pycom1880g00030

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00001880
Physical Location & Seq
Forward (+)
26650 .. 33663
7014 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 780 bp
ATGAGGAGTGGTGTGGATGTTGTAGGTGAAGTGGATGTAGCGGCAAACTCATCGAACCTTAGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTTCAGGTGAAGACTCTGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAAAAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCTCGGTCCCGCCAAGTGGAATCGTTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGCTTGCGTCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGCCTCCCGCTTCTATGCCTCCCGCTTCTATGCCTTCCGCTTCTGCGCCTCGTAGTGGGGCTTCACGCAAACAACCTTTGAGTGGTGTTTGGATTATAAGGGAATGGATGGGAAGCTCACGGCTAGGGAAGGGAGAATGTGTTTGTAATGTGTTGTGTATGAAATGA

Protein Analysis

260

Amino Acids

28.09

Weight (kDa)

8.73

Isoelectric Point (pI)

62.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 710
AccB1I GGYRCC 2 cut(s) 117, 534
AccB7I CCANNNNNTGG 1 cut(s) 561
AccBSI CCGCTC 1 cut(s) 608
AciI CCGC 6 cut(s) 41, 340, 606, 621, 636, 651
AclWI GGATC 2 cut(s) 80, 382
AcoI YGGCCR 2 cut(s) 258, 563
AcsI RAATTY 1 cut(s) 492
AcyI GRCGYC 2 cut(s) 118, 177
AdeI CACNNNGTG 1 cut(s) 284
AfaI GTAC 1 cut(s) 404
AfeI AGCGCT 1 cut(s) 559
AfiI CCNNNNNNNGG 6 cut(s) 104, 152, 346, 561, 668, 695
AflII CTTAAG 2 cut(s) 377, 398
AgsI TTSAA 1 cut(s) 266
AjnI CCWGG 2 cut(s) 544, 578
AluBI AGCT 8 cut(s) 63, 188, 200, 397, 463, 472, 593, 729
AluI AGCT 8 cut(s) 63, 188, 200, 397, 463, 472, 593, 729
Alw26I GTCTC 1 cut(s) 80
AlwI GGATC 2 cut(s) 80, 382
Aor51HI AGCGCT 1 cut(s) 559
AoxI GGCC 4 cut(s) 258, 316, 563, 576
ApeKI GCWGC 4 cut(s) 81, 232, 394, 472
ApoI RAATTY 1 cut(s) 492
AspLEI GCGC 4 cut(s) 97, 120, 560, 661
AspS9I GGNCC 4 cut(s) 143, 246, 316, 336
AsuHPI GGTGA 2 cut(s) 38, 167
AvaII GGWCC 3 cut(s) 143, 246, 336
BalI TGGCCA 1 cut(s) 565
BanI GGYRCC 2 cut(s) 117, 534
BarI GAAGNNNNNNTAC 2 cut(s) 658, 690
BbsI GAAGAC 1 cut(s) 165
BbvI GCAGC 4 cut(s) 93, 219, 406, 459
BccI CCATC 2 cut(s) 352, 715
BceAI ACGGC 2 cut(s) 245, 749
BcgI CGANNNNNNTGC 4 cut(s) 33, 67, 74, 108
BciT130I CCWGG 2 cut(s) 546, 580
BcoDI GTCTC 1 cut(s) 80
BfaI CTAG 2 cut(s) 590, 737
BfoI RGCGCY 2 cut(s) 121, 561
BfrI CTTAAG 2 cut(s) 377, 398
BisI GCNGC 5 cut(s) 42, 82, 233, 395, 473
BlsI GCNGC 5 cut(s) 43, 83, 234, 396, 474
Bme1390I CCNGG 2 cut(s) 546, 580
Bme18I GGWCC 3 cut(s) 143, 246, 336
BmgT120I GGNCC 4 cut(s) 143, 246, 316, 336
BmiI GGNNCC 3 cut(s) 119, 338, 536
BmrFI CCNGG 2 cut(s) 546, 580
BmsI GCATC 3 cut(s) 159, 588, 603
BpiI GAAGAC 1 cut(s) 165
BpmI CTGGAG 1 cut(s) 512
Bpu10I CCTNAGC 1 cut(s) 59
BsaHI GRCGYC 2 cut(s) 118, 177
BsaJI CCNNGG 1 cut(s) 545
BsaWI WCCGGW 1 cut(s) 88
BsaXI ACNNNNNCTCC 2 cut(s) 738, 768
Bsc4I CCNNNNNNNGG 6 cut(s) 104, 152, 346, 561, 668, 695
BseBI CCWGG 2 cut(s) 546, 580
BseDI CCNNGG 1 cut(s) 545
BseGI GGATG 5 cut(s) 22, 40, 456, 551, 726
BseLI CCNNNNNNNGG 6 cut(s) 104, 152, 346, 561, 668, 695
BseMII CTCAG 2 cut(s) 91, 474
BseRI GAGGAG 2 cut(s) 19, 200
BseXI GCAGC 4 cut(s) 93, 219, 406, 459
BshFI GGCC 4 cut(s) 260, 318, 565, 578
BshNI GGYRCC 2 cut(s) 117, 534
BsiSI CCGG 1 cut(s) 89
BslFI GGGAC 2 cut(s) 256, 322
BslI CCNNNNNNNGG 6 cut(s) 104, 152, 346, 561, 668, 695
BsmAI GTCTC 1 cut(s) 80
BsmFI GGGAC 2 cut(s) 256, 322
BsmI GAATGC 1 cut(s) 589
BsnI GGCC 4 cut(s) 260, 318, 565, 578
Bsp143I GATC 2 cut(s) 85, 387
BspACI CCGC 6 cut(s) 41, 340, 606, 621, 636, 651
BspANI GGCC 4 cut(s) 260, 318, 565, 578
BspCNI CTCAG 2 cut(s) 90, 475
BspLI GGNNCC 3 cut(s) 119, 338, 536
BspPI GGATC 2 cut(s) 80, 382
BspT107I GGYRCC 2 cut(s) 117, 534
BspTI CTTAAG 2 cut(s) 377, 398
BsrBI CCGCTC 1 cut(s) 608
BssECI CCNNGG 1 cut(s) 545
BssMI GATC 2 cut(s) 85, 387
BssNI GRCGYC 2 cut(s) 118, 177
Bst2UI CCWGG 2 cut(s) 546, 580
Bst4CI ACNGT 4 cut(s) 143, 246, 500, 506
Bst6I CTCTTC 1 cut(s) 449
BstACI GRCGYC 2 cut(s) 118, 177
BstAFI CTTAAG 2 cut(s) 377, 398
BstC8I GCNNGC 4 cut(s) 326, 330, 429, 516
BstDEI CTNAG 5 cut(s) 59, 64, 77, 281, 483
BstENI CCTNNNNNAGG 1 cut(s) 150
BstF5I GGATG 5 cut(s) 22, 40, 456, 551, 726
BstH2I RGCGCY 2 cut(s) 121, 561
BstHHI GCGC 4 cut(s) 97, 120, 560, 661
BstKTI GATC 2 cut(s) 88, 390
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 2 cut(s) 85, 387
BstMWI GCNNNNNNNGC 3 cut(s) 185, 469, 584
BstNI CCWGG 2 cut(s) 546, 580
BstNSI RCATGY 1 cut(s) 425
BstSCI CCNGG 2 cut(s) 544, 578
BstV1I GCAGC 4 cut(s) 93, 219, 406, 459
BstV2I GAAGAC 1 cut(s) 165
BstX2I RGATCY 1 cut(s) 387
BstYI RGATCY 1 cut(s) 387
BsuRI GGCC 4 cut(s) 260, 318, 565, 578
BtsCI GGATG 5 cut(s) 22, 40, 456, 551, 726
BtsIMutI CAGTG 2 cut(s) 296, 505
Cac8I GCNNGC 4 cut(s) 326, 330, 429, 516
CfoI GCGC 4 cut(s) 97, 120, 560, 661
Cfr13I GGNCC 4 cut(s) 143, 246, 316, 336
CpoI CGGWCCG 1 cut(s) 246
CseI GACGC 2 cut(s) 185, 507
Csp6I GTAC 1 cut(s) 403
CspI CGGWCCG 1 cut(s) 246
CviAII CATG 2 cut(s) 313, 422
CviQI GTAC 1 cut(s) 403
DdeI CTNAG 5 cut(s) 59, 64, 77, 281, 483
DinI GGCGCC 1 cut(s) 119
DpnI GATC 2 cut(s) 87, 389
DpnII GATC 2 cut(s) 85, 387
DraIII CACNNNGTG 1 cut(s) 284
EaeI YGGCCR 2 cut(s) 258, 563
Eam1104I CTCTTC 1 cut(s) 449
EarI CTCTTC 1 cut(s) 449
Eco147I AGGCCT 1 cut(s) 578
Eco47I GGWCC 3 cut(s) 143, 246, 336
Eco47III AGCGCT 1 cut(s) 559
EcoNI CCTNNNNNAGG 1 cut(s) 150
EcoRI GAATTC 1 cut(s) 492
EcoRII CCWGG 2 cut(s) 544, 578
EgeI GGCGCC 1 cut(s) 119
EheI GGCGCC 1 cut(s) 119
FaeI CATG 2 cut(s) 316, 425
FaiI YATR 7 cut(s) 115, 314, 423, 629, 644, 710, 773
FaqI GGGAC 2 cut(s) 256, 322
FatI CATG 2 cut(s) 312, 421
FauI CCCGC 4 cut(s) 347, 613, 628, 643
Fnu4HI GCNGC 5 cut(s) 42, 82, 233, 395, 473
FokI GGATG 5 cut(s) 29, 47, 463, 538, 733
Fsp4HI GCNGC 5 cut(s) 42, 82, 233, 395, 473
FspBI CTAG 2 cut(s) 590, 737
GlaI GCGC 4 cut(s) 96, 119, 559, 660
GluI GCNGC 5 cut(s) 42, 82, 233, 395, 473
GsuI CTGGAG 1 cut(s) 512
HaeII RGCGCY 2 cut(s) 121, 561
HaeIII GGCC 4 cut(s) 260, 318, 565, 578
HapII CCGG 1 cut(s) 89
HgaI GACGC 2 cut(s) 185, 507
HhaI GCGC 4 cut(s) 97, 120, 560, 661
Hin1I GRCGYC 2 cut(s) 118, 177
Hin1II CATG 2 cut(s) 316, 425
Hin6I GCGC 4 cut(s) 95, 118, 558, 659
HinP1I GCGC 4 cut(s) 95, 118, 558, 659
HindIII AAGCTT 1 cut(s) 461
HinfI GANTC 5 cut(s) 73, 161, 269, 350, 479
HpaII CCGG 1 cut(s) 89
HphI GGTGA 2 cut(s) 38, 167
Hpy188I TCNGA 4 cut(s) 250, 484, 597, 612
Hpy188III TCNNGA 3 cut(s) 240, 266, 529
Hpy99I CGWCG 1 cut(s) 448
HpyAV CCTTC 3 cut(s) 132, 657, 736
HpyCH4III ACNGT 4 cut(s) 143, 246, 500, 506
HpyCH4V TGCA 4 cut(s) 172, 421, 431, 475
HpyF10VI GCNNNNNNNGC 3 cut(s) 185, 469, 584
HpyF3I CTNAG 5 cut(s) 59, 64, 77, 281, 483
Hsp92I GRCGYC 2 cut(s) 118, 177
Hsp92II CATG 2 cut(s) 316, 425
HspAI GCGC 4 cut(s) 95, 118, 558, 659
KasI GGCGCC 1 cut(s) 117
Kzo9I GATC 2 cut(s) 85, 387
LmnI GCTCC 2 cut(s) 598, 613
Lsp1109I GCAGC 4 cut(s) 93, 219, 406, 459
LweI GCATC 3 cut(s) 159, 588, 603
MaeI CTAG 2 cut(s) 590, 737
MaeIII GTNAC 1 cut(s) 500
MalI GATC 2 cut(s) 87, 389
MbiI CCGCTC 1 cut(s) 608
MboI GATC 2 cut(s) 85, 387
MboII GAAGA 3 cut(s) 126, 170, 466
MflI RGATCY 1 cut(s) 387
MlsI TGGCCA 1 cut(s) 565
MluCI AATT 1 cut(s) 492
MluNI TGGCCA 1 cut(s) 565
Mly113I GGCGCC 1 cut(s) 118
MlyI GAGTC 3 cut(s) 82, 155, 278
MmeI TCCRAC 1 cut(s) 333
Mox20I TGGCCA 1 cut(s) 565
MscI TGGCCA 1 cut(s) 565
MseI TTAA 2 cut(s) 378, 399
Msp20I TGGCCA 1 cut(s) 565
MspCI CTTAAG 2 cut(s) 377, 398
MspI CCGG 1 cut(s) 89
MspR9I CCNGG 2 cut(s) 546, 580
Mva1269I GAATGC 1 cut(s) 589
MvaI CCWGG 2 cut(s) 546, 580
MwoI GCNNNNNNNGC 3 cut(s) 185, 469, 584
NarI GGCGCC 1 cut(s) 118
NdeII GATC 2 cut(s) 85, 387
NlaIII CATG 2 cut(s) 316, 425
NlaIV GGNNCC 3 cut(s) 119, 338, 536
NmuCI GTSAC 1 cut(s) 500
NspI RCATGY 1 cut(s) 425
PceI AGGCCT 1 cut(s) 578
PctI GAATGC 1 cut(s) 589
PfeI GAWTC 2 cut(s) 350, 479
PflMI CCANNNNNTGG 1 cut(s) 561
PkrI GCNGC 5 cut(s) 43, 83, 234, 396, 474
PleI GAGTC 3 cut(s) 81, 155, 277
PluTI GGCGCC 1 cut(s) 121
PpsI GAGTC 3 cut(s) 81, 155, 277
PsiI TTATAA 1 cut(s) 710
Psp6I CCWGG 2 cut(s) 544, 578
PspGI CCWGG 2 cut(s) 544, 578
PspN4I GGNNCC 3 cut(s) 119, 338, 536
PspPI GGNCC 4 cut(s) 143, 246, 316, 336
PsuI RGATCY 1 cut(s) 387
RsaI GTAC 1 cut(s) 404
RsaNI GTAC 1 cut(s) 403
Rsr2I CGGWCCG 1 cut(s) 246
RsrII CGGWCCG 1 cut(s) 246
SaqAI TTAA 2 cut(s) 378, 399
SatI GCNGC 5 cut(s) 42, 82, 233, 395, 473
Sau3AI GATC 2 cut(s) 85, 387
Sau96I GGNCC 4 cut(s) 143, 246, 316, 336
SchI GAGTC 3 cut(s) 82, 155, 278
ScrFI CCNGG 2 cut(s) 546, 580
SfaNI GCATC 3 cut(s) 159, 588, 603
SfoI GGCGCC 1 cut(s) 119
SinI GGWCC 3 cut(s) 143, 246, 336
SmlI CTYRAG 2 cut(s) 377, 398
SmoI CTYRAG 2 cut(s) 377, 398
Sse9I AATT 1 cut(s) 492
SseBI AGGCCT 1 cut(s) 578
SsiI CCGC 6 cut(s) 41, 340, 606, 621, 636, 651
SspDI GGCGCC 1 cut(s) 117
SspMI CTAG 2 cut(s) 590, 737
StuI AGGCCT 1 cut(s) 578
StyD4I CCNGG 2 cut(s) 544, 578
TaaI ACNGT 4 cut(s) 143, 246, 500, 506
TaqI TCGA 2 cut(s) 53, 490
TaqII GACCGA 1 cut(s) 324
TasI AATT 1 cut(s) 492
TauI GCSGC 1 cut(s) 44
TfiI GAWTC 2 cut(s) 350, 479
Tru1I TTAA 2 cut(s) 378, 399
Tru9I TTAA 2 cut(s) 378, 399
TscAI CASTG 2 cut(s) 296, 505
TseFI GTSAC 1 cut(s) 500
TseI GCWGC 4 cut(s) 81, 232, 394, 472
Tsp45I GTSAC 1 cut(s) 500
TspDTI ATGAA 1 cut(s) 467
TspRI CASTG 2 cut(s) 296, 505
Van91I CCANNNNNTGG 1 cut(s) 561
Vha464I CTTAAG 2 cut(s) 377, 398
VpaK11BI GGWCC 3 cut(s) 143, 246, 336
XagI CCTNNNNNAGG 1 cut(s) 150
XapI RAATTY 1 cut(s) 492
XceI RCATGY 1 cut(s) 425
XspI CTAG 2 cut(s) 590, 737
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.