pycom394g00080

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000394
Physical Location & Seq
Reverse (-)
76386 .. 93032
16647 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 372 bp
ATGGCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCCTCTCACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCATACTCATGGATCAGATCCAGCAGCTTAA

Protein Analysis

124

Amino Acids

13.0

Weight (kDa)

5.25

Isoelectric Point (pI)

40.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 78
AccBSI CCGCTC 1 cut(s) 297
AccII CGCG 2 cut(s) 56, 61
AciI CCGC 2 cut(s) 59, 295
AclWI GGATC 2 cut(s) 353, 361
AcoI YGGCCR 1 cut(s) 219
AcyI GRCGYC 2 cut(s) 79, 138
AdeI CACNNNGTG 1 cut(s) 245
AfiI CCNNNNNNNGG 4 cut(s) 25, 65, 113, 307
AflII CTTAAG 1 cut(s) 338
AgsI TTSAA 1 cut(s) 227
AjuI GAANNNNNNNTTGG 2 cut(s) 8, 40
AluBI AGCT 4 cut(s) 24, 149, 161, 368
AluI AGCT 4 cut(s) 24, 149, 161, 368
AlwI GGATC 2 cut(s) 353, 361
AoxI GGCC 2 cut(s) 219, 277
ApeKI GCWGC 2 cut(s) 193, 365
AscI GGCGCGCC 1 cut(s) 54
AspLEI GCGC 3 cut(s) 56, 58, 81
AspS9I GGNCC 3 cut(s) 104, 207, 277
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 2 cut(s) 104, 207
BanI GGYRCC 1 cut(s) 78
BbsI GAAGAC 1 cut(s) 126
BbvI GCAGC 1 cut(s) 180
BccI CCATC 1 cut(s) 313
BceAI ACGGC 1 cut(s) 206
BcgI CGANNNNNNTGC 1 cut(s) 28
BfaI CTAG 1 cut(s) 162
BfoI RGCGCY 1 cut(s) 82
BfrI CTTAAG 1 cut(s) 338
BisI GCNGC 3 cut(s) 59, 194, 366
BlsI GCNGC 3 cut(s) 60, 195, 367
Bme18I GGWCC 2 cut(s) 104, 207
BmgT120I GGNCC 3 cut(s) 104, 207, 277
BmiI GGNNCC 2 cut(s) 80, 167
BmsI GCATC 1 cut(s) 120
BpiI GAAGAC 1 cut(s) 126
Bpu10I CCTNAGC 2 cut(s) 20, 38
BsaHI GRCGYC 2 cut(s) 79, 138
Bsc4I CCNNNNNNNGG 4 cut(s) 25, 65, 113, 307
BseLI CCNNNNNNNGG 4 cut(s) 25, 65, 113, 307
BsePI GCGCGC 1 cut(s) 54
BseRI GAGGAG 1 cut(s) 161
BseXI GCAGC 1 cut(s) 180
Bsh1236I CGCG 2 cut(s) 56, 61
BshFI GGCC 2 cut(s) 221, 279
BshNI GGYRCC 1 cut(s) 78
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 4 cut(s) 25, 65, 113, 307
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 2 cut(s) 221, 279
Bsp143I GATC 2 cut(s) 353, 358
BspACI CCGC 2 cut(s) 59, 295
BspANI GGCC 2 cut(s) 221, 279
BspFNI CGCG 2 cut(s) 56, 61
BspLI GGNNCC 2 cut(s) 80, 167
BspPI GGATC 2 cut(s) 353, 361
BspT107I GGYRCC 1 cut(s) 78
BspTI CTTAAG 1 cut(s) 338
BsrBI CCGCTC 1 cut(s) 297
BssHII GCGCGC 1 cut(s) 54
BssMI GATC 2 cut(s) 353, 358
BssNI GRCGYC 2 cut(s) 79, 138
Bst4CI ACNGT 2 cut(s) 104, 207
BstACI GRCGYC 2 cut(s) 79, 138
BstAFI CTTAAG 1 cut(s) 338
BstC8I GCNNGC 4 cut(s) 56, 287, 291, 295
BstDEI CTNAG 3 cut(s) 20, 38, 242
BstENI CCTNNNNNAGG 1 cut(s) 111
BstFNI CGCG 2 cut(s) 56, 61
BstH2I RGCGCY 1 cut(s) 82
BstHHI GCGC 3 cut(s) 56, 58, 81
BstKTI GATC 2 cut(s) 356, 361
BstMBI GATC 2 cut(s) 353, 358
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstUI CGCG 2 cut(s) 56, 61
BstV1I GCAGC 1 cut(s) 180
BstV2I GAAGAC 1 cut(s) 126
BstX2I RGATCY 1 cut(s) 358
BstYI RGATCY 1 cut(s) 358
BsuRI GGCC 2 cut(s) 221, 279
BtsI GCAGTG 1 cut(s) 49
BtsIMutI CAGTG 2 cut(s) 49, 257
Cac8I GCNNGC 4 cut(s) 56, 287, 291, 295
CfoI GCGC 3 cut(s) 56, 58, 81
Cfr13I GGNCC 3 cut(s) 104, 207, 277
CpoI CGGWCCG 1 cut(s) 207
CseI GACGC 2 cut(s) 50, 146
CspI CGGWCCG 1 cut(s) 207
CviAII CATG 2 cut(s) 274, 350
CviJI RGCY 8 cut(s) 24, 36, 149, 161, 193, 221, 279, 368
CviKI_1 RGCY 8 cut(s) 24, 36, 149, 161, 193, 221, 279, 368
DdeI CTNAG 3 cut(s) 20, 38, 242
DinI GGCGCC 1 cut(s) 80
DpnI GATC 2 cut(s) 355, 360
DpnII GATC 2 cut(s) 353, 358
DraIII CACNNNGTG 1 cut(s) 245
EaeI YGGCCR 1 cut(s) 219
Eco47I GGWCC 2 cut(s) 104, 207
EcoNI CCTNNNNNAGG 1 cut(s) 111
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
FaeI CATG 2 cut(s) 277, 353
FaiI YATR 4 cut(s) 76, 275, 345, 351
FaqI GGGAC 1 cut(s) 217
FatI CATG 2 cut(s) 273, 349
FauI CCCGC 1 cut(s) 302
Fnu4HI GCNGC 3 cut(s) 59, 194, 366
Fsp4HI GCNGC 3 cut(s) 59, 194, 366
FspBI CTAG 1 cut(s) 162
GlaI GCGC 3 cut(s) 55, 57, 80
GluI GCNGC 3 cut(s) 59, 194, 366
HaeII RGCGCY 1 cut(s) 82
HaeIII GGCC 2 cut(s) 221, 279
HgaI GACGC 2 cut(s) 50, 146
HhaI GCGC 3 cut(s) 56, 58, 81
Hin1I GRCGYC 2 cut(s) 79, 138
Hin1II CATG 2 cut(s) 277, 353
Hin6I GCGC 3 cut(s) 54, 56, 79
HinP1I GCGC 3 cut(s) 54, 56, 79
HinfI GANTC 3 cut(s) 122, 230, 311
HphI GGTGA 1 cut(s) 128
Hpy188I TCNGA 2 cut(s) 211, 358
Hpy188III TCNNGA 2 cut(s) 201, 227
HpyAV CCTTC 1 cut(s) 93
HpyCH4III ACNGT 2 cut(s) 104, 207
HpyCH4IV ACGT 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 133
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 3 cut(s) 20, 38, 242
HpySE526I ACGT 1 cut(s) 72
Hsp92I GRCGYC 2 cut(s) 79, 138
Hsp92II CATG 2 cut(s) 277, 353
HspAI GCGC 3 cut(s) 54, 56, 79
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 353, 358
LmnI GCTCC 1 cut(s) 302
LpnPI CCDG 5 cut(s) 99, 119, 186, 290, 299
Lsp1109I GCAGC 1 cut(s) 180
LweI GCATC 1 cut(s) 120
MaeI CTAG 1 cut(s) 162
MaeII ACGT 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 68
MalI GATC 2 cut(s) 355, 360
MbiI CCGCTC 1 cut(s) 297
MboI GATC 2 cut(s) 353, 358
MboII GAAGA 2 cut(s) 87, 131
MflI RGATCY 1 cut(s) 358
MluCI AATT 1 cut(s) 29
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 2 cut(s) 116, 239
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 5 cut(s) 117, 179, 182, 245, 319
MseI TTAA 2 cut(s) 339, 370
MslI CAYNNNNRTG 1 cut(s) 348
MspCI CTTAAG 1 cut(s) 338
MvnI CGCG 2 cut(s) 56, 61
MwoI GCNNNNNNNGC 1 cut(s) 146
NarI GGCGCC 1 cut(s) 79
NdeII GATC 2 cut(s) 353, 358
NlaIII CATG 2 cut(s) 277, 353
NlaIV GGNNCC 2 cut(s) 80, 167
PalAI GGCGCGCC 1 cut(s) 54
PauI GCGCGC 1 cut(s) 54
PfeI GAWTC 1 cut(s) 311
PkrI GCNGC 3 cut(s) 60, 195, 367
PleI GAGTC 2 cut(s) 116, 238
PluTI GGCGCC 1 cut(s) 82
PpsI GAGTC 2 cut(s) 116, 238
PspN4I GGNNCC 2 cut(s) 80, 167
PspPI GGNCC 3 cut(s) 104, 207, 277
PsuI RGATCY 1 cut(s) 358
PteI GCGCGC 1 cut(s) 54
RseI CAYNNNNRTG 1 cut(s) 348
Rsr2I CGGWCCG 1 cut(s) 207
RsrII CGGWCCG 1 cut(s) 207
SaqAI TTAA 2 cut(s) 339, 370
SatI GCNGC 3 cut(s) 59, 194, 366
Sau3AI GATC 2 cut(s) 353, 358
Sau96I GGNCC 3 cut(s) 104, 207, 277
SchI GAGTC 2 cut(s) 116, 239
SfaNI GCATC 1 cut(s) 120
SfoI GGCGCC 1 cut(s) 80
SgsI GGCGCGCC 1 cut(s) 54
SinI GGWCC 2 cut(s) 104, 207
SmiMI CAYNNNNRTG 1 cut(s) 348
SmlI CTYRAG 1 cut(s) 338
SmoI CTYRAG 1 cut(s) 338
Sse9I AATT 1 cut(s) 29
SsiI CCGC 2 cut(s) 59, 295
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 1 cut(s) 162
TaaI ACNGT 2 cut(s) 104, 207
TaiI ACGT 1 cut(s) 75
TaqI TCGA 1 cut(s) 14
TasI AATT 1 cut(s) 29
TauI GCSGC 1 cut(s) 61
TfiI GAWTC 1 cut(s) 311
Tru1I TTAA 2 cut(s) 339, 370
Tru9I TTAA 2 cut(s) 339, 370
TscAI CASTG 2 cut(s) 49, 257
TseI GCWGC 2 cut(s) 193, 365
TspGWI ACGGA 1 cut(s) 115
TspRI CASTG 2 cut(s) 49, 257
Vha464I CTTAAG 1 cut(s) 338
VpaK11BI GGWCC 2 cut(s) 104, 207
XagI CCTNNNNNAGG 1 cut(s) 111
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.