYC 1 cut(s) 851
BssT1I CCWWGG 3 cut(s) 1504, 1560, 1812
Bst2UI CCWGG 1 cut(s) 127
Bst4CI ACNGT 4 cut(s) 257, 450, 933, 1604
Bst6I CTCTTC 1 cut(s) 1650
BstACI GRCGYC 1 cut(s) 851
BstAPI GCANNNNNTGC 2 cut(s) 1712, 2223
BstBI TTCGAA 1 cut(s) 1842
BstC8I GCNNGC 1 cut(s) 1704
BstDEI CTNAG 4 cut(s) 671, 1159, 1374, 2514
BstDSI CCRYGG 1 cut(s) 1674
BstF5I GGATG 1 cut(s) 52
BstH2I RGCGCY 1 cut(s) 854
BstHHI GCGC 1 cut(s) 853
BstKTI GATC 8 cut(s) 375, 677, 816, 1033, 1803, 2146, 2176, 2441
BstMAI GTCTC 3 cut(s) 1377, 1494, 1910
BstMBI GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
BstMWI GCNNNNNNNGC 4 cut(s) 1120, 1468, 1712, 2223
BstNI CCWGG 1 cut(s) 127
BstSCI CCNGG 2 cut(s) 125, 859
BstV1I GCAGC 5 cut(s) 113, 1099, 1132, 1273, 1306
BstX2I RGATCY 1 cut(s) 674
BstYI RGATCY 1 cut(s) 674
BtgI CCRYGG 1 cut(s) 1674
BtsCI GGATG 1 cut(s) 52
BveI ACCTGC 1 cut(s) 1315
Cac8I GCNNGC 1 cut(s) 1704
CfoI GCGC 1 cut(s) 853
Cfr13I GGNCC 2 cut(s) 945, 1447
Csp6I GTAC 1 cut(s) 1326
CviQI GTAC 1 cut(s) 1326
DdeI CTNAG 4 cut(s) 671, 1159, 1374, 2514
DinI GGCGCC 1 cut(s) 852
DpnI GATC 8 cut(s) 374, 676, 815, 1032, 1802, 2145, 2175, 2440
DpnII GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
DraI TTTAAA 2 cut(s) 2131, 2457
Eam1104I CTCTTC 1 cut(s) 1650
EarI CTCTTC 1 cut(s) 1650
Eco130I CCWWGG 3 cut(s) 1504, 1560, 1812
Eco24I GRGCYC 2 cut(s) 1220, 2195
Eco31I GGTCTC 1 cut(s) 1494
Eco47I GGWCC 2 cut(s) 945, 1447
EcoRI GAATTC 2 cut(s) 1729, 1892
EcoRII CCWGG 1 cut(s) 125
EcoT14I CCWWGG 3 cut(s) 1504, 1560, 1812
EcoT22I ATGCAT 2 cut(s) 245, 2228
EcoT38I GRGCYC 2 cut(s) 1220, 2195
EgeI GGCGCC 1 cut(s) 852
EheI GGCGCC 1 cut(s) 852
ErhI CCWWGG 3 cut(s) 1504, 1560, 1812
FaqI GGGAC 5 cut(s) 423, 773, 947, 1769, 1968
FauNDI CATATG 2 cut(s) 1093, 1267
FbaI TGATCA 1 cut(s) 1030
Fnu4HI GCNGC 6 cut(s) 102, 1088, 1121, 1262, 1295, 1700
FokI GGATG 1 cut(s) 39
FriOI GRGCYC 2 cut(s) 1220, 2195
Fsp4HI GCNGC 6 cut(s) 102, 1088, 1121, 1262, 1295, 1700
FspBI CTAG 6 cut(s) 138, 807, 1764, 1889, 1985, 1998
GlaI GCGC 1 cut(s) 852
GluI GCNGC 6 cut(s) 102, 1088, 1121, 1262, 1295, 1700
GsaI CCCAGC 2 cut(s) 805, 1881
GsuI CTGGAG 1 cut(s) 148
HaeII RGCGCY 1 cut(s) 854
HapII CCGG 3 cut(s) 494, 860, 2141
HhaI GCGC 1 cut(s) 853
Hin1I GRCGYC 1 cut(s) 851
Hin6I GCGC 1 cut(s) 851
HinP1I GCGC 1 cut(s) 851
HpaII CCGG 3 cut(s) 494, 860, 2141
HphI GGTGA 4 cut(s) 1354, 1838, 2150, 2357
Hpy166II GTNNAC 3 cut(s) 948, 1013, 1607
Hpy188I TCNGA 4 cut(s) 484, 1539, 2044, 2414
Hpy188III TCNNGA 9 cut(s) 67, 1412, 1433, 1499, 1573, 1862, 1889, 2030, 2123
Hpy8I GTNNAC 3 cut(s) 948, 1013, 1607
HpyAV CCTTC 6 cut(s) 103, 110, 935, 1817, 2009, 2171
HpyCH4III ACNGT 4 cut(s) 257, 450, 933, 1604
HpyCH4IV ACGT 2 cut(s) 366, 1328
HpyF10VI GCNNNNNNNGC 4 cut(s) 1120, 1468, 1712, 2223
HpyF3I CTNAG 4 cut(s) 671, 1159, 1374, 2514
HpySE526I ACGT 2 cut(s) 366, 1328
Hsp92I GRCGYC 1 cut(s) 851
HspAI GCGC 1 cut(s) 851
KasI GGCGCC 1 cut(s) 850
Ksp22I TGATCA 1 cut(s) 1030
Kzo9I GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
LmnI GCTCC 5 cut(s) 119, 129, 1720, 2044, 2198
Lsp1109I GCAGC 5 cut(s) 113, 1099, 1132, 1273, 1306
LweI GCATC 1 cut(s) 1845
MaeI CTAG 6 cut(s) 138, 807, 1764, 1889, 1985, 1998
MaeII ACGT 2 cut(s) 366, 1328
MaeIII GTNAC 4 cut(s) 302, 444, 927, 1356
MalI GATC 8 cut(s) 374, 676, 815, 1032, 1802, 2145, 2175, 2440
MboI GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
MboII GAAGA 9 cut(s) 125, 430, 544, 648, 1643, 1667, 1829, 1831, 1832
MflI RGATCY 1 cut(s) 674
MhlI GDGCHC 3 cut(s) 1220, 2049, 2195
Mly113I GGCGCC 1 cut(s) 851
MlyI GAGTC 7 cut(s) 644, 676, 703, 724, 773, 2327, 2492
MmeI TCCRAC 2 cut(s) 1425, 2022
Mph1103I ATGCAT 2 cut(s) 245, 2228
MroXI GAANNNNTTC 1 cut(s) 1848
MslI CAYNNNNRTG 1 cut(s) 344
MspI CCGG 3 cut(s) 494, 860, 2141
MspR9I CCNGG 2 cut(s) 127, 861
Mva1269I GAATGC 2 cut(s) 245, 427
MvaI CCWGG 1 cut(s) 127
MwoI GCNNNNNNNGC 4 cut(s) 1120, 1468, 1712, 2223
NarI GGCGCC 1 cut(s) 851
NciI CCSGG 1 cut(s) 861
NdeI CATATG 2 cut(s) 1093, 1267
NdeII GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
NlaIV GGNNCC 6 cut(s) 121, 852, 946, 1707, 2115, 2194
NmuCI GTSAC 2 cut(s) 444, 927
NsiI ATGCAT 2 cut(s) 245, 2228
NspV TTCGAA 1 cut(s) 1842
PctI GAATGC 2 cut(s) 245, 427
PdmI GAANNNNTTC 1 cut(s) 1848
PfeI GAWTC 4 cut(s) 535, 1844, 1858, 2107
PflMI CCANNNNNTGG 1 cut(s) 2188
PkrI GCNGC 6 cut(s) 103, 1089, 1122, 1263, 1296, 1701
PleI GAGTC 7 cut(s) 643, 675, 702, 723, 772, 2326, 2491
PluTI GGCGCC 1 cut(s) 854
PpsI GAGTC 7 cut(s) 643, 675, 702, 723, 772, 2326, 2491
PshBI ATTAAT 2 cut(s) 210, 1199
PsiI TTATAA 1 cut(s) 1179
Psp6I CCWGG 1 cut(s) 125
PspFI CCCAGC 2 cut(s) 801, 1877
PspGI CCWGG 1 cut(s) 125
PspN4I GGNNCC 6 cut(s) 121, 852, 946, 1707, 2115, 2194
PspPI GGNCC 2 cut(s) 945, 1447
PsrI GAACNNNNNNTAC 2 cut(s) 802, 834
PsuI RGATCY 1 cut(s) 674
RsaI GTAC 1 cut(s) 1327
RsaNI GTAC 1 cut(s) 1326
RseI CAYNNNNRTG 1 cut(s) 344
SatI GCNGC 6 cut(s) 102, 1088, 1121, 1262, 1295, 1700
Sau3AI GATC 8 cut(s) 372, 674, 813, 1030, 1800, 2143, 2173, 2438
Sau96I GGNCC 2 cut(s) 945, 1447
SchI GAGTC 7 cut(s) 644, 676, 703, 724, 773, 2327, 2492
ScrFI CCNGG 2 cut(s) 127, 861
SduI GDGCHC 3 cut(s) 1220, 2049, 2195
SfaNI GCATC 1 cut(s) 1845
SfoI GGCGCC 1 cut(s) 852
SfuI TTCGAA 1 cut(s) 1842
SinI GGWCC 2 cut(s) 945, 1447
SmiMI CAYNNNNRTG 1 cut(s) 344
SmlI CTYRAG 4 cut(s) 65, 1573, 1913, 2030
SmoI CTYRAG 4 cut(s) 65, 1573, 1913, 2030
SsiI CCGC 3 cut(s) 582, 1478, 1700
SspDI GGCGCC 1 cut(s) 850
SspI AATATT 1 cut(s) 1256
SspMI CTAG 6 cut(s) 138, 807, 1764, 1889, 1985, 1998
StyD4I CCNGG 2 cut(s) 125, 859
StyI CCWWGG 3 cut(s) 1504, 1560, 1812
TaaI ACNGT 4 cut(s) 257, 450, 933, 1604
TaiI ACGT 2 cut(s) 369, 1331
TaqI TCGA 4 cut(s) 1498, 1727, 1842, 2441
TauI GCSGC 1 cut(s) 1702
TfiI GAWTC 4 cut(s) 535, 1844, 1858, 2107
TseFI GTSAC 2 cut(s) 444, 927
TseI GCWGC 5 cut(s) 101, 1087, 1120, 1261, 1294
Tsp45I GTSAC 2 cut(s) 444, 927
TspDTI ATGAA 9 cut(s) 216, 217, 461, 763, 1209, 1650, 1885, 2026, 2214
Van91I CCANNNNNTGG 1 cut(s) 2188
VpaK11BI GGWCC 2 cut(s) 945, 1447
VspI ATTAAT 2 cut(s) 210, 1199
XbaI TCTAGA 1 cut(s) 1888
XcmI CCANNNNNNNNNTGG 1 cut(s) 1681
XmnI GAANNNNTTC 1 cut(s) 1848
XspI CTAG 6 cut(s) 138, 807, 1764, 1889, 1985, 1998
Zsp2I ATGCAT 2 cut(s) 245, 2228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.