pycom17g25680

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Forward (+)
23804844 .. 23805591
748 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 690 bp
ATGTGGTGGGAACCTCAACATGTTCAAGAAGAAGGATATTGGCAGCCATATGAGGAGTTCTATTCAAGACCTATACACCCACCACAACCTCATATTCAATATGCCCAACCAAATTTAAGTTCGTCAATAGATTATAATCAAAAGCTTAACGAATTAATTTGTTTGGTGCAGGGCTCACAAAATCAAGACAATGAGGATCGACAAGAAGACAAAAGGTTGGACCACTTGGAAAAGCAAATTGGGCAGATAGCGGAGTTCGTAGGACAATTTTGCGACCAAGGCAAACTCCCTAGTTCAACCATTGTAAATCCGAATGGAGGATTTGAAGCACCTTTGTCAGAAGCACTTATTGCTCCTACGCCATCTAATTCAAGTAAGGTTGTTCCAATTAGTTCTAACCCCATTCCAACAAATATCCCTATTCCTTGCAGGTTCATGAATTCCAAGGAAGAAGAAAGTGAAAAAGACATCTTGGAAGCCCTTCCAAAGGTGCAAAGTAGGGAATGTCATGAATTCATCAAAGAGGACGTTCTTGAAACCAAAAAATCCAAAGAAGTTAAATTTGATGACATTGGACAAGTCATAACCATCACTTGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTATCGGACAAAACAAGTAAGCACCTACACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

230

Amino Acids

26.13

Weight (kDa)

4.98

Isoelectric Point (pI)

56.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 135
Acc36I ACCTGC 1 cut(s) 420
AciI CCGC 1 cut(s) 251
AclWI GGATC 1 cut(s) 204
AcoI YGGCCR 1 cut(s) 603
AcsI RAATTY 4 cut(s) 112, 439, 512, 560
AfiI CCNNNNNNNGG 2 cut(s) 317, 487
AflIII ACRYGT 1 cut(s) 19
AgsI TTSAA 8 cut(s) 26, 66, 98, 297, 326, 372, 536, 631
AjuI GAANNNNNNNTTGG 4 cut(s) 103, 135, 222, 254
AluBI AGCT 1 cut(s) 145
AluI AGCT 1 cut(s) 145
AlwI GGATC 1 cut(s) 204
AoxI GGCC 1 cut(s) 603
ApeKI GCWGC 1 cut(s) 43
ApoI RAATTY 4 cut(s) 112, 439, 512, 560
AseI ATTAAT 1 cut(s) 155
Asp700I GAANNNNTTC 1 cut(s) 480
AspS9I GGNCC 1 cut(s) 220
AvaII GGWCC 1 cut(s) 220
BalI TGGCCA 1 cut(s) 605
BanII GRGCYC 1 cut(s) 176
BbsI GAAGAC 1 cut(s) 213
BbvI GCAGC 1 cut(s) 55
BccI CCATC 2 cut(s) 370, 596
BfaI CTAG 2 cut(s) 291, 688
BfuAI ACCTGC 1 cut(s) 420
BisI GCNGC 1 cut(s) 44
BlsI GCNGC 1 cut(s) 45
Bme18I GGWCC 1 cut(s) 220
BmgT120I GGNCC 1 cut(s) 220
BmiI GGNNCC 1 cut(s) 12
BpiI GAAGAC 1 cut(s) 213
BsaBI GATNNNNATC 1 cut(s) 135
BsaJI CCNNGG 2 cut(s) 277, 444
Bsc4I CCNNNNNNNGG 2 cut(s) 317, 487
Bse8I GATNNNNATC 1 cut(s) 135
BseDI CCNNGG 2 cut(s) 277, 444
BseJI GATNNNNATC 1 cut(s) 135
BseLI CCNNNNNNNGG 2 cut(s) 317, 487
BseRI GAGGAG 1 cut(s) 68
BseXI GCAGC 1 cut(s) 55
BsgI GTGCAG 1 cut(s) 188
BshFI GGCC 1 cut(s) 605
BslI CCNNNNNNNGG 2 cut(s) 317, 487
BsnI GGCC 1 cut(s) 605
Bsp1286I GDGCHC 1 cut(s) 176
Bsp143I GATC 1 cut(s) 196
BspACI CCGC 1 cut(s) 251
BspANI GGCC 1 cut(s) 605
BspHI TCATGA 2 cut(s) 435, 508
BspLI GGNNCC 1 cut(s) 12
BspMI ACCTGC 1 cut(s) 420
BspPI GGATC 1 cut(s) 204
BssECI CCNNGG 2 cut(s) 277, 444
BssMI GATC 1 cut(s) 196
BssT1I CCWWGG 2 cut(s) 277, 444
BstAPI GCANNNNNTGC 1 cut(s) 350
BstENI CCTNNNNNAGG 1 cut(s) 485
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstMWI GCNNNNNNNGC 3 cut(s) 241, 279, 350
BstNSI RCATGY 1 cut(s) 23
BstV1I GCAGC 1 cut(s) 55
BstV2I GAAGAC 1 cut(s) 213
BsuRI GGCC 1 cut(s) 605
BveI ACCTGC 1 cut(s) 420
CciI TCATGA 2 cut(s) 435, 508
Cfr13I GGNCC 1 cut(s) 220
CviAII CATG 3 cut(s) 20, 436, 509
CviJI RGCY 5 cut(s) 46, 145, 174, 479, 605
CviKI_1 RGCY 5 cut(s) 46, 145, 174, 479, 605
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
EaeI YGGCCR 1 cut(s) 603
Eco130I CCWWGG 2 cut(s) 277, 444
Eco24I GRGCYC 1 cut(s) 176
Eco47I GGWCC 1 cut(s) 220
EcoNI CCTNNNNNAGG 1 cut(s) 485
EcoRI GAATTC 2 cut(s) 439, 512
EcoT14I CCWWGG 2 cut(s) 277, 444
EcoT38I GRGCYC 1 cut(s) 176
ErhI CCWWGG 2 cut(s) 277, 444
FaeI CATG 3 cut(s) 23, 439, 512
FatI CATG 3 cut(s) 19, 435, 508
FauNDI CATATG 1 cut(s) 49
Fnu4HI GCNGC 1 cut(s) 44
FriOI GRGCYC 1 cut(s) 176
Fsp4HI GCNGC 1 cut(s) 44
FspBI CTAG 2 cut(s) 291, 688
GluI GCNGC 1 cut(s) 44
HaeIII GGCC 1 cut(s) 605
Hin1II CATG 3 cut(s) 23, 439, 512
HindIII AAGCTT 1 cut(s) 143
Hpy188I TCNGA 3 cut(s) 312, 340, 664
Hpy188III TCNNGA 6 cut(s) 26, 66, 185, 436, 509, 533
HpyAV CCTTC 2 cut(s) 26, 491
HpyCH4IV ACGT 1 cut(s) 528
HpyCH4V TGCA 4 cut(s) 169, 429, 493, 597
HpyF10VI GCNNNNNNNGC 3 cut(s) 241, 279, 350
HpySE526I ACGT 1 cut(s) 528
Hsp92II CATG 3 cut(s) 23, 439, 512
Kzo9I GATC 1 cut(s) 196
LmnI GCTCC 1 cut(s) 358
LpnPI CCDG 4 cut(s) 155, 415, 587, 633
Lsp1109I GCAGC 1 cut(s) 55
MaeI CTAG 2 cut(s) 291, 688
MaeII ACGT 1 cut(s) 528
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 4 cut(s) 41, 218, 461, 464
MhlI GDGCHC 1 cut(s) 176
MlsI TGGCCA 1 cut(s) 605
MluNI TGGCCA 1 cut(s) 605
MmeI TCCRAC 2 cut(s) 198, 431
MnlI CCTC 6 cut(s) 24, 46, 99, 187, 311, 517
Mox20I TGGCCA 1 cut(s) 605
MroXI GAANNNNTTC 1 cut(s) 480
MscI TGGCCA 1 cut(s) 605
MseI TTAA 4 cut(s) 116, 147, 155, 558
Msp20I TGGCCA 1 cut(s) 605
MwoI GCNNNNNNNGC 3 cut(s) 241, 279, 350
NdeI CATATG 1 cut(s) 49
NdeII GATC 1 cut(s) 196
NlaIII CATG 3 cut(s) 23, 439, 512
NlaIV GGNNCC 1 cut(s) 12
NspI RCATGY 1 cut(s) 23
PagI TCATGA 2 cut(s) 435, 508
PciI ACATGT 1 cut(s) 19
PdmI GAANNNNTTC 1 cut(s) 480
PkrI GCNGC 1 cut(s) 45
PscI ACATGT 1 cut(s) 19
PshBI ATTAAT 1 cut(s) 155
PsiI TTATAA 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 12
PspPI GGNCC 1 cut(s) 220
SaqAI TTAA 4 cut(s) 116, 147, 155, 558
SatI GCNGC 1 cut(s) 44
Sau3AI GATC 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 220
SduI GDGCHC 1 cut(s) 176
SinI GGWCC 1 cut(s) 220
SsiI CCGC 1 cut(s) 251
SspMI CTAG 2 cut(s) 291, 688
StyI CCWWGG 2 cut(s) 277, 444
TaiI ACGT 1 cut(s) 531
TaqI TCGA 1 cut(s) 199
Tru1I TTAA 4 cut(s) 116, 147, 155, 558
Tru9I TTAA 4 cut(s) 116, 147, 155, 558
TseI GCWGC 1 cut(s) 43
TspDTI ATGAA 4 cut(s) 424, 452, 505, 525
VpaK11BI GGWCC 1 cut(s) 220
VspI ATTAAT 1 cut(s) 155
XagI CCTNNNNNAGG 1 cut(s) 485
XapI RAATTY 4 cut(s) 112, 439, 512, 560
XceI RCATGY 1 cut(s) 23
XmnI GAANNNNTTC 1 cut(s) 480
XspI CTAG 2 cut(s) 291, 688
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.