pycom17g25100

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
23258368 .. 23259201
834 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 834 bp
ATGCGTCGCCGAACTTCACGCAGGAAAATCCGGATTTTTGAATCGGTGATCGTGTCGCTTGGCTTTTTACAGAGGTATCGATCACTCCAACATACACACTCTGAAAATTGCCCATTCTTGAAAATCGTCTCCGGCCTTTTGAGAATTATCTTCATCCACCCATTCTCTCTGAACACCTTTGAAAAAATGACTAACTCATCGAACCTTTGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCACCCGGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACGGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCTCTCAGCGTTCAGTGTGCAGGCTCTGTGTCCAACATGGGCCAACGCCTGCTTGCTCGGTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAATCTTAAGCAGGAGATCAAACAGCTTAAGTACGAGAATAGAAGTTTGCACGTGCTTGCAAATAACTATTCGTCGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAAGGTCGGATTCAAAGTGACCGTCAAAGGTTTTCGTCTTTCCTCCAGAGGCACATTTTTCCTGGGTCTTCCAGCGTTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTTCAATGCCTCCCGCTCCGATGCCTTCTGCTCCGATGCCTTCCGCTTCTAGAGTTTTGCCAAGTAATGGGGCTTCACGTGAACATCCTTTGTGA

Protein Analysis

278

Amino Acids

30.88

Weight (kDa)

9.88

Isoelectric Point (pI)

66.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 264
AccB7I CCANNNNNTGG 2 cut(s) 708, 806
AccBSI CCGCTC 1 cut(s) 755
AccIII TCCGGA 1 cut(s) 30
AciI CCGC 2 cut(s) 753, 783
AclWI GGATC 1 cut(s) 227
AcoI YGGCCR 2 cut(s) 405, 710
AcuI CTGAAG 1 cut(s) 651
AcvI CACGTG 2 cut(s) 571, 818
AcyI GRCGYC 2 cut(s) 265, 324
AfaI GTAC 1 cut(s) 551
AfiI CCNNNNNNNGG 5 cut(s) 251, 299, 493, 708, 806
AflII CTTAAG 2 cut(s) 524, 545
AgsI TTSAA 6 cut(s) 41, 121, 182, 413, 644, 744
AjnI CCWGG 2 cut(s) 691, 725
AluBI AGCT 5 cut(s) 347, 544, 610, 619, 740
AluI AGCT 5 cut(s) 347, 544, 610, 619, 740
Alw26I GTCTC 2 cut(s) 133, 227
AlwI GGATC 1 cut(s) 227
AlwNI CAGNNNCTG 1 cut(s) 449
Aor13HI TCCGGA 1 cut(s) 30
AoxI GGCC 5 cut(s) 133, 405, 463, 710, 723
ApeKI GCWGC 3 cut(s) 228, 379, 619
ArsI GACNNNNNNTTYG 2 cut(s) 637, 669
AspLEI GCGC 1 cut(s) 267
AspS9I GGNCC 4 cut(s) 290, 393, 463, 483
AsuC2I CCSGG 1 cut(s) 246
AsuHPI GGTGA 2 cut(s) 58, 314
AvaII GGWCC 3 cut(s) 290, 393, 483
BaeI ACNNNNGTAYC 2 cut(s) 59, 92
BalI TGGCCA 1 cut(s) 712
BanI GGYRCC 1 cut(s) 264
BarI GAAGNNNNNNTAC 2 cut(s) 796, 828
BbrPI CACGTG 2 cut(s) 571, 818
BbsI GAAGAC 2 cut(s) 312, 690
BbvI GCAGC 3 cut(s) 240, 366, 606
BccI CCATC 1 cut(s) 499
BceAI ACGGC 2 cut(s) 348, 392
BcgI CGANNNNNNTGC 2 cut(s) 221, 255
BciT130I CCWGG 2 cut(s) 693, 727
BcnI CCSGG 1 cut(s) 246
BcoDI GTCTC 2 cut(s) 133, 227
BfaI CTAG 3 cut(s) 348, 737, 789
BfoI RGCGCY 1 cut(s) 268
BfrI CTTAAG 2 cut(s) 524, 545
BglI GCCNNNNNGGC 1 cut(s) 332
BisI GCNGC 3 cut(s) 229, 380, 620
BlsI GCNGC 3 cut(s) 230, 381, 621
Bme1390I CCNGG 3 cut(s) 246, 693, 727
Bme18I GGWCC 3 cut(s) 290, 393, 483
BmgT120I GGNCC 4 cut(s) 290, 393, 463, 483
BmiI GGNNCC 3 cut(s) 266, 353, 485
BmrFI CCNGG 3 cut(s) 246, 693, 727
BmsI GCATC 3 cut(s) 306, 750, 765
BpiI GAAGAC 2 cut(s) 312, 690
BpmI CTGGAG 1 cut(s) 659
BpuMI CCSGG 1 cut(s) 246
Bsa29I ATCGAT 1 cut(s) 79
BsaAI YACGTR 2 cut(s) 571, 818
BsaHI GRCGYC 2 cut(s) 265, 324
BsaJI CCNNGG 1 cut(s) 692
BsaWI WCCGGW 2 cut(s) 30, 235
Bsc4I CCNNNNNNNGG 5 cut(s) 251, 299, 493, 708, 806
BseAI TCCGGA 1 cut(s) 30
BseBI CCWGG 2 cut(s) 693, 727
BseCI ATCGAT 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 692
BseGI GGATG 2 cut(s) 153, 823
BseLI CCNNNNNNNGG 5 cut(s) 251, 299, 493, 708, 806
BseMII CTCAG 2 cut(s) 238, 442
BseRI GAGGAG 1 cut(s) 347
BseXI GCAGC 3 cut(s) 240, 366, 606
BsgI GTGCAG 1 cut(s) 462
BshFI GGCC 5 cut(s) 135, 407, 465, 712, 725
BshNI GGYRCC 1 cut(s) 264
BshVI ATCGAT 1 cut(s) 79
BsiSI CCGG 4 cut(s) 31, 132, 236, 246
BslFI GGGAC 2 cut(s) 403, 469
BslI CCNNNNNNNGG 5 cut(s) 251, 299, 493, 708, 806
BsmAI GTCTC 2 cut(s) 133, 227
BsmBI CGTCTC 1 cut(s) 133
BsmFI GGGAC 2 cut(s) 403, 469
BsmI GAATGC 1 cut(s) 736
BsnI GGCC 5 cut(s) 135, 407, 465, 712, 725
Bsp13I TCCGGA 1 cut(s) 30
Bsp143I GATC 4 cut(s) 48, 80, 232, 534
BspACI CCGC 2 cut(s) 753, 783
BspANI GGCC 5 cut(s) 135, 407, 465, 712, 725
BspCNI CTCAG 2 cut(s) 237, 441
BspDI ATCGAT 1 cut(s) 79
BspEI TCCGGA 1 cut(s) 30
BspLI GGNNCC 3 cut(s) 266, 353, 485
BspPI GGATC 1 cut(s) 227
BspT107I GGYRCC 1 cut(s) 264
BspTI CTTAAG 2 cut(s) 524, 545
BsrBI CCGCTC 1 cut(s) 755
BssECI CCNNGG 1 cut(s) 692
BssMI GATC 4 cut(s) 48, 80, 232, 534
BssNI GRCGYC 2 cut(s) 265, 324
Bst2UI CCWGG 2 cut(s) 693, 727
Bst4CI ACNGT 3 cut(s) 290, 393, 653
Bst6I CTCTTC 1 cut(s) 596
BstACI GRCGYC 2 cut(s) 265, 324
BstAFI CTTAAG 2 cut(s) 524, 545
BstBAI YACGTR 2 cut(s) 571, 818
BstC8I GCNNGC 4 cut(s) 445, 473, 477, 576
BstDEI CTNAG 3 cut(s) 211, 224, 428
BstENI CCTNNNNNAGG 1 cut(s) 297
BstF5I GGATG 2 cut(s) 153, 823
BstH2I RGCGCY 1 cut(s) 268
BstHHI GCGC 1 cut(s) 267
BstKTI GATC 4 cut(s) 51, 83, 235, 537
BstMAI GTCTC 2 cut(s) 133, 227
BstMBI GATC 4 cut(s) 48, 80, 232, 534
BstMWI GCNNNNNNNGC 3 cut(s) 332, 616, 731
BstNI CCWGG 2 cut(s) 693, 727
BstSCI CCNGG 3 cut(s) 244, 691, 725
BstV1I GCAGC 3 cut(s) 240, 366, 606
BstV2I GAAGAC 2 cut(s) 312, 690
Bsu15I ATCGAT 1 cut(s) 79
BsuRI GGCC 5 cut(s) 135, 407, 465, 712, 725
BsuTUI ATCGAT 1 cut(s) 79
BtsCI GGATG 2 cut(s) 153, 823
BtsIMutI CAGTG 1 cut(s) 443
Cac8I GCNNGC 4 cut(s) 445, 473, 477, 576
CaiI CAGNNNCTG 1 cut(s) 449
CfoI GCGC 1 cut(s) 267
Cfr13I GGNCC 4 cut(s) 290, 393, 463, 483
ClaI ATCGAT 1 cut(s) 79
CpoI CGGWCCG 1 cut(s) 393
CseI GACGC 1 cut(s) 332
Csp6I GTAC 1 cut(s) 550
CspI CGGWCCG 1 cut(s) 393
CviAII CATG 2 cut(s) 460, 598
CviQI GTAC 1 cut(s) 550
DdeI CTNAG 3 cut(s) 211, 224, 428
DinI GGCGCC 1 cut(s) 266
DpnI GATC 4 cut(s) 50, 82, 234, 536
DpnII GATC 4 cut(s) 48, 80, 232, 534
EaeI YGGCCR 2 cut(s) 405, 710
Eam1104I CTCTTC 1 cut(s) 596
EarI CTCTTC 1 cut(s) 596
Eco147I AGGCCT 1 cut(s) 725
Eco47I GGWCC 3 cut(s) 290, 393, 483
Eco57I CTGAAG 1 cut(s) 651
Eco72I CACGTG 2 cut(s) 571, 818
EcoNI CCTNNNNNAGG 1 cut(s) 297
EcoRII CCWGG 2 cut(s) 691, 725
EgeI GGCGCC 1 cut(s) 266
EheI GGCGCC 1 cut(s) 266
Esp3I CGTCTC 1 cut(s) 133
FaeI CATG 2 cut(s) 463, 601
FaiI YATR 4 cut(s) 93, 262, 461, 599
FaqI GGGAC 2 cut(s) 403, 469
FatI CATG 2 cut(s) 459, 597
FauI CCCGC 1 cut(s) 760
Fnu4HI GCNGC 3 cut(s) 229, 380, 620
FokI GGATG 2 cut(s) 140, 810
Fsp4HI GCNGC 3 cut(s) 229, 380, 620
FspBI CTAG 3 cut(s) 348, 737, 789
GlaI GCGC 1 cut(s) 266
GluI GCNGC 3 cut(s) 229, 380, 620
GsuI CTGGAG 1 cut(s) 659
HaeII RGCGCY 1 cut(s) 268
HaeIII GGCC 5 cut(s) 135, 407, 465, 712, 725
HapII CCGG 4 cut(s) 31, 132, 236, 246
HgaI GACGC 1 cut(s) 332
HhaI GCGC 1 cut(s) 267
Hin1I GRCGYC 2 cut(s) 265, 324
Hin1II CATG 2 cut(s) 463, 601
Hin6I GCGC 1 cut(s) 265
HinP1I GCGC 1 cut(s) 265
HindIII AAGCTT 1 cut(s) 608
HinfI GANTC 7 cut(s) 41, 220, 308, 416, 497, 626, 640
HpaII CCGG 4 cut(s) 31, 132, 236, 246
HphI GGTGA 2 cut(s) 58, 314
Hpy166II GTNNAC 1 cut(s) 821
Hpy188I TCNGA 7 cut(s) 103, 171, 397, 631, 639, 759, 774
Hpy188III TCNNGA 6 cut(s) 31, 118, 387, 413, 676, 789
Hpy8I GTNNAC 1 cut(s) 821
Hpy99I CGWCG 2 cut(s) 9, 595
HpyAV CCTTC 4 cut(s) 279, 626, 774, 789
HpyCH4III ACNGT 3 cut(s) 290, 393, 653
HpyCH4IV ACGT 2 cut(s) 570, 817
HpyCH4V TGCA 6 cut(s) 242, 319, 443, 568, 578, 622
HpyF10VI GCNNNNNNNGC 3 cut(s) 332, 616, 731
HpyF3I CTNAG 3 cut(s) 211, 224, 428
HpySE526I ACGT 2 cut(s) 570, 817
Hsp92I GRCGYC 2 cut(s) 265, 324
Hsp92II CATG 2 cut(s) 463, 601
HspAI GCGC 1 cut(s) 265
KasI GGCGCC 1 cut(s) 264
Kpn2I TCCGGA 1 cut(s) 30
Kzo9I GATC 4 cut(s) 48, 80, 232, 534
LmnI GCTCC 2 cut(s) 760, 775
Lsp1109I GCAGC 3 cut(s) 240, 366, 606
LweI GCATC 3 cut(s) 306, 750, 765
MaeI CTAG 3 cut(s) 348, 737, 789
MaeII ACGT 2 cut(s) 570, 817
MaeIII GTNAC 1 cut(s) 647
MalI GATC 4 cut(s) 50, 82, 234, 536
MbiI CCGCTC 1 cut(s) 755
MboI GATC 4 cut(s) 48, 80, 232, 534
MboII GAAGA 5 cut(s) 142, 273, 317, 613, 690
MlsI TGGCCA 1 cut(s) 712
MluCI AATT 2 cut(s) 106, 144
MluNI TGGCCA 1 cut(s) 712
Mly113I GGCGCC 1 cut(s) 265
MlyI GAGTC 3 cut(s) 229, 302, 425
MmeI TCCRAC 3 cut(s) 112, 480, 617
Mox20I TGGCCA 1 cut(s) 712
MroI TCCGGA 1 cut(s) 30
MscI TGGCCA 1 cut(s) 712
MseI TTAA 2 cut(s) 525, 546
Msp20I TGGCCA 1 cut(s) 712
MspCI CTTAAG 2 cut(s) 524, 545
MspI CCGG 4 cut(s) 31, 132, 236, 246
MspR9I CCNGG 3 cut(s) 246, 693, 727
Mva1269I GAATGC 1 cut(s) 736
MvaI CCWGG 2 cut(s) 693, 727
MwoI GCNNNNNNNGC 3 cut(s) 332, 616, 731
NarI GGCGCC 1 cut(s) 265
NciI CCSGG 1 cut(s) 246
NdeII GATC 4 cut(s) 48, 80, 232, 534
NlaIII CATG 2 cut(s) 463, 601
NlaIV GGNNCC 3 cut(s) 266, 353, 485
NmuCI GTSAC 1 cut(s) 647
PceI AGGCCT 1 cut(s) 725
PcsI WCGNNNNNNNCGW 1 cut(s) 429
PctI GAATGC 1 cut(s) 736
PfeI GAWTC 4 cut(s) 41, 497, 626, 640
PflMI CCANNNNNTGG 2 cut(s) 708, 806
PkrI GCNGC 3 cut(s) 230, 381, 621
PleI GAGTC 3 cut(s) 228, 302, 424
PluTI GGCGCC 1 cut(s) 268
PmaCI CACGTG 2 cut(s) 571, 818
PmlI CACGTG 2 cut(s) 571, 818
PpsI GAGTC 3 cut(s) 228, 302, 424
Ppu21I YACGTR 2 cut(s) 571, 818
Psp6I CCWGG 2 cut(s) 691, 725
PspCI CACGTG 2 cut(s) 571, 818
PspGI CCWGG 2 cut(s) 691, 725
PspN4I GGNNCC 3 cut(s) 266, 353, 485
PspPI GGNCC 4 cut(s) 290, 393, 463, 483
PstNI CAGNNNCTG 1 cut(s) 449
RsaI GTAC 1 cut(s) 551
RsaNI GTAC 1 cut(s) 550
Rsr2I CGGWCCG 1 cut(s) 393
RsrII CGGWCCG 1 cut(s) 393
SaqAI TTAA 2 cut(s) 525, 546
SatI GCNGC 3 cut(s) 229, 380, 620
Sau3AI GATC 4 cut(s) 48, 80, 232, 534
Sau96I GGNCC 4 cut(s) 290, 393, 463, 483
SchI GAGTC 3 cut(s) 229, 302, 425
ScrFI CCNGG 3 cut(s) 246, 693, 727
SfaNI GCATC 3 cut(s) 306, 750, 765
SfoI GGCGCC 1 cut(s) 266
SinI GGWCC 3 cut(s) 290, 393, 483
SmlI CTYRAG 2 cut(s) 524, 545
SmoI CTYRAG 2 cut(s) 524, 545
Sse9I AATT 2 cut(s) 106, 144
SseBI AGGCCT 1 cut(s) 725
SsiI CCGC 2 cut(s) 753, 783
SspDI GGCGCC 1 cut(s) 264
SspMI CTAG 3 cut(s) 348, 737, 789
StuI AGGCCT 1 cut(s) 725
StyD4I CCNGG 3 cut(s) 244, 691, 725
TaaI ACNGT 3 cut(s) 290, 393, 653
TaiI ACGT 2 cut(s) 573, 820
TaqI TCGA 2 cut(s) 79, 200
TaqII GACCGA 1 cut(s) 471
TasI AATT 2 cut(s) 106, 144
TfiI GAWTC 4 cut(s) 41, 497, 626, 640
Tru1I TTAA 2 cut(s) 525, 546
Tru9I TTAA 2 cut(s) 525, 546
TscAI CASTG 1 cut(s) 443
TseFI GTSAC 1 cut(s) 647
TseI GCWGC 3 cut(s) 228, 379, 619
Tsp45I GTSAC 1 cut(s) 647
TspDTI ATGAA 2 cut(s) 142, 614
TspGWI ACGGA 1 cut(s) 301
TspRI CASTG 1 cut(s) 443
Van91I CCANNNNNTGG 2 cut(s) 708, 806
Vha464I CTTAAG 2 cut(s) 524, 545
VpaK11BI GGWCC 3 cut(s) 290, 393, 483
XagI CCTNNNNNAGG 1 cut(s) 297
XbaI TCTAGA 1 cut(s) 788
XspI CTAG 3 cut(s) 348, 737, 789
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.