pycom2749g00080

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002749
Physical Location & Seq
Forward (+)
40476 .. 58590
18115 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 753 bp
ATGAATCATGAATCATTGTGGATGAAAGGTGGAAGTGCATGTGTTGATAGGAGGCTAGGGGCAAACTCATCGAACCTTAGCTTAGATTTGAGTCTCAGCAGCGATCCGGTTGCGCCCCGTCAAGGTAATGTATGGCGCCCTTCTTTTTTATCTTCTAACGGTCCTCTTTCAGGTGAAGACTCTGTGATGCAGGATGCCACAACAGCTACAATAGTAGCTAAAAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGCTCTGTGTCCAACATGGGCCTACGCCTGCTTGCCCGCTCTCGTCAGGTGGAATCGTTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAAAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGTCACGGCGACCGTCAAAGGTTTTCTGCTTATCTCCAGAGGCATCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGCCTTCTGCTCCTATGCCTTCCGCTCCGATGCCTCCCGCTCCGATGCCTTCCGCTTCAAGAGTAAAGCCACGTAGTGGGGCCTCAAGCAAACAACCTTTGTGA

Protein Analysis

251

Amino Acids

27.21

Weight (kDa)

9.42

Isoelectric Point (pI)

71.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 135
AccB7I CCANNNNNTGG 2 cut(s) 597, 725
AccBSI CCGCTC 4 cut(s) 354, 644, 674, 689
AciI CCGC 5 cut(s) 352, 642, 672, 687, 702
AclWI GGATC 2 cut(s) 98, 400
AcoI YGGCCR 2 cut(s) 276, 599
AcsI RAATTY 1 cut(s) 510
AcyI GRCGYC 1 cut(s) 136
AdeI CACNNNGTG 2 cut(s) 302, 725
AfaI GTAC 1 cut(s) 422
AfeI AGCGCT 1 cut(s) 595
AfiI CCNNNNNNNGG 4 cut(s) 122, 170, 597, 725
AflII CTTAAG 2 cut(s) 395, 416
AgsI TTSAA 2 cut(s) 284, 708
AjnI CCWGG 2 cut(s) 580, 614
AluBI AGCT 8 cut(s) 81, 206, 218, 318, 415, 481, 490, 629
AluI AGCT 8 cut(s) 81, 206, 218, 318, 415, 481, 490, 629
Alw21I GWGCWC 1 cut(s) 320
Alw26I GTCTC 1 cut(s) 98
AlwI GGATC 2 cut(s) 98, 400
Aor51HI AGCGCT 1 cut(s) 595
AoxI GGCC 5 cut(s) 276, 334, 599, 612, 729
ApeKI GCWGC 4 cut(s) 99, 250, 412, 490
ApoI RAATTY 1 cut(s) 510
AspLEI GCGC 3 cut(s) 115, 138, 596
AspS9I GGNCC 4 cut(s) 161, 264, 334, 729
AsuHPI GGTGA 1 cut(s) 185
AvaII GGWCC 2 cut(s) 161, 264
BalI TGGCCA 1 cut(s) 601
BanI GGYRCC 1 cut(s) 135
BanII GRGCYC 1 cut(s) 320
BbsI GAAGAC 1 cut(s) 183
Bbv12I GWGCWC 1 cut(s) 320
BbvI GCAGC 4 cut(s) 111, 237, 424, 477
BccI CCATC 1 cut(s) 370
BceAI ACGGC 2 cut(s) 263, 550
BcgI CGANNNNNNTGC 4 cut(s) 51, 85, 92, 126
BciT130I CCWGG 2 cut(s) 582, 616
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 2 cut(s) 56, 626
BfoI RGCGCY 2 cut(s) 139, 597
BfrI CTTAAG 2 cut(s) 395, 416
BisI GCNGC 4 cut(s) 100, 251, 413, 491
BlsI GCNGC 4 cut(s) 101, 252, 414, 492
Bme1390I CCNGG 2 cut(s) 582, 616
Bme18I GGWCC 2 cut(s) 161, 264
BmgT120I GGNCC 4 cut(s) 161, 264, 334, 729
BmiI GGNNCC 2 cut(s) 137, 730
BmrFI CCNGG 2 cut(s) 582, 616
BmsI GCATC 7 cut(s) 177, 184, 580, 624, 639, 669, 684
BpiI GAAGAC 1 cut(s) 183
BpmI CTGGAG 1 cut(s) 548
Bpu10I CCTNAGC 1 cut(s) 77
BpuEI CTTGAG 1 cut(s) 718
BsaAI YACGTR 1 cut(s) 722
BsaHI GRCGYC 1 cut(s) 136
BsaWI WCCGGW 1 cut(s) 106
Bsc4I CCNNNNNNNGG 4 cut(s) 122, 170, 597, 725
BseBI CCWGG 2 cut(s) 582, 616
BseGI GGATG 4 cut(s) 27, 199, 474, 587
BseLI CCNNNNNNNGG 4 cut(s) 122, 170, 597, 725
BseMII CTCAG 2 cut(s) 109, 492
BseRI GAGGAG 1 cut(s) 218
BseXI GCAGC 4 cut(s) 111, 237, 424, 477
Bsh1285I CGRYCG 1 cut(s) 541
BshFI GGCC 5 cut(s) 278, 336, 601, 614, 731
BshNI GGYRCC 1 cut(s) 135
BsiEI CGRYCG 1 cut(s) 541
BsiHKAI GWGCWC 1 cut(s) 320
BsiSI CCGG 1 cut(s) 107
BslFI GGGAC 1 cut(s) 274
BslI CCNNNNNNNGG 4 cut(s) 122, 170, 597, 725
BsmAI GTCTC 1 cut(s) 98
BsmFI GGGAC 1 cut(s) 274
BsmI GAATGC 1 cut(s) 625
BsnI GGCC 5 cut(s) 278, 336, 601, 614, 731
Bsp1286I GDGCHC 1 cut(s) 320
Bsp143I GATC 2 cut(s) 103, 405
BspACI CCGC 5 cut(s) 352, 642, 672, 687, 702
BspANI GGCC 5 cut(s) 278, 336, 601, 614, 731
BspCNI CTCAG 2 cut(s) 108, 493
BspHI TCATGA 1 cut(s) 7
BspLI GGNNCC 2 cut(s) 137, 730
BspPI GGATC 2 cut(s) 98, 400
BspT107I GGYRCC 1 cut(s) 135
BspTI CTTAAG 2 cut(s) 395, 416
BsrBI CCGCTC 4 cut(s) 354, 644, 674, 689
BssMI GATC 2 cut(s) 103, 405
BssNI GRCGYC 1 cut(s) 136
Bst2UI CCWGG 2 cut(s) 582, 616
Bst4CI ACNGT 5 cut(s) 161, 264, 518, 524, 542
BstACI GRCGYC 1 cut(s) 136
BstAFI CTTAAG 2 cut(s) 395, 416
BstBAI YACGTR 1 cut(s) 722
BstC8I GCNNGC 5 cut(s) 316, 344, 348, 352, 447
BstDEI CTNAG 5 cut(s) 77, 82, 95, 299, 501
BstENI CCTNNNNNAGG 1 cut(s) 168
BstF5I GGATG 4 cut(s) 27, 199, 474, 587
BstH2I RGCGCY 2 cut(s) 139, 597
BstHHI GCGC 3 cut(s) 115, 138, 596
BstKTI GATC 2 cut(s) 106, 408
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 2 cut(s) 103, 405
BstMCI CGRYCG 1 cut(s) 541
BstMWI GCNNNNNNNGC 4 cut(s) 203, 487, 591, 620
BstNI CCWGG 2 cut(s) 582, 616
BstNSI RCATGY 2 cut(s) 42, 443
BstSCI CCNGG 2 cut(s) 580, 614
BstV1I GCAGC 4 cut(s) 111, 237, 424, 477
BstV2I GAAGAC 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 405
BstYI RGATCY 1 cut(s) 405
BsuRI GGCC 5 cut(s) 278, 336, 601, 614, 731
BtsCI GGATG 4 cut(s) 27, 199, 474, 587
BtsIMutI CAGTG 2 cut(s) 314, 523
Cac8I GCNNGC 5 cut(s) 316, 344, 348, 352, 447
CciI TCATGA 1 cut(s) 7
CfoI GCGC 3 cut(s) 115, 138, 596
Cfr13I GGNCC 4 cut(s) 161, 264, 334, 729
CpoI CGGWCCG 1 cut(s) 264
Csp6I GTAC 1 cut(s) 421
CspI CGGWCCG 1 cut(s) 264
CviAII CATG 4 cut(s) 8, 39, 331, 440
CviQI GTAC 1 cut(s) 421
DdeI CTNAG 5 cut(s) 77, 82, 95, 299, 501
DinI GGCGCC 1 cut(s) 137
DpnI GATC 2 cut(s) 105, 407
DpnII GATC 2 cut(s) 103, 405
DraIII CACNNNGTG 2 cut(s) 302, 725
EaeI YGGCCR 2 cut(s) 276, 599
Ecl136II GAGCTC 1 cut(s) 318
Eco147I AGGCCT 1 cut(s) 614
Eco24I GRGCYC 1 cut(s) 320
Eco47I GGWCC 2 cut(s) 161, 264
Eco47III AGCGCT 1 cut(s) 595
Eco53kI GAGCTC 1 cut(s) 318
EcoICRI GAGCTC 1 cut(s) 318
EcoNI CCTNNNNNAGG 1 cut(s) 168
EcoO109I RGGNCCY 1 cut(s) 729
EcoRI GAATTC 1 cut(s) 510
EcoRII CCWGG 2 cut(s) 580, 614
EcoT38I GRGCYC 1 cut(s) 320
EgeI GGCGCC 1 cut(s) 137
EheI GGCGCC 1 cut(s) 137
FaeI CATG 4 cut(s) 11, 42, 334, 443
FaiI YATR 6 cut(s) 9, 40, 133, 332, 441, 665
FaqI GGGAC 1 cut(s) 274
FatI CATG 4 cut(s) 7, 38, 330, 439
FauI CCCGC 3 cut(s) 359, 649, 694
Fnu4HI GCNGC 4 cut(s) 100, 251, 413, 491
FokI GGATG 4 cut(s) 34, 206, 481, 574
FriOI GRGCYC 1 cut(s) 320
Fsp4HI GCNGC 4 cut(s) 100, 251, 413, 491
FspBI CTAG 2 cut(s) 56, 626
GlaI GCGC 3 cut(s) 114, 137, 595
GluI GCNGC 4 cut(s) 100, 251, 413, 491
GsuI CTGGAG 1 cut(s) 548
HaeII RGCGCY 2 cut(s) 139, 597
HaeIII GGCC 5 cut(s) 278, 336, 601, 614, 731
HapII CCGG 1 cut(s) 107
HhaI GCGC 3 cut(s) 115, 138, 596
Hin1I GRCGYC 1 cut(s) 136
Hin1II CATG 4 cut(s) 11, 42, 334, 443
Hin6I GCGC 3 cut(s) 113, 136, 594
HinP1I GCGC 3 cut(s) 113, 136, 594
HindIII AAGCTT 1 cut(s) 479
HinfI GANTC 7 cut(s) 4, 11, 91, 179, 287, 368, 497
HpaII CCGG 1 cut(s) 107
HphI GGTGA 1 cut(s) 185
Hpy188I TCNGA 6 cut(s) 268, 502, 633, 648, 678, 693
Hpy188III TCNNGA 5 cut(s) 8, 258, 284, 565, 708
Hpy99I CGWCG 1 cut(s) 466
HpyAV CCTTC 4 cut(s) 150, 663, 678, 708
HpyCH4III ACNGT 5 cut(s) 161, 264, 518, 524, 542
HpyCH4IV ACGT 1 cut(s) 721
HpyCH4V TGCA 5 cut(s) 38, 190, 439, 449, 493
HpyF10VI GCNNNNNNNGC 4 cut(s) 203, 487, 591, 620
HpyF3I CTNAG 5 cut(s) 77, 82, 95, 299, 501
HpySE526I ACGT 1 cut(s) 721
Hsp92I GRCGYC 1 cut(s) 136
Hsp92II CATG 4 cut(s) 11, 42, 334, 443
HspAI GCGC 3 cut(s) 113, 136, 594
KasI GGCGCC 1 cut(s) 135
Kzo9I GATC 2 cut(s) 103, 405
LmnI GCTCC 5 cut(s) 634, 649, 664, 679, 694
Lsp1109I GCAGC 4 cut(s) 111, 237, 424, 477
LweI GCATC 7 cut(s) 177, 184, 580, 624, 639, 669, 684
MaeI CTAG 2 cut(s) 56, 626
MaeII ACGT 1 cut(s) 721
MaeIII GTNAC 2 cut(s) 518, 530
MalI GATC 2 cut(s) 105, 407
MbiI CCGCTC 4 cut(s) 354, 644, 674, 689
MboI GATC 2 cut(s) 103, 405
MboII GAAGA 2 cut(s) 144, 188
MflI RGATCY 1 cut(s) 405
MhlI GDGCHC 1 cut(s) 320
MlsI TGGCCA 1 cut(s) 601
MluCI AATT 1 cut(s) 510
MluNI TGGCCA 1 cut(s) 601
Mly113I GGCGCC 1 cut(s) 136
MlyI GAGTC 3 cut(s) 100, 173, 296
MmeI TCCRAC 1 cut(s) 351
Mox20I TGGCCA 1 cut(s) 601
MscI TGGCCA 1 cut(s) 601
MseI TTAA 2 cut(s) 396, 417
Msp20I TGGCCA 1 cut(s) 601
MspCI CTTAAG 2 cut(s) 395, 416
MspI CCGG 1 cut(s) 107
MspR9I CCNGG 2 cut(s) 582, 616
Mva1269I GAATGC 1 cut(s) 625
MvaI CCWGG 2 cut(s) 582, 616
MwoI GCNNNNNNNGC 4 cut(s) 203, 487, 591, 620
NarI GGCGCC 1 cut(s) 136
NdeII GATC 2 cut(s) 103, 405
NlaIII CATG 4 cut(s) 11, 42, 334, 443
NlaIV GGNNCC 2 cut(s) 137, 730
NmuCI GTSAC 2 cut(s) 518, 530
NspI RCATGY 2 cut(s) 42, 443
PagI TCATGA 1 cut(s) 7
PceI AGGCCT 1 cut(s) 614
PctI GAATGC 1 cut(s) 625
PfeI GAWTC 4 cut(s) 4, 11, 368, 497
PflMI CCANNNNNTGG 2 cut(s) 597, 725
PkrI GCNGC 4 cut(s) 101, 252, 414, 492
PleI GAGTC 3 cut(s) 99, 173, 295
PluTI GGCGCC 1 cut(s) 139
PpsI GAGTC 3 cut(s) 99, 173, 295
Ppu21I YACGTR 1 cut(s) 722
Psp124BI GAGCTC 1 cut(s) 320
Psp6I CCWGG 2 cut(s) 580, 614
PspGI CCWGG 2 cut(s) 580, 614
PspN4I GGNNCC 2 cut(s) 137, 730
PspPI GGNCC 4 cut(s) 161, 264, 334, 729
PsuI RGATCY 1 cut(s) 405
RsaI GTAC 1 cut(s) 422
RsaNI GTAC 1 cut(s) 421
Rsr2I CGGWCCG 1 cut(s) 264
RsrII CGGWCCG 1 cut(s) 264
SacI GAGCTC 1 cut(s) 320
SaqAI TTAA 2 cut(s) 396, 417
SatI GCNGC 4 cut(s) 100, 251, 413, 491
Sau3AI GATC 2 cut(s) 103, 405
Sau96I GGNCC 4 cut(s) 161, 264, 334, 729
SchI GAGTC 3 cut(s) 100, 173, 296
ScrFI CCNGG 2 cut(s) 582, 616
SduI GDGCHC 1 cut(s) 320
SfaNI GCATC 7 cut(s) 177, 184, 580, 624, 639, 669, 684
SfoI GGCGCC 1 cut(s) 137
SinI GGWCC 2 cut(s) 161, 264
SmlI CTYRAG 3 cut(s) 395, 416, 733
SmoI CTYRAG 3 cut(s) 395, 416, 733
Sse9I AATT 1 cut(s) 510
SseBI AGGCCT 1 cut(s) 614
SsiI CCGC 5 cut(s) 352, 642, 672, 687, 702
SspDI GGCGCC 1 cut(s) 135
SspMI CTAG 2 cut(s) 56, 626
SstI GAGCTC 1 cut(s) 320
StuI AGGCCT 1 cut(s) 614
StyD4I CCNGG 2 cut(s) 580, 614
TaaI ACNGT 5 cut(s) 161, 264, 518, 524, 542
TaiI ACGT 1 cut(s) 724
TaqI TCGA 2 cut(s) 71, 508
TasI AATT 1 cut(s) 510
TfiI GAWTC 4 cut(s) 4, 11, 368, 497
Tru1I TTAA 2 cut(s) 396, 417
Tru9I TTAA 2 cut(s) 396, 417
TscAI CASTG 2 cut(s) 314, 523
TseFI GTSAC 2 cut(s) 518, 530
TseI GCWGC 4 cut(s) 99, 250, 412, 490
Tsp45I GTSAC 2 cut(s) 518, 530
TspDTI ATGAA 4 cut(s) 17, 24, 38, 485
TspRI CASTG 2 cut(s) 314, 523
Van91I CCANNNNNTGG 2 cut(s) 597, 725
Vha464I CTTAAG 2 cut(s) 395, 416
VpaK11BI GGWCC 2 cut(s) 161, 264
XagI CCTNNNNNAGG 1 cut(s) 168
XapI RAATTY 1 cut(s) 510
XceI RCATGY 2 cut(s) 42, 443
XspI CTAG 2 cut(s) 56, 626
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.