pycom436g00190

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_436
Physical Location & Seq
Forward (+)
265559 .. 266641
1083 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1083 bp
ATGGCACTTGATAGTGCTTCTCTTTTGTCACAGCTTATGGAAGAGTACCAAACGCAAAGAGTTGGTACATTTGATCATAATCAATCAAGGAACGACGTGTTTTCCAATACTTACAATTCCGATTGGAGTGATCATTCAAACTCTATATGGTGGGAACCTCAACATATTCAACAAGAAGGATATTGGCAGCCTTATGAGGAGTTCTATTCAACGTCTATGCATCCACCACAACCTCATATTCAATATGCCCAACCAAACTCAAGTTCGTCAATAGATTATAATCAAAAGCTTAATGAATTACTTTGTTTGGTGCAGGGCTCACAAAACCAAGTCGAGGAAACTCAACAAGGAGAATATTGGCAACCATATGAGGAGTTCTATACAACGCCTATGCAGCCACCACAACCTGCCCAAAGCAATGAAGTCCAAACACAAACCAAGGACGAACAAAATCAAGACAAGAAGTTGGGTAAATTGGAGGAGCAAATTGGGCAGATTATGGAATTCATGAAACAAATTCAAGAGCAAGAAGTGGATGAGGAGCTGCTAATTGAGGAAGAGGAACACACGCAACCCACGGAAAGGGTGGAAACACCTTTGTCGGAGGCACCTATTGCTCCTACGCCATCTAATTCAAGTAAGGTTGTTCCAAATTTAATTAGTTCTAACCCCATTCCACCTAATATCCCTATTCCTTGCAGGTTCATGAATTCCAAGGAAGAAGAAAGTGAAAAAGACATCTTGGAAGCACTTCCAAAGGTGCAAAGTAGGGAATATCATGAATTCATCAAAGAGGACGGTCTTGAGGCAAACAACCCCAAAGAAGTTGAATTTTATGACACAAGACAAGGACCAATCCTCACATCAAATCTGTCCAAGGGCAAAGTTCCTGAAATGTTCAAAGAAGATGTGTTTATCCTTGAGTTCATGTCGGAGCACATAAGTAAGCCACCTCCTCCAATTTCAATTTTCTTTTATACTAACATGTTGTTAATGATTCAGGCATCCAATCTTGAATTTAAACCATTACCGGATCATTTCAAGTATCACCGCCCATTCAAAGATAAATTCCATGCCGATTGA

Protein Analysis

361

Amino Acids

42.04

Weight (kDa)

4.59

Isoelectric Point (pI)

58.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 279
Acc36I ACCTGC 2 cut(s) 415, 690
AccB1I GGYRCC 1 cut(s) 607
AciI CCGC 1 cut(s) 1051
AclWI GGATC 1 cut(s) 1041
AcsI RAATTY 8 cut(s) 503, 516, 652, 709, 782, 830, 1016, 1067
AfaI GTAC 2 cut(s) 47, 67
AfiI CCNNNNNNNGG 2 cut(s) 334, 582
AflIII ACRYGT 2 cut(s) 96, 984
AjiI CACGTC 1 cut(s) 97
AjuI GAANNNNNNNTTGG 2 cut(s) 247, 279
AluBI AGCT 3 cut(s) 34, 289, 544
AluI AGCT 3 cut(s) 34, 289, 544
Alw21I GWGCWC 1 cut(s) 939
AlwI GGATC 1 cut(s) 1041
ApeKI GCWGC 3 cut(s) 187, 394, 544
ApoI RAATTY 8 cut(s) 503, 516, 652, 709, 782, 830, 1016, 1067
Asp700I GAANNNNTTC 1 cut(s) 750
AspS9I GGNCC 1 cut(s) 851
AsuHPI GGTGA 1 cut(s) 1040
AvaII GGWCC 1 cut(s) 851
BanI GGYRCC 1 cut(s) 607
BanII GRGCYC 1 cut(s) 320
Bbv12I GWGCWC 1 cut(s) 939
BbvI GCAGC 3 cut(s) 199, 406, 531
BccI CCATC 1 cut(s) 634
BclI TGATCA 2 cut(s) 73, 130
BfuAI ACCTGC 2 cut(s) 415, 690
BisI GCNGC 3 cut(s) 188, 395, 545
BlsI GCNGC 3 cut(s) 189, 396, 546
Bme18I GGWCC 1 cut(s) 851
BmgBI CACGTC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 851
BmiI GGNNCC 2 cut(s) 156, 609
BmsI GCATC 2 cut(s) 229, 1013
BpuEI CTTGAG 3 cut(s) 244, 824, 941
BsaBI GATNNNNATC 2 cut(s) 78, 279
BsaJI CCNNGG 4 cut(s) 438, 576, 714, 876
BsaWI WCCGGW 1 cut(s) 1030
Bsc4I CCNNNNNNNGG 2 cut(s) 334, 582
Bse3DI GCAATG 1 cut(s) 424
Bse8I GATNNNNATC 2 cut(s) 78, 279
BseDI CCNNGG 4 cut(s) 438, 576, 714, 876
BseGI GGATG 3 cut(s) 220, 541, 1004
BseJI GATNNNNATC 2 cut(s) 78, 279
BseLI CCNNNNNNNGG 2 cut(s) 334, 582
BseMI GCAATG 1 cut(s) 424
BseRI GAGGAG 5 cut(s) 212, 386, 494, 554, 945
BseXI GCAGC 3 cut(s) 199, 406, 531
BsgI GTGCAG 1 cut(s) 332
BshNI GGYRCC 1 cut(s) 607
BsiHKAI GWGCWC 1 cut(s) 939
BsiSI CCGG 1 cut(s) 1031
BslI CCNNNNNNNGG 2 cut(s) 334, 582
Bsp1286I GDGCHC 2 cut(s) 320, 939
Bsp143I GATC 3 cut(s) 73, 130, 1033
BspACI CCGC 1 cut(s) 1051
BspHI TCATGA 3 cut(s) 507, 705, 778
BspLI GGNNCC 2 cut(s) 156, 609
BspMI ACCTGC 2 cut(s) 415, 690
BspPI GGATC 1 cut(s) 1041
BspT107I GGYRCC 1 cut(s) 607
BsrDI GCAATG 1 cut(s) 424
BssECI CCNNGG 4 cut(s) 438, 576, 714, 876
BssMI GATC 3 cut(s) 73, 130, 1033
BssT1I CCWWGG 3 cut(s) 438, 714, 876
Bst4CI ACNGT 1 cut(s) 800
Bst6I CTCTTC 2 cut(s) 36, 552
BstAPI GCANNNNNTGC 1 cut(s) 614
BstDSI CCRYGG 1 cut(s) 576
BstF5I GGATG 3 cut(s) 220, 541, 1004
BstKTI GATC 3 cut(s) 76, 133, 1036
BstMBI GATC 3 cut(s) 73, 130, 1033
BstMWI GCNNNNNNNGC 3 cut(s) 394, 490, 614
BstNSI RCATGY 1 cut(s) 988
BstV1I GCAGC 3 cut(s) 199, 406, 531
BtgI CCRYGG 1 cut(s) 576
BtrI CACGTC 1 cut(s) 97
BtsCI GGATG 3 cut(s) 220, 541, 1004
BveI ACCTGC 2 cut(s) 415, 690
CciI TCATGA 3 cut(s) 507, 705, 778
Cfr13I GGNCC 1 cut(s) 851
Csp6I GTAC 2 cut(s) 46, 66
CviAII CATG 6 cut(s) 508, 706, 779, 928, 985, 1073
CviJI RGCY 7 cut(s) 34, 190, 289, 318, 397, 544, 949
CviKI_1 RGCY 7 cut(s) 34, 190, 289, 318, 397, 544, 949
CviQI GTAC 2 cut(s) 46, 66
DpnI GATC 3 cut(s) 75, 132, 1035
DpnII GATC 3 cut(s) 73, 130, 1033
DraI TTTAAA 1 cut(s) 1021
Eam1104I CTCTTC 2 cut(s) 36, 552
EarI CTCTTC 2 cut(s) 36, 552
Eco130I CCWWGG 3 cut(s) 438, 714, 876
Eco24I GRGCYC 1 cut(s) 320
Eco47I GGWCC 1 cut(s) 851
EcoRI GAATTC 3 cut(s) 503, 709, 782
EcoT14I CCWWGG 3 cut(s) 438, 714, 876
EcoT22I ATGCAT 1 cut(s) 222
EcoT38I GRGCYC 1 cut(s) 320
ErhI CCWWGG 3 cut(s) 438, 714, 876
FaeI CATG 6 cut(s) 511, 709, 782, 931, 988, 1076
FatI CATG 6 cut(s) 507, 705, 778, 927, 984, 1072
FauNDI CATATG 1 cut(s) 367
FbaI TGATCA 2 cut(s) 73, 130
Fnu4HI GCNGC 3 cut(s) 188, 395, 545
FokI GGATG 3 cut(s) 207, 548, 991
FriOI GRGCYC 1 cut(s) 320
Fsp4HI GCNGC 3 cut(s) 188, 395, 545
GluI GCNGC 3 cut(s) 188, 395, 545
HapII CCGG 1 cut(s) 1031
Hin1II CATG 6 cut(s) 511, 709, 782, 931, 988, 1076
HindIII AAGCTT 1 cut(s) 287
HinfI GANTC 1 cut(s) 997
HpaII CCGG 1 cut(s) 1031
HphI GGTGA 1 cut(s) 1040
Hpy188I TCNGA 3 cut(s) 121, 604, 934
Hpy188III TCNNGA 8 cut(s) 455, 508, 521, 706, 779, 803, 890, 1013
Hpy99I CGWCG 1 cut(s) 98
HpyAV CCTTC 1 cut(s) 170
HpyCH4III ACNGT 1 cut(s) 800
HpyCH4IV ACGT 2 cut(s) 96, 212
HpyCH4V TGCA 5 cut(s) 220, 313, 394, 699, 763
HpyF10VI GCNNNNNNNGC 3 cut(s) 394, 490, 614
HpySE526I ACGT 2 cut(s) 96, 212
Hsp92II CATG 6 cut(s) 511, 709, 782, 931, 988, 1076
Ksp22I TGATCA 2 cut(s) 73, 130
Kzo9I GATC 3 cut(s) 73, 130, 1033
LmnI GCTCC 4 cut(s) 481, 541, 622, 934
LpnPI CCDG 6 cut(s) 299, 420, 685, 903, 986, 1044
Lsp1109I GCAGC 3 cut(s) 199, 406, 531
LweI GCATC 2 cut(s) 229, 1013
MaeII ACGT 2 cut(s) 96, 212
MaeIII GTNAC 1 cut(s) 27
MalI GATC 3 cut(s) 75, 132, 1035
MboI GATC 3 cut(s) 73, 130, 1033
MboII GAAGA 5 cut(s) 53, 569, 731, 734, 917
MhlI GDGCHC 2 cut(s) 320, 939
MmeI TCCRAC 2 cut(s) 582, 912
Mph1103I ATGCAT 1 cut(s) 222
MroXI GAANNNNTTC 1 cut(s) 750
MseI TTAA 4 cut(s) 291, 656, 992, 1020
MspI CCGG 1 cut(s) 1031
MwoI GCNNNNNNNGC 3 cut(s) 394, 490, 614
NdeI CATATG 1 cut(s) 367
NdeII GATC 3 cut(s) 73, 130, 1033
NlaIII CATG 6 cut(s) 511, 709, 782, 931, 988, 1076
NlaIV GGNNCC 2 cut(s) 156, 609
NmuCI GTSAC 1 cut(s) 27
NsiI ATGCAT 1 cut(s) 222
NspI RCATGY 1 cut(s) 988
PagI TCATGA 3 cut(s) 507, 705, 778
PciI ACATGT 1 cut(s) 984
PdmI GAANNNNTTC 1 cut(s) 750
PfeI GAWTC 1 cut(s) 997
PkrI GCNGC 3 cut(s) 189, 396, 546
PscI ACATGT 1 cut(s) 984
PsiI TTATAA 1 cut(s) 279
PspN4I GGNNCC 2 cut(s) 156, 609
PspPI GGNCC 1 cut(s) 851
RsaI GTAC 2 cut(s) 47, 67
RsaNI GTAC 2 cut(s) 46, 66
SaqAI TTAA 4 cut(s) 291, 656, 992, 1020
SatI GCNGC 3 cut(s) 188, 395, 545
Sau3AI GATC 3 cut(s) 73, 130, 1033
Sau96I GGNCC 1 cut(s) 851
SduI GDGCHC 2 cut(s) 320, 939
SfaNI GCATC 2 cut(s) 229, 1013
SinI GGWCC 1 cut(s) 851
SmlI CTYRAG 3 cut(s) 259, 803, 920
SmoI CTYRAG 3 cut(s) 259, 803, 920
SsiI CCGC 1 cut(s) 1051
SspI AATATT 1 cut(s) 356
StyI CCWWGG 3 cut(s) 438, 714, 876
TaaI ACNGT 1 cut(s) 800
TaiI ACGT 2 cut(s) 99, 215
TaqI TCGA 1 cut(s) 333
TfiI GAWTC 1 cut(s) 997
Tru1I TTAA 4 cut(s) 291, 656, 992, 1020
Tru9I TTAA 4 cut(s) 291, 656, 992, 1020
TseFI GTSAC 1 cut(s) 27
TseI GCWGC 3 cut(s) 187, 394, 544
Tsp45I GTSAC 1 cut(s) 27
TspDTI ATGAA 9 cut(s) 309, 435, 496, 524, 694, 722, 775, 795, 916
TspGWI ACGGA 1 cut(s) 593
VpaK11BI GGWCC 1 cut(s) 851
XapI RAATTY 8 cut(s) 503, 516, 652, 709, 782, 830, 1016, 1067
XceI RCATGY 1 cut(s) 988
XcmI CCANNNNNNNNNTGG 1 cut(s) 583
XmnI GAANNNNTTC 1 cut(s) 750
Zsp2I ATGCAT 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.