pycom2189g00010

Chloroplast-localized elongation factor EF-G involved in protein synthesis in plastids. Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A- site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002189
Physical Location & Seq
Forward (+)
20444 .. 21376
933 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 933 bp
ATGTCCATGGATAATGATAAAAATTTTCAATTACTAACCTCTTTGACGCAGGACGAACAAAATCAAGACAAGAAGTTGGGTAAATTGGAGGAGCAAATTGGGCAGATTATGGAGTTTATGAAACAAATTCAAGAGCAAAGTGAACTCTCCAACTCAACTATTGAAAACTCGAAGGAAGATTTTGAAATCCATAATGCTATCACTTTGGGAAGTGCTATGGAGGTTGGAGCTGACCTAAAAATGTCCAAACATAGCCTAGAAGTGGATGAGGAGCTGCTAATTGAGGATGAGGAAGAAGACATGCACACGGCAAGGGTAGAACAACCCTTGCCGCAGCCCCCTATGCCCTCTAAATCACCCACCACAAGTAAGGACGTCCCAATTCCATGTGATTCTGATGTTATTCCACCCAATGTCCCTTTTCCTAGCAGGTTTTTGATTCCCAACCAAGAAGAAAGTAAAAAGGACATCGTGGAAGCCTTCCCAAAGGTGCAAAATGCTATTCCAATTCGTGGTGCAACACAGCAAGTTTTAGATGGTGTTGAATTCTTCAAAGGACTTTGTACACCAAGAAGAATGATTCAAGAAAAGGTAGTGGCTGGAGAAGATGTAGAAGGCATCAAAGAGGACATATTTGAAACCACAAAACCCAAAGAAGTTGAATTTGATGACATTGGACAAGTCATAACCATCACATGCAATCTGGCCAAGTCCAATATCCCTGAAACTTTCAAAGGAGTGGTGTTTGTCATTGAGTTCTTGTCGGACAAAACAAGTAAGTCATCTTCTTCAAATTCCATTACATTTTATACTAACTTGCTGATTTTGATGAATCAGGCACCTACACTAGAATTCAAACCAATGCCGGTTCACTTCAAGTATCACCTTCCATTCAAGGATCAATTCCATGCCGTGGGACCTAGGGAAGTTTGA

Protein Analysis

311

Amino Acids

35.0

Weight (kDa)

4.67

Isoelectric Point (pI)

51.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 378
Acc36I ACCTGC 1 cut(s) 420
AccB1I GGYRCC 1 cut(s) 838
AccB7I CCANNNNNTGG 2 cut(s) 512, 913
AciI CCGC 1 cut(s) 332
AclWI GGATC 1 cut(s) 906
AcoI YGGCCR 1 cut(s) 705
AcsI RAATTY 6 cut(s) 22, 126, 545, 662, 793, 851
AcyI GRCGYC 1 cut(s) 375
AfaI GTAC 1 cut(s) 565
AfiI CCNNNNNNNGG 3 cut(s) 262, 512, 913
AluBI AGCT 2 cut(s) 230, 274
AluI AGCT 2 cut(s) 230, 274
AlwI GGATC 1 cut(s) 906
AoxI GGCC 1 cut(s) 705
ApeKI GCWGC 2 cut(s) 274, 334
ApoI RAATTY 6 cut(s) 22, 126, 545, 662, 793, 851
AspA2I CCTAGG 1 cut(s) 920
AspS9I GGNCC 1 cut(s) 917
AsuHPI GGTGA 2 cut(s) 348, 875
AvaII GGWCC 1 cut(s) 917
AvrII CCTAGG 1 cut(s) 920
BalI TGGCCA 1 cut(s) 707
BanI GGYRCC 1 cut(s) 838
BarI GAAGNNNNNNTAC 2 cut(s) 769, 801
BbsI GAAGAC 1 cut(s) 303
BbvI GCAGC 2 cut(s) 261, 346
BccI CCATC 2 cut(s) 530, 698
BceAI ACGGC 2 cut(s) 324, 896
BfaI CTAG 4 cut(s) 257, 426, 848, 921
BfuAI ACCTGC 1 cut(s) 420
BisI GCNGC 3 cut(s) 275, 332, 335
BlnI CCTAGG 1 cut(s) 920
BlsI GCNGC 3 cut(s) 276, 333, 336
Bme18I GGWCC 1 cut(s) 917
BmgT120I GGNCC 1 cut(s) 917
BmiI GGNNCC 2 cut(s) 840, 918
BmsI GCATC 1 cut(s) 627
BpiI GAAGAC 1 cut(s) 303
BpmI CTGGAG 1 cut(s) 621
BsaHI GRCGYC 1 cut(s) 375
BsaJI CCNNGG 3 cut(s) 6, 912, 920
BsaXI ACNNNNNCTCC 2 cut(s) 594, 624
Bsc4I CCNNNNNNNGG 3 cut(s) 262, 512, 913
Bse118I RCCGGY 1 cut(s) 865
BseDI CCNNGG 3 cut(s) 6, 912, 920
BseGI GGATG 2 cut(s) 271, 292
BseLI CCNNNNNNNGG 3 cut(s) 262, 512, 913
BseRI GAGGAG 2 cut(s) 104, 284
BseXI GCAGC 2 cut(s) 261, 346
BshFI GGCC 1 cut(s) 707
BshNI GGYRCC 1 cut(s) 838
BsiSI CCGG 1 cut(s) 866
BslFI GGGAC 2 cut(s) 362, 401
BslI CCNNNNNNNGG 3 cut(s) 262, 512, 913
BsmFI GGGAC 2 cut(s) 362, 401
BsnI GGCC 1 cut(s) 707
Bsp1407I TGTACA 1 cut(s) 563
Bsp143I GATC 1 cut(s) 898
Bsp19I CCATGG 1 cut(s) 6
BspACI CCGC 1 cut(s) 332
BspANI GGCC 1 cut(s) 707
BspLI GGNNCC 2 cut(s) 840, 918
BspMI ACCTGC 1 cut(s) 420
BspPI GGATC 1 cut(s) 906
BspT107I GGYRCC 1 cut(s) 838
BsrFI RCCGGY 1 cut(s) 865
BsrGI TGTACA 1 cut(s) 563
BssAI RCCGGY 1 cut(s) 865
BssECI CCNNGG 3 cut(s) 6, 912, 920
BssMI GATC 1 cut(s) 898
BssNI GRCGYC 1 cut(s) 375
BssT1I CCWWGG 2 cut(s) 6, 920
BstACI GRCGYC 1 cut(s) 375
BstAUI TGTACA 1 cut(s) 563
BstDSI CCRYGG 2 cut(s) 6, 912
BstF5I GGATG 2 cut(s) 271, 292
BstKTI GATC 1 cut(s) 901
BstMBI GATC 1 cut(s) 898
BstMWI GCNNNNNNNGC 2 cut(s) 100, 343
BstNSI RCATGY 2 cut(s) 304, 699
BstV1I GCAGC 2 cut(s) 261, 346
BstV2I GAAGAC 1 cut(s) 303
BsuRI GGCC 1 cut(s) 707
BtgI CCRYGG 2 cut(s) 6, 912
BtsCI GGATG 2 cut(s) 271, 292
BveI ACCTGC 1 cut(s) 420
Cfr10I RCCGGY 1 cut(s) 865
Cfr13I GGNCC 1 cut(s) 917
CseI GACGC 1 cut(s) 55
Csp6I GTAC 1 cut(s) 564
CviAII CATG 5 cut(s) 7, 301, 387, 696, 908
CviJI RGCY 7 cut(s) 230, 255, 274, 337, 479, 599, 707
CviKI_1 RGCY 7 cut(s) 230, 255, 274, 337, 479, 599, 707
CviQI GTAC 1 cut(s) 564
DpnI GATC 1 cut(s) 900
DpnII GATC 1 cut(s) 898
EaeI YGGCCR 1 cut(s) 705
Eco130I CCWWGG 2 cut(s) 6, 920
Eco47I GGWCC 1 cut(s) 917
EcoO109I RGGNCCY 1 cut(s) 917
EcoRI GAATTC 2 cut(s) 545, 851
EcoT14I CCWWGG 2 cut(s) 6, 920
ErhI CCWWGG 2 cut(s) 6, 920
FaeI CATG 5 cut(s) 10, 304, 390, 699, 911
FaqI GGGAC 2 cut(s) 362, 401
FatI CATG 5 cut(s) 6, 300, 386, 695, 907
Fnu4HI GCNGC 3 cut(s) 275, 332, 335
FokI GGATG 2 cut(s) 278, 299
Fsp4HI GCNGC 3 cut(s) 275, 332, 335
FspBI CTAG 4 cut(s) 257, 426, 848, 921
GluI GCNGC 3 cut(s) 275, 332, 335
GsuI CTGGAG 1 cut(s) 621
HaeIII GGCC 1 cut(s) 707
HapII CCGG 1 cut(s) 866
HgaI GACGC 1 cut(s) 55
Hin1I GRCGYC 1 cut(s) 375
Hin1II CATG 5 cut(s) 10, 304, 390, 699, 911
HinfI GANTC 4 cut(s) 392, 439, 580, 832
HpaII CCGG 1 cut(s) 866
HphI GGTGA 2 cut(s) 348, 875
Hpy166II GTNNAC 3 cut(s) 143, 566, 871
Hpy188I TCNGA 2 cut(s) 397, 766
Hpy188III TCNNGA 3 cut(s) 65, 131, 584
Hpy8I GTNNAC 3 cut(s) 143, 566, 871
HpyAV CCTTC 4 cut(s) 166, 490, 608, 896
HpyCH4IV ACGT 1 cut(s) 375
HpyCH4V TGCA 4 cut(s) 304, 493, 518, 699
HpyF10VI GCNNNNNNNGC 2 cut(s) 100, 343
HpySE526I ACGT 1 cut(s) 375
Hsp92I GRCGYC 1 cut(s) 375
Hsp92II CATG 5 cut(s) 10, 304, 390, 699, 911
Kzo9I GATC 1 cut(s) 898
LmnI GCTCC 3 cut(s) 91, 227, 271
LpnPI CCDG 7 cut(s) 35, 415, 585, 689, 735, 821, 879
Lsp1109I GCAGC 2 cut(s) 261, 346
LweI GCATC 1 cut(s) 627
MaeI CTAG 4 cut(s) 257, 426, 848, 921
MaeII ACGT 1 cut(s) 375
MalI GATC 1 cut(s) 900
MboI GATC 1 cut(s) 898
MboII GAAGA 9 cut(s) 188, 305, 308, 464, 541, 585, 617, 777, 780
MlsI TGGCCA 1 cut(s) 707
MluNI TGGCCA 1 cut(s) 707
MmeI TCCRAC 3 cut(s) 174, 205, 744
MnlI CCTC 8 cut(s) 49, 82, 214, 262, 277, 283, 358, 619
Mox20I TGGCCA 1 cut(s) 707
MscI TGGCCA 1 cut(s) 707
Msp20I TGGCCA 1 cut(s) 707
MspI CCGG 1 cut(s) 866
MwoI GCNNNNNNNGC 2 cut(s) 100, 343
NcoI CCATGG 1 cut(s) 6
NdeII GATC 1 cut(s) 898
NlaIII CATG 5 cut(s) 10, 304, 390, 699, 911
NlaIV GGNNCC 2 cut(s) 840, 918
NspI RCATGY 2 cut(s) 304, 699
PfeI GAWTC 4 cut(s) 392, 439, 580, 832
PflMI CCANNNNNTGG 2 cut(s) 512, 913
PkrI GCNGC 3 cut(s) 276, 333, 336
PpuMI RGGWCCY 1 cut(s) 917
Psp5II RGGWCCY 1 cut(s) 917
PspN4I GGNNCC 2 cut(s) 840, 918
PspPI GGNCC 1 cut(s) 917
PspPPI RGGWCCY 1 cut(s) 917
RsaI GTAC 1 cut(s) 565
RsaNI GTAC 1 cut(s) 564
SatI GCNGC 3 cut(s) 275, 332, 335
Sau3AI GATC 1 cut(s) 898
Sau96I GGNCC 1 cut(s) 917
SfaNI GCATC 1 cut(s) 627
SinI GGWCC 1 cut(s) 917
SsiI CCGC 1 cut(s) 332
SspMI CTAG 4 cut(s) 257, 426, 848, 921
StyI CCWWGG 2 cut(s) 6, 920
TaiI ACGT 1 cut(s) 378
TaqI TCGA 1 cut(s) 170
TatI WGTACW 1 cut(s) 563
TauI GCSGC 1 cut(s) 334
TfiI GAWTC 4 cut(s) 392, 439, 580, 832
TseI GCWGC 2 cut(s) 274, 334
TspDTI ATGAA 2 cut(s) 134, 845
Van91I CCANNNNNTGG 2 cut(s) 512, 913
VpaK11BI GGWCC 1 cut(s) 917
XapI RAATTY 6 cut(s) 22, 126, 545, 662, 793, 851
XceI RCATGY 2 cut(s) 304, 699
XmaJI CCTAGG 1 cut(s) 920
XspI CTAG 4 cut(s) 257, 426, 848, 921
ZraI GACGTC 1 cut(s) 376
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.