pycom420g00320

Uncharacterized protein K02A2.6-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
Physical Location & Seq
Forward (+)
408115 .. 409331
1217 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 588 bp
ATGGGAAAGTCAACAACCGACTTGCCAGTACAAGGCCCTGGACAAGATTTGTCTCAGGTACAAAATCCCCTCATTGTTGTACCACCCGAGGCTACAAGTGCAACACACCGAGAAAAGGAAATTTGTCTTGGCGGACAGCCTCGCAACCTAGAAATTCCCAACCAAACTACATGCATATTCATCGAAGGAATAGTGGAAGATTGCGACGAAGATGGTGGGGAAGCCTTTGCTTGGTACATCAACCTCCCACCAAACTCCGTCCAGAGTTGGGAGGAATTGGTCGAGAAATTCCATGAACAATTCTATCGACCAGGGATGGAAATGTCAGTTGCATCATTAGCTAGGATGGCCCAAGCTTCAGAAGAATCGCCAATAGAATACTTAATAAGGTTCAAGTCGGCCAGGAATTGGTGTCGAGTACCTCTCCCTGAAGTTGAATTCGTTAGAATCGCTCTAAACGACCTAGATGTAGAATACAAAAAGAAATTCTTGGGGGAAAATATCCAAGATATGTACGAACTGGCTCACCACGTTGAGCAGTACGATTATTTGCTCCGAGGGGAAAAAATCTCAAAGTCCCCTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

196

Amino Acids

22.19

Weight (kDa)

4.69

Isoelectric Point (pI)

52.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Retrotrans_gag PF03732 73 - 152 3.5e-08 Retrotransposon gag protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000128)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g28082 FvH4_2g15191 FvH4_2g31621 FvH4_3g07261 FvH4_3g22806 FvH4_3g26703 FvH4_3g26704 FvH4_3g31360 FvH4_4g01161 FvH4_4g22271 FvH4_4g25732 FvH4_5g00242 FvH4_5g28911 FvH4_5g32461 FvH4_6g13112 FvH4_6g53790 FvH4_6g53791 FvH4_7g03661 FvH4_7g04125 FvH4_7g04126
pyrus_communis pycom01g01950 pycom01g01960 pycom01g03260 pycom01g07760 pycom01g11430 pycom01g23980 pycom02g15030 pycom02g18630 pycom03g12320 pycom03g18810 pycom03g19250 pycom04g05010 pycom04g06520 pycom04g06680 pycom04g09630 pycom04g09640 pycom05g06850 pycom05g07540 pycom05g08940 pycom06g04300 pycom06g05750 pycom06g06960 pycom06g19690 pycom07g08750 pycom07g10700 pycom07g10910 pycom07g27480 pycom07g27790 pycom07g27800 pycom08g13620 pycom09g03540 pycom09g03550 pycom09g09870 pycom09g13480 pycom09g14360 pycom09g14890 pycom09g14930 pycom09g15760 pycom10g02190 pycom10g05270 pycom10g06810 pycom10g06830 pycom10g08060 pycom10g08520 pycom11g02350 pycom11g14170 pycom11g15050 pycom11g19270 pycom11g20160 pycom11g22420 pycom12g08620 pycom12g08630 pycom12g10440 pycom12g16590 pycom133g00190 pycom13g20730 pycom13g22230 pycom13g22670 pycom13g23230 pycom13g23250 pycom13g24880 pycom13g25300 pycom13g28040 pycom13g29010 pycom14g07570 pycom14g18650 pycom15g04500 pycom15g09310 pycom15g27210 pycom15g30810 pycom15g34920 pycom16g16040 pycom16g17260 pycom16g17940 pycom16g20990 pycom16g23470 pycom16g24160 pycom16g24720 pycom16g25910 pycom16g25920 pycom16g26370 pycom17g03310 pycom17g12670 pycom17g17530 pycom17g25090 pycom17g27300 pycom17g27310 pycom420g00140 pycom420g00160 pycom420g00320 pycom505g00220 pycom520g00740 pycom520g01010 pycom520g01020 pycom576g00060 pycom675g00040
rosa_laevigata RLG00000022630
rosa_multiflora Rmu_co7993280.1_g000001 Rmu_co8054704.1_g000001 Rmu_co8148394.1_g000001 Rmu_co8243015.1_g000001 Rmu_co8272095.1_g000001 Rmu_co8282359.1_g000001 Rmu_co8334783.1_g000001 Rmu_co8404405.1_g000001 Rmu_sc0000161.1_g000030 Rmu_sc0000418.1_g000026 Rmu_sc0000488.1_g000015 Rmu_sc0000706.1_g000041 Rmu_sc0000720.1_g000013 Rmu_sc0000776.1_g000022 Rmu_sc0000948.1_g000017 Rmu_sc0001167.1_g000045 Rmu_sc0001167.1_g000047 Rmu_sc0001211.1_g000054 Rmu_sc0001241.1_g000019 Rmu_sc0001307.1_g000021 Rmu_sc0001438.1_g000043 Rmu_sc0001468.1_g000032 Rmu_sc0001851.1_g000020 Rmu_sc0002026.1_g000023 Rmu_sc0002811.1_g000016 Rmu_sc0002958.1_g000002 Rmu_sc0002958.1_g000003 Rmu_sc0003745.1_g000010 Rmu_sc0004234.1_g000006 Rmu_sc0004234.1_g000008 Rmu_sc0005035.1_g000001 Rmu_sc0005320.1_g000010 Rmu_sc0005866.1_g000006 Rmu_sc0006139.1_g000009 Rmu_sc0006504.1_g000008 Rmu_sc0006695.1_g000049 Rmu_sc0006695.1_g000050 Rmu_sc0006981.1_g000001 Rmu_sc0007108.1_g000012 Rmu_sc0007355.1_g000001 Rmu_sc0007873.1_g000015 Rmu_sc0007961.1_g000003 Rmu_sc0008991.1_g000005 Rmu_sc0009528.1_g000009 Rmu_sc0013299.1_g000003 Rmu_sc0013532.1_g000015 Rmu_sc0015524.1_g000001 Rmu_sc0015793.1_g000001 Rmu_sc0015817.1_g000006 Rmu_sc0015930.1_g000003 Rmu_sc0015930.1_g000006 Rmu_sc0016952.1_g000002 Rmu_sc0016952.1_g000003 Rmu_sc0018715.1_g000003 Rmu_sc0018715.1_g000005 Rmu_sc0023934.1_g000003 Rmu_sc0023989.1_g000002 Rmu_sc0023989.1_g000003 Rmu_sc0028612.1_g000001 Rmu_sc0029049.1_g000001 Rmu_sc0029639.1_g000001 Rmu_sc0035263.1_g000001 Rmu_sc0037892.1_g000001 Rmu_ssc0000170.1_g000024 Rmu_ssc0000233.1_g000057 Rmu_ssc0000259.1_g000055 Rmu_ssc0000259.1_g000057
rosa_roxburghii Rroxscaffold_4G00287780 Rroxscaffold_4G00325290 Rroxscaffold_5G00333910 Rroxscaffold_7G00211350
rosa_rugosa Rorug01G0056300 Rorug04G0149000 Rorug07G0222000
rosa_samantha Rh1AG072900 Rh1CG072000
rosa_wichuraiana Rw0G003630 Rw0G005250 Rw0G020770 Rw0G023770 Rw1G005460 Rw1G005980 Rw1G007190 Rw1G011350 Rw1G022520 Rw1G028660 Rw2G018620 Rw2G019490 Rw4G006910 Rw4G013020 Rw4G023970 Rw5G044650 Rw6G006590 Rw6G012210 Rw6G023750 Rw7G027370 Rw7G027460 Rw7G035570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 408
AciI CCGC 1 cut(s) 132
AcoI YGGCCR 1 cut(s) 399
AcsI RAATTY 5 cut(s) 120, 153, 287, 437, 485
AcuI CTGAAG 2 cut(s) 342, 450
AfaI GTAC 7 cut(s) 30, 60, 81, 236, 420, 515, 542
AfiI CCNNNNNNNGG 5 cut(s) 32, 115, 231, 268, 408
AgsI TTSAA 2 cut(s) 394, 437
AjnI CCWGG 4 cut(s) 37, 310, 401, 580
AjuI GAANNNNNNNTTGG 2 cut(s) 111, 143
AluBI AGCT 2 cut(s) 341, 356
AluI AGCT 2 cut(s) 341, 356
Alw26I GTCTC 1 cut(s) 57
Ama87I CYCGRG 1 cut(s) 86
AoxI GGCC 3 cut(s) 34, 348, 399
ApoI RAATTY 5 cut(s) 120, 153, 287, 437, 485
AspS9I GGNCC 2 cut(s) 35, 349
AsuHPI GGTGA 1 cut(s) 518
AvaI CYCGRG 1 cut(s) 86
BccI CCATC 3 cut(s) 206, 310, 340
BcgI CGANNNNNNTGC 2 cut(s) 163, 197
BciT130I CCWGG 4 cut(s) 39, 312, 403, 582
BcoDI GTCTC 1 cut(s) 57
BfaI CTAG 3 cut(s) 149, 342, 464
Bme1390I CCNGG 4 cut(s) 39, 312, 403, 582
BmeT110I CYCGRG 1 cut(s) 86
BmgT120I GGNCC 2 cut(s) 35, 349
BmrFI CCNGG 4 cut(s) 39, 312, 403, 582
BmsI GCATC 1 cut(s) 341
BplI GAGNNNNNCTC 2 cut(s) 408, 440
BsaJI CCNNGG 5 cut(s) 37, 87, 311, 556, 580
Bsc4I CCNNNNNNNGG 5 cut(s) 32, 115, 231, 268, 408
Bse1I ACTGG 2 cut(s) 26, 525
BseBI CCWGG 4 cut(s) 39, 312, 403, 582
BseDI CCNNGG 5 cut(s) 37, 87, 311, 556, 580
BseGI GGATG 2 cut(s) 321, 351
BseLI CCNNNNNNNGG 5 cut(s) 32, 115, 231, 268, 408
BseMII CTCAG 1 cut(s) 68
BseNI ACTGG 2 cut(s) 26, 525
BshFI GGCC 3 cut(s) 36, 350, 401
BsiHKCI CYCGRG 1 cut(s) 86
BslFI GGGAC 1 cut(s) 562
BslI CCNNNNNNNGG 5 cut(s) 32, 115, 231, 268, 408
BsmAI GTCTC 1 cut(s) 57
BsmFI GGGAC 1 cut(s) 562
BsnI GGCC 3 cut(s) 36, 350, 401
BsoBI CYCGRG 1 cut(s) 86
BspACI CCGC 1 cut(s) 132
BspANI GGCC 3 cut(s) 36, 350, 401
BspCNI CTCAG 1 cut(s) 67
BsrI ACTGG 2 cut(s) 26, 525
BssECI CCNNGG 5 cut(s) 37, 87, 311, 556, 580
Bst2UI CCWGG 4 cut(s) 39, 312, 403, 582
BstDEI CTNAG 1 cut(s) 54
BstF5I GGATG 2 cut(s) 321, 351
BstMAI GTCTC 1 cut(s) 57
BstMWI GCNNNNNNNGC 3 cut(s) 98, 338, 347
BstNI CCWGG 4 cut(s) 39, 312, 403, 582
BstNSI RCATGY 1 cut(s) 174
BstSCI CCNGG 4 cut(s) 37, 310, 401, 580
BsuRI GGCC 3 cut(s) 36, 350, 401
BtsCI GGATG 2 cut(s) 321, 351
Cfr13I GGNCC 2 cut(s) 35, 349
Csp6I GTAC 7 cut(s) 29, 59, 80, 235, 419, 514, 541
CviAII CATG 2 cut(s) 171, 293
CviQI GTAC 7 cut(s) 29, 59, 80, 235, 419, 514, 541
DdeI CTNAG 1 cut(s) 54
EaeI YGGCCR 1 cut(s) 399
EciI GGCGGA 1 cut(s) 147
Eco57I CTGAAG 2 cut(s) 342, 450
Eco88I CYCGRG 1 cut(s) 86
EcoO109I RGGNCCY 1 cut(s) 35
EcoRI GAATTC 1 cut(s) 437
EcoRII CCWGG 4 cut(s) 37, 310, 401, 580
EcoT22I ATGCAT 1 cut(s) 176
FaeI CATG 2 cut(s) 174, 296
FaiI YATR 4 cut(s) 172, 176, 294, 512
FalI AAGNNNNNCTT 2 cut(s) 473, 505
FaqI GGGAC 1 cut(s) 562
FatI CATG 2 cut(s) 170, 292
FokI GGATG 2 cut(s) 328, 358
FspBI CTAG 3 cut(s) 149, 342, 464
HaeIII GGCC 3 cut(s) 36, 350, 401
Hin1II CATG 2 cut(s) 174, 296
HincII GTYRAC 1 cut(s) 12
HindII GTYRAC 1 cut(s) 12
HindIII AAGCTT 1 cut(s) 354
HinfI GANTC 2 cut(s) 365, 447
HphI GGTGA 1 cut(s) 518
Hpy166II GTNNAC 1 cut(s) 12
Hpy188I TCNGA 2 cut(s) 361, 557
Hpy188III TCNNGA 2 cut(s) 262, 283
Hpy8I GTNNAC 1 cut(s) 12
Hpy99I CGWCG 1 cut(s) 209
HpyAV CCTTC 1 cut(s) 179
HpyCH4IV ACGT 1 cut(s) 531
HpyCH4V TGCA 3 cut(s) 101, 174, 332
HpyF10VI GCNNNNNNNGC 3 cut(s) 98, 338, 347
HpyF3I CTNAG 1 cut(s) 54
HpySE526I ACGT 1 cut(s) 531
Hsp92II CATG 2 cut(s) 174, 296
LmnI GCTCC 1 cut(s) 558
LweI GCATC 1 cut(s) 341
MaeI CTAG 3 cut(s) 149, 342, 464
MaeII ACGT 1 cut(s) 531
MboII GAAGA 3 cut(s) 209, 221, 374
MluCI AATT 8 cut(s) 120, 153, 275, 287, 299, 406, 437, 485
MnlI CCTC 7 cut(s) 80, 82, 150, 254, 265, 432, 551
Mph1103I ATGCAT 1 cut(s) 176
MseI TTAA 1 cut(s) 383
MspR9I CCNGG 4 cut(s) 39, 312, 403, 582
MvaI CCWGG 4 cut(s) 39, 312, 403, 582
MwoI GCNNNNNNNGC 3 cut(s) 98, 338, 347
NlaIII CATG 2 cut(s) 174, 296
NsiI ATGCAT 1 cut(s) 176
NspI RCATGY 1 cut(s) 174
PcsI WCGNNNNNNNCGW 1 cut(s) 456
PfeI GAWTC 2 cut(s) 365, 447
PflMI CCANNNNNTGG 1 cut(s) 408
Psp6I CCWGG 4 cut(s) 37, 310, 401, 580
PspGI CCWGG 4 cut(s) 37, 310, 401, 580
PspPI GGNCC 2 cut(s) 35, 349
RsaI GTAC 7 cut(s) 30, 60, 81, 236, 420, 515, 542
RsaNI GTAC 7 cut(s) 29, 59, 80, 235, 419, 514, 541
SaqAI TTAA 1 cut(s) 383
Sau96I GGNCC 2 cut(s) 35, 349
ScrFI CCNGG 4 cut(s) 39, 312, 403, 582
SetI ASST 9 cut(s) 60, 150, 246, 343, 358, 392, 424, 465, 534
SfaNI GCATC 1 cut(s) 341
Sse9I AATT 8 cut(s) 120, 153, 275, 287, 299, 406, 437, 485
SsiI CCGC 1 cut(s) 132
SspMI CTAG 3 cut(s) 149, 342, 464
StyD4I CCNGG 4 cut(s) 37, 310, 401, 580
TaiI ACGT 1 cut(s) 534
TaqI TCGA 4 cut(s) 183, 282, 307, 415
TasI AATT 8 cut(s) 120, 153, 275, 287, 299, 406, 437, 485
TatI WGTACW 1 cut(s) 28
TfiI GAWTC 2 cut(s) 365, 447
Tru1I TTAA 1 cut(s) 383
Tru9I TTAA 1 cut(s) 383
TspDTI ATGAA 2 cut(s) 169, 309
TspGWI ACGGA 1 cut(s) 247
Van91I CCANNNNNTGG 1 cut(s) 408
XapI RAATTY 5 cut(s) 120, 153, 287, 437, 485
XceI RCATGY 1 cut(s) 174
XspI CTAG 3 cut(s) 149, 342, 464
Zsp2I ATGCAT 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.