Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

tig00000608

Orthogroup ID

OG0000120

Physical Location & Seq

Genomic Coordinates Reverse (-)

65146 .. 69188

Gene Structure 4043 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 561 bp

ATGATGAAGGTGGTAGCTAGGGTGAATTATGATGAATGCATTGCATGTGTGTGTGAATGGTGGTGCAATGATGAAAGAGTAAGTGCATGTGTGGCAAACCCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTCTTATCTTCTAACGGTCTTCTTACAGGTGAAGACTCCGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTTGGGCATGAAGAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004177 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005829 GO:0006508 GO:0006807 GO:0008150 GO:0008152 GO:0008233 GO:0008238 GO:0008239 GO:0016787 GO:0019538 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0070011 GO:0071704 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NUDIX Peptidase_M49

Protein Analysis

187

Amino Acids

20.64

Weight (kDa)

5.3

Isoelectric Point (pI)

47.56

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000120)

Species	Orthologous Gene IDs
malus_domestica	MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica	Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis	pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	168
AccBSI	CCGCTC	1 cut(s)	387
AccII	CGCG	2 cut(s)	146, 151
AciI	CCGC	2 cut(s)	149, 385
AclWI	GGATC	1 cut(s)	433
AcoI	YGGCCR	1 cut(s)	309
AcsI	RAATTY	1 cut(s)	543
AcyI	GRCGYC	2 cut(s)	169, 228
AdeI	CACNNNGTG	1 cut(s)	335
AfaI	GTAC	1 cut(s)	455
AfiI	CCNNNNNNNGG	3 cut(s)	115, 155, 397
AflII	CTTAAG	2 cut(s)	428, 449
AgsI	TTSAA	1 cut(s)	317
AjuI	GAANNNNNNNTTGG	2 cut(s)	98, 130
AluBI	AGCT	7 cut(s)	17, 114, 239, 251, 448, 514, 523
AluI	AGCT	7 cut(s)	17, 114, 239, 251, 448, 514, 523
AlwI	GGATC	1 cut(s)	433
AoxI	GGCC	2 cut(s)	309, 367
ApeKI	GCWGC	3 cut(s)	283, 445, 523
ApoI	RAATTY	1 cut(s)	543
AscI	GGCGCGCC	1 cut(s)	144
AspLEI	GCGC	3 cut(s)	146, 148, 171
AspS9I	GGNCC	2 cut(s)	297, 367
AsuHPI	GGTGA	2 cut(s)	34, 218
AvaII	GGWCC	1 cut(s)	297
BanI	GGYRCC	1 cut(s)	168
BbsI	GAAGAC	2 cut(s)	188, 216
BbvI	GCAGC	3 cut(s)	270, 457, 510
BccI	CCATC	2 cut(s)	109, 403
BceAI	ACGGC	1 cut(s)	296
BcgI	CGANNNNNNTGC	2 cut(s)	84, 118
BfaI	CTAG	2 cut(s)	18, 252
BfoI	RGCGCY	1 cut(s)	172
BfrI	CTTAAG	2 cut(s)	428, 449
BisI	GCNGC	4 cut(s)	149, 284, 446, 524
BlsI	GCNGC	4 cut(s)	150, 285, 447, 525
Bme18I	GGWCC	1 cut(s)	297
BmgT120I	GGNCC	2 cut(s)	297, 367
BmiI	GGNNCC	2 cut(s)	170, 257
BmsI	GCATC	1 cut(s)	210
BpiI	GAAGAC	2 cut(s)	188, 216
Bpu10I	CCTNAGC	2 cut(s)	110, 128
BsaHI	GRCGYC	2 cut(s)	169, 228
Bsc4I	CCNNNNNNNGG	3 cut(s)	115, 155, 397
Bse3DI	GCAATG	2 cut(s)	39, 73
BseLI	CCNNNNNNNGG	3 cut(s)	115, 155, 397
BseMI	GCAATG	2 cut(s)	39, 73
BseMII	CTCAG	1 cut(s)	525
BsePI	GCGCGC	1 cut(s)	144
BseRI	GAGGAG	1 cut(s)	251
BseXI	GCAGC	3 cut(s)	270, 457, 510
Bsh1236I	CGCG	2 cut(s)	146, 151
BshFI	GGCC	2 cut(s)	311, 369
BshNI	GGYRCC	1 cut(s)	168
BslFI	GGGAC	1 cut(s)	307
BslI	CCNNNNNNNGG	3 cut(s)	115, 155, 397
BsmFI	GGGAC	1 cut(s)	307
BsmI	GAATGC	1 cut(s)	41
BsnI	GGCC	2 cut(s)	311, 369
Bsp143I	GATC	1 cut(s)	438
BspACI	CCGC	2 cut(s)	149, 385
BspANI	GGCC	2 cut(s)	311, 369
BspCNI	CTCAG	1 cut(s)	526
BspFNI	CGCG	2 cut(s)	146, 151
BspLI	GGNNCC	2 cut(s)	170, 257
BspPI	GGATC	1 cut(s)	433
BspT107I	GGYRCC	1 cut(s)	168
BspTI	CTTAAG	2 cut(s)	428, 449
BsrBI	CCGCTC	1 cut(s)	387
BsrDI	GCAATG	2 cut(s)	39, 73
BssHII	GCGCGC	1 cut(s)	144
BssMI	GATC	1 cut(s)	438
BssNI	GRCGYC	2 cut(s)	169, 228
Bst4CI	ACNGT	4 cut(s)	194, 297, 551, 557
Bst6I	CTCTTC	1 cut(s)	500
BstACI	GRCGYC	2 cut(s)	169, 228
BstAFI	CTTAAG	2 cut(s)	428, 449
BstC8I	GCNNGC	5 cut(s)	146, 377, 381, 385, 480
BstDEI	CTNAG	4 cut(s)	110, 128, 332, 534
BstFNI	CGCG	2 cut(s)	146, 151
BstH2I	RGCGCY	1 cut(s)	172
BstHHI	GCGC	3 cut(s)	146, 148, 171
BstKTI	GATC	1 cut(s)	441
BstMBI	GATC	1 cut(s)	438
BstMWI	GCNNNNNNNGC	3 cut(s)	92, 236, 520
BstNSI	RCATGY	3 cut(s)	48, 90, 476
BstUI	CGCG	2 cut(s)	146, 151
BstV1I	GCAGC	3 cut(s)	270, 457, 510
BstV2I	GAAGAC	2 cut(s)	188, 216
BstX2I	RGATCY	1 cut(s)	438
BstYI	RGATCY	1 cut(s)	438
BsuRI	GGCC	2 cut(s)	311, 369
BtsI	GCAGTG	1 cut(s)	139
BtsIMutI	CAGTG	3 cut(s)	139, 347, 556
Cac8I	GCNNGC	5 cut(s)	146, 377, 381, 385, 480
CfoI	GCGC	3 cut(s)	146, 148, 171
Cfr13I	GGNCC	2 cut(s)	297, 367
CpoI	CGGWCCG	1 cut(s)	297
CseI	GACGC	2 cut(s)	140, 236
Csp6I	GTAC	1 cut(s)	454
CspI	CGGWCCG	1 cut(s)	297
CviAII	CATG	5 cut(s)	45, 87, 364, 473, 502
CviQI	GTAC	1 cut(s)	454
DdeI	CTNAG	4 cut(s)	110, 128, 332, 534
DinI	GGCGCC	1 cut(s)	170
DpnI	GATC	1 cut(s)	440
DpnII	GATC	1 cut(s)	438
DraIII	CACNNNGTG	1 cut(s)	335
EaeI	YGGCCR	1 cut(s)	309
Eam1104I	CTCTTC	1 cut(s)	500
EarI	CTCTTC	1 cut(s)	500
Eco47I	GGWCC	1 cut(s)	297
EcoRI	GAATTC	1 cut(s)	543
EcoT22I	ATGCAT	1 cut(s)	41
EgeI	GGCGCC	1 cut(s)	170
EheI	GGCGCC	1 cut(s)	170
FaeI	CATG	5 cut(s)	48, 90, 367, 476, 505
FaiI	YATR	7 cut(s)	30, 46, 88, 166, 365, 474, 503
FaqI	GGGAC	1 cut(s)	307
FatI	CATG	5 cut(s)	44, 86, 363, 472, 501
FauI	CCCGC	1 cut(s)	392
Fnu4HI	GCNGC	4 cut(s)	149, 284, 446, 524
Fsp4HI	GCNGC	4 cut(s)	149, 284, 446, 524
FspBI	CTAG	2 cut(s)	18, 252
GlaI	GCGC	3 cut(s)	145, 147, 170
GluI	GCNGC	4 cut(s)	149, 284, 446, 524
HaeII	RGCGCY	1 cut(s)	172
HaeIII	GGCC	2 cut(s)	311, 369
HgaI	GACGC	2 cut(s)	140, 236
HhaI	GCGC	3 cut(s)	146, 148, 171
Hin1I	GRCGYC	2 cut(s)	169, 228
Hin1II	CATG	5 cut(s)	48, 90, 367, 476, 505
Hin6I	GCGC	3 cut(s)	144, 146, 169
HinP1I	GCGC	3 cut(s)	144, 146, 169
HindIII	AAGCTT	1 cut(s)	512
HinfI	GANTC	4 cut(s)	212, 320, 401, 530
HphI	GGTGA	2 cut(s)	34, 218
Hpy188I	TCNGA	2 cut(s)	301, 535
Hpy188III	TCNNGA	2 cut(s)	291, 317
HpyAV	CCTTC	1 cut(s)	183
HpyCH4III	ACNGT	4 cut(s)	194, 297, 551, 557
HpyCH4IV	ACGT	1 cut(s)	162
HpyCH4V	TGCA	8 cut(s)	39, 44, 66, 86, 223, 472, 482, 526
HpyF10VI	GCNNNNNNNGC	3 cut(s)	92, 236, 520
HpyF3I	CTNAG	4 cut(s)	110, 128, 332, 534
HpySE526I	ACGT	1 cut(s)	162
Hsp92I	GRCGYC	2 cut(s)	169, 228
Hsp92II	CATG	5 cut(s)	48, 90, 367, 476, 505
HspAI	GCGC	3 cut(s)	144, 146, 169
KasI	GGCGCC	1 cut(s)	168
Kzo9I	GATC	1 cut(s)	438
LmnI	GCTCC	1 cut(s)	392
LpnPI	CCDG	6 cut(s)	189, 209, 276, 380, 389, 455
Lsp1109I	GCAGC	3 cut(s)	270, 457, 510
LweI	GCATC	1 cut(s)	210
MaeI	CTAG	2 cut(s)	18, 252
MaeII	ACGT	1 cut(s)	162
MaeIII	GTNAC	2 cut(s)	158, 551
MalI	GATC	1 cut(s)	440
MbiI	CCGCTC	1 cut(s)	387
MboI	GATC	1 cut(s)	438
MboII	GAAGA	4 cut(s)	177, 188, 221, 517
MflI	RGATCY	1 cut(s)	438
MluCI	AATT	3 cut(s)	25, 119, 543
Mly113I	GGCGCC	1 cut(s)	169
MlyI	GAGTC	2 cut(s)	206, 329
MmeI	TCCRAC	1 cut(s)	384
MnlI	CCTC	6 cut(s)	269, 272, 335, 409, 501, 529
Mph1103I	ATGCAT	1 cut(s)	41
MseI	TTAA	3 cut(s)	429, 450, 559
MslI	CAYNNNNRTG	1 cut(s)	49
MspCI	CTTAAG	2 cut(s)	428, 449
Mva1269I	GAATGC	1 cut(s)	41
MvnI	CGCG	2 cut(s)	146, 151
MwoI	GCNNNNNNNGC	3 cut(s)	92, 236, 520
NarI	GGCGCC	1 cut(s)	169
NdeII	GATC	1 cut(s)	438
NlaIII	CATG	5 cut(s)	48, 90, 367, 476, 505
NlaIV	GGNNCC	2 cut(s)	170, 257
NmuCI	GTSAC	1 cut(s)	551
NsiI	ATGCAT	1 cut(s)	41
NspI	RCATGY	3 cut(s)	48, 90, 476
PalAI	GGCGCGCC	1 cut(s)	144
PauI	GCGCGC	1 cut(s)	144
PctI	GAATGC	1 cut(s)	41
PfeI	GAWTC	2 cut(s)	401, 530
PkrI	GCNGC	4 cut(s)	150, 285, 447, 525
PleI	GAGTC	2 cut(s)	206, 328
PluTI	GGCGCC	1 cut(s)	172
PpsI	GAGTC	2 cut(s)	206, 328
PspN4I	GGNNCC	2 cut(s)	170, 257
PspPI	GGNCC	2 cut(s)	297, 367
PsuI	RGATCY	1 cut(s)	438
PteI	GCGCGC	1 cut(s)	144
RsaI	GTAC	1 cut(s)	455
RsaNI	GTAC	1 cut(s)	454
RseI	CAYNNNNRTG	1 cut(s)	49
Rsr2I	CGGWCCG	1 cut(s)	297
RsrII	CGGWCCG	1 cut(s)	297
SaqAI	TTAA	3 cut(s)	429, 450, 559
SatI	GCNGC	4 cut(s)	149, 284, 446, 524
Sau3AI	GATC	1 cut(s)	438
Sau96I	GGNCC	2 cut(s)	297, 367
SchI	GAGTC	2 cut(s)	206, 329
SfaNI	GCATC	1 cut(s)	210
SfoI	GGCGCC	1 cut(s)	170
SgsI	GGCGCGCC	1 cut(s)	144
SinI	GGWCC	1 cut(s)	297
SmiMI	CAYNNNNRTG	1 cut(s)	49
SmlI	CTYRAG	2 cut(s)	428, 449
SmoI	CTYRAG	2 cut(s)	428, 449
Sse9I	AATT	3 cut(s)	25, 119, 543
SsiI	CCGC	2 cut(s)	149, 385
SspDI	GGCGCC	1 cut(s)	168
SspMI	CTAG	2 cut(s)	18, 252
TaaI	ACNGT	4 cut(s)	194, 297, 551, 557
TaiI	ACGT	1 cut(s)	165
TaqI	TCGA	2 cut(s)	104, 541
TasI	AATT	3 cut(s)	25, 119, 543
TauI	GCSGC	1 cut(s)	151
TfiI	GAWTC	2 cut(s)	401, 530
Tru1I	TTAA	3 cut(s)	429, 450, 559
Tru9I	TTAA	3 cut(s)	429, 450, 559
TscAI	CASTG	3 cut(s)	139, 347, 556
TseFI	GTSAC	1 cut(s)	551
TseI	GCWGC	3 cut(s)	283, 445, 523
Tsp45I	GTSAC	1 cut(s)	551
TspDTI	ATGAA	4 cut(s)	20, 48, 87, 518
TspGWI	ACGGA	1 cut(s)	205
TspRI	CASTG	3 cut(s)	139, 347, 556
Vha464I	CTTAAG	2 cut(s)	428, 449
VpaK11BI	GGWCC	1 cut(s)	297
XapI	RAATTY	1 cut(s)	543
XceI	RCATGY	3 cut(s)	48, 90, 476
XspI	CTAG	2 cut(s)	18, 252
Zsp2I	ATGCAT	1 cut(s)	41

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.