pycom808g00640

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000808
Physical Location & Seq
Forward (+)
394708 .. 398718
4011 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 846 bp
ATGGATAAGCTATCCAATCCATGCCCAAAAATGCTCCAAATGGCCTCAAAATGCACTTACTTGCTCCCTAGGCCCTTAGAACCTGAAAACACACAAAAGAAGCACGAGAACAATGCATGTGAAGTCATACATTATAACCATAACCAAGCATATACCAAGATCATGCAATTACAAACCAAATCCTTATCATTGTGTTGGAAGAAACAACATGTGAAAGCAACGCTAGGTAAGCAATCAGGAATAGATTCCAGGCAGTTGGCTCCAGAACGGAAGACTGACTCCAAGTGCCGGCTGATTGCTTCTTTTACTTTGCCATCTACAATAGTAGCTAGGAACCTCCTCACTCCGAAAGATAGTAGGCTGCTGTCAGGACGGTCCGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGTTCTGTGTCCAACATGGGCCAACGCCTGCTTGCCCGCTCCCGTCAGGTGGAATCATTGATGGCAGAGGTGGAAAGTCTCAAGCAGGAGATCCAGCAGCTGAAGTATGAGAATAGAAGTTTGCATGTGCTTGCAAACAACTATTCGACGGGCATGAAGAGGAAGCTTGATGAGTTGCAAGAGTCTGAAGGTCGGATTCACAGTGACCGTCAAAGGTTTTCGTTTTTCCTCCAGAGGTACCTTTTTCCTGGCTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTATCTTCGATGCCTCCCGCTCCGATGCCTTCTGTTCCTACGCCTTCCGCTCCGATGCCCTCTGTTCCTACGCCTTCCGCTTCAAGAGTAAAGCCACGTAGTGGGGCCTCAAGCAAACAACCTTTATGA

Protein Analysis

282

Amino Acids

31.43

Weight (kDa)

9.71

Isoelectric Point (pI)

67.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 135
Acc65I GGTACC 1 cut(s) 663
AccB1I GGYRCC 1 cut(s) 663
AccB7I CCANNNNNTGG 2 cut(s) 690, 818
AccBSI CCGCTC 3 cut(s) 465, 737, 767
AciI CCGC 4 cut(s) 463, 735, 765, 795
AclWI GGATC 1 cut(s) 511
AcoI YGGCCR 2 cut(s) 387, 692
AcuI CTGAAG 2 cut(s) 548, 633
AdeI CACNNNGTG 2 cut(s) 413, 818
AfaI GTAC 1 cut(s) 665
AfeI AGCGCT 1 cut(s) 688
AfiI CCNNNNNNNGG 4 cut(s) 288, 475, 690, 818
AflIII ACRYGT 1 cut(s) 208
AgsI TTSAA 2 cut(s) 395, 801
AjnI CCWGG 3 cut(s) 248, 673, 707
AluBI AGCT 4 cut(s) 10, 329, 526, 592
AluI AGCT 4 cut(s) 10, 329, 526, 592
Alw26I GTCTC 1 cut(s) 509
AlwI GGATC 1 cut(s) 511
AlwNI CAGNNNCTG 1 cut(s) 526
Aor51HI AGCGCT 1 cut(s) 688
AoxI GGCC 7 cut(s) 42, 71, 387, 445, 692, 705, 822
ApeKI GCWGC 2 cut(s) 361, 523
Asp700I GAANNNNTTC 1 cut(s) 244
Asp718I GGTACC 1 cut(s) 663
AspA2I CCTAGG 1 cut(s) 68
AspLEI GCGC 1 cut(s) 689
AspS9I GGNCC 4 cut(s) 72, 375, 445, 822
AvaII GGWCC 1 cut(s) 375
AvrII CCTAGG 1 cut(s) 68
BalI TGGCCA 1 cut(s) 694
BanI GGYRCC 1 cut(s) 663
BauI CACGAG 1 cut(s) 104
BbsI GAAGAC 1 cut(s) 278
BbvI GCAGC 2 cut(s) 348, 535
BccI CCATC 2 cut(s) 322, 481
BceAI ACGGC 1 cut(s) 374
BcgI CGANNNNNNTGC 2 cut(s) 95, 129
BciT130I CCWGG 3 cut(s) 250, 675, 709
BcoDI GTCTC 1 cut(s) 509
BfaI CTAG 3 cut(s) 69, 224, 330
BfoI RGCGCY 1 cut(s) 690
BisI GCNGC 2 cut(s) 362, 524
BlnI CCTAGG 1 cut(s) 68
BlsI GCNGC 2 cut(s) 363, 525
Bme1390I CCNGG 3 cut(s) 250, 675, 709
Bme18I GGWCC 1 cut(s) 375
BmgT120I GGNCC 4 cut(s) 72, 375, 445, 822
BmiI GGNNCC 4 cut(s) 261, 335, 665, 823
BmrFI CCNGG 3 cut(s) 250, 675, 709
BmsI GCATC 3 cut(s) 717, 732, 762
BpiI GAAGAC 1 cut(s) 278
BpmI CTGGAG 2 cut(s) 246, 641
BpuEI CTTGAG 2 cut(s) 491, 811
BsaAI YACGTR 1 cut(s) 815
BsaJI CCNNGG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 4 cut(s) 288, 475, 690, 818
Bse118I RCCGGY 1 cut(s) 288
BseBI CCWGG 3 cut(s) 250, 675, 709
BseDI CCNNGG 1 cut(s) 68
BseGI GGATG 1 cut(s) 680
BseLI CCNNNNNNNGG 4 cut(s) 288, 475, 690, 818
BseRI GAGGAG 1 cut(s) 329
BseXI GCAGC 2 cut(s) 348, 535
BshFI GGCC 7 cut(s) 44, 73, 389, 447, 694, 707, 824
BshNI GGYRCC 1 cut(s) 663
BsiSI CCGG 1 cut(s) 289
BslFI GGGAC 1 cut(s) 385
BslI CCNNNNNNNGG 4 cut(s) 288, 475, 690, 818
BsmAI GTCTC 1 cut(s) 509
BsmFI GGGAC 1 cut(s) 385
BsmI GAATGC 1 cut(s) 718
BsnI GGCC 7 cut(s) 44, 73, 389, 447, 694, 707, 824
Bsp143I GATC 2 cut(s) 159, 516
BspACI CCGC 4 cut(s) 463, 735, 765, 795
BspANI GGCC 7 cut(s) 44, 73, 389, 447, 694, 707, 824
BspLI GGNNCC 4 cut(s) 261, 335, 665, 823
BspPI GGATC 1 cut(s) 511
BspT107I GGYRCC 1 cut(s) 663
BsrBI CCGCTC 3 cut(s) 465, 737, 767
BsrFI RCCGGY 1 cut(s) 288
BssAI RCCGGY 1 cut(s) 288
BssECI CCNNGG 1 cut(s) 68
BssMI GATC 2 cut(s) 159, 516
BssSI CACGAG 1 cut(s) 104
BssT1I CCWWGG 1 cut(s) 68
Bst2BI CACGAG 1 cut(s) 104
Bst2UI CCWGG 3 cut(s) 250, 675, 709
Bst4CI ACNGT 3 cut(s) 375, 629, 635
Bst6I CTCTTC 1 cut(s) 578
BstBAI YACGTR 1 cut(s) 815
BstC8I GCNNGC 5 cut(s) 290, 455, 459, 463, 558
BstDEI CTNAG 2 cut(s) 76, 410
BstF5I GGATG 1 cut(s) 680
BstH2I RGCGCY 1 cut(s) 690
BstHHI GCGC 1 cut(s) 689
BstKTI GATC 2 cut(s) 162, 519
BstMAI GTCTC 1 cut(s) 509
BstMBI GATC 2 cut(s) 159, 516
BstMWI GCNNNNNNNGC 4 cut(s) 70, 229, 684, 713
BstNI CCWGG 3 cut(s) 250, 675, 709
BstNSI RCATGY 3 cut(s) 120, 212, 554
BstSCI CCNGG 3 cut(s) 248, 673, 707
BstV1I GCAGC 2 cut(s) 348, 535
BstV2I GAAGAC 1 cut(s) 278
BstX2I RGATCY 1 cut(s) 516
BstXI CCANNNNNNTGG 1 cut(s) 256
BstYI RGATCY 1 cut(s) 516
BsuRI GGCC 7 cut(s) 44, 73, 389, 447, 694, 707, 824
BtsCI GGATG 1 cut(s) 680
BtsIMutI CAGTG 2 cut(s) 425, 634
Cac8I GCNNGC 5 cut(s) 290, 455, 459, 463, 558
CaiI CAGNNNCTG 1 cut(s) 526
CfoI GCGC 1 cut(s) 689
Cfr10I RCCGGY 1 cut(s) 288
Cfr13I GGNCC 4 cut(s) 72, 375, 445, 822
CpoI CGGWCCG 1 cut(s) 375
Csp6I GTAC 1 cut(s) 664
CspI CGGWCCG 1 cut(s) 375
CviAII CATG 7 cut(s) 21, 117, 163, 209, 442, 551, 580
CviQI GTAC 1 cut(s) 664
DdeI CTNAG 2 cut(s) 76, 410
DpnI GATC 2 cut(s) 161, 518
DpnII GATC 2 cut(s) 159, 516
DraIII CACNNNGTG 2 cut(s) 413, 818
EaeI YGGCCR 2 cut(s) 387, 692
Eam1104I CTCTTC 1 cut(s) 578
EarI CTCTTC 1 cut(s) 578
Eco130I CCWWGG 1 cut(s) 68
Eco147I AGGCCT 1 cut(s) 707
Eco47I GGWCC 1 cut(s) 375
Eco47III AGCGCT 1 cut(s) 688
Eco57I CTGAAG 2 cut(s) 548, 633
EcoO109I RGGNCCY 2 cut(s) 72, 822
EcoRII CCWGG 3 cut(s) 248, 673, 707
EcoT14I CCWWGG 1 cut(s) 68
EcoT22I ATGCAT 1 cut(s) 118
ErhI CCWWGG 1 cut(s) 68
FaeI CATG 7 cut(s) 24, 120, 166, 212, 445, 554, 583
FaqI GGGAC 1 cut(s) 385
FatI CATG 7 cut(s) 20, 116, 162, 208, 441, 550, 579
FauI CCCGC 2 cut(s) 470, 742
Fnu4HI GCNGC 2 cut(s) 362, 524
FokI GGATG 1 cut(s) 667
Fsp4HI GCNGC 2 cut(s) 362, 524
FspBI CTAG 3 cut(s) 69, 224, 330
GlaI GCGC 1 cut(s) 688
GluI GCNGC 2 cut(s) 362, 524
GsuI CTGGAG 2 cut(s) 246, 641
HaeII RGCGCY 1 cut(s) 690
HaeIII GGCC 7 cut(s) 44, 73, 389, 447, 694, 707, 824
HapII CCGG 1 cut(s) 289
HhaI GCGC 1 cut(s) 689
Hin1II CATG 7 cut(s) 24, 120, 166, 212, 445, 554, 583
Hin6I GCGC 1 cut(s) 687
HinP1I GCGC 1 cut(s) 687
HindIII AAGCTT 1 cut(s) 590
HinfI GANTC 6 cut(s) 245, 278, 398, 479, 608, 622
HpaII CCGG 1 cut(s) 289
Hpy188I TCNGA 6 cut(s) 348, 379, 613, 621, 741, 771
Hpy188III TCNNGA 6 cut(s) 237, 263, 369, 395, 658, 801
Hpy99I CGWCG 1 cut(s) 577
HpyAV CCTTC 4 cut(s) 608, 756, 771, 801
HpyCH4III ACNGT 3 cut(s) 375, 629, 635
HpyCH4IV ACGT 1 cut(s) 814
HpyCH4V TGCA 6 cut(s) 54, 116, 166, 550, 560, 604
HpyF10VI GCNNNNNNNGC 4 cut(s) 70, 229, 684, 713
HpyF3I CTNAG 2 cut(s) 76, 410
HpySE526I ACGT 1 cut(s) 814
Hsp92II CATG 7 cut(s) 24, 120, 166, 212, 445, 554, 583
HspAI GCGC 1 cut(s) 687
KpnI GGTACC 1 cut(s) 667
KroI GCCGGC 1 cut(s) 288
KroNI GCCGGC 1 cut(s) 290
Kzo9I GATC 2 cut(s) 159, 516
LmnI GCTCC 6 cut(s) 39, 69, 265, 470, 742, 772
Lsp1109I GCAGC 2 cut(s) 348, 535
LweI GCATC 3 cut(s) 717, 732, 762
MaeI CTAG 3 cut(s) 69, 224, 330
MaeII ACGT 1 cut(s) 814
MaeIII GTNAC 1 cut(s) 629
MalI GATC 2 cut(s) 161, 518
MbiI CCGCTC 3 cut(s) 465, 737, 767
MboI GATC 2 cut(s) 159, 516
MboII GAAGA 4 cut(s) 211, 283, 595, 714
MflI RGATCY 1 cut(s) 516
MlsI TGGCCA 1 cut(s) 694
MluCI AATT 1 cut(s) 167
MluNI TGGCCA 1 cut(s) 694
MlyI GAGTC 3 cut(s) 272, 407, 617
MmeI TCCRAC 3 cut(s) 176, 462, 599
Mox20I TGGCCA 1 cut(s) 694
Mph1103I ATGCAT 1 cut(s) 118
MroNI GCCGGC 1 cut(s) 288
MroXI GAANNNNTTC 1 cut(s) 244
MscI TGGCCA 1 cut(s) 694
Msp20I TGGCCA 1 cut(s) 694
MspA1I CMGCKG 1 cut(s) 526
MspI CCGG 1 cut(s) 289
MspR9I CCNGG 3 cut(s) 250, 675, 709
Mva1269I GAATGC 1 cut(s) 718
MvaI CCWGG 3 cut(s) 250, 675, 709
MwoI GCNNNNNNNGC 4 cut(s) 70, 229, 684, 713
NaeI GCCGGC 1 cut(s) 290
NdeII GATC 2 cut(s) 159, 516
NgoMIV GCCGGC 1 cut(s) 288
NlaIII CATG 7 cut(s) 24, 120, 166, 212, 445, 554, 583
NlaIV GGNNCC 4 cut(s) 261, 335, 665, 823
NmuCI GTSAC 1 cut(s) 629
NsiI ATGCAT 1 cut(s) 118
NspI RCATGY 3 cut(s) 120, 212, 554
PceI AGGCCT 1 cut(s) 707
PciI ACATGT 1 cut(s) 208
PctI GAATGC 1 cut(s) 718
PdiI GCCGGC 1 cut(s) 290
PdmI GAANNNNTTC 1 cut(s) 244
PfeI GAWTC 3 cut(s) 245, 479, 622
PflMI CCANNNNNTGG 2 cut(s) 690, 818
PkrI GCNGC 2 cut(s) 363, 525
PleI GAGTC 3 cut(s) 272, 406, 616
PpsI GAGTC 3 cut(s) 272, 406, 616
Ppu21I YACGTR 1 cut(s) 815
PscI ACATGT 1 cut(s) 208
PsiI TTATAA 1 cut(s) 135
Psp6I CCWGG 3 cut(s) 248, 673, 707
PspGI CCWGG 3 cut(s) 248, 673, 707
PspN4I GGNNCC 4 cut(s) 261, 335, 665, 823
PspPI GGNCC 4 cut(s) 72, 375, 445, 822
PstNI CAGNNNCTG 1 cut(s) 526
PsuI RGATCY 1 cut(s) 516
PvuII CAGCTG 1 cut(s) 526
RsaI GTAC 1 cut(s) 665
RsaNI GTAC 1 cut(s) 664
Rsr2I CGGWCCG 1 cut(s) 375
RsrII CGGWCCG 1 cut(s) 375
SatI GCNGC 2 cut(s) 362, 524
Sau3AI GATC 2 cut(s) 159, 516
Sau96I GGNCC 4 cut(s) 72, 375, 445, 822
SchI GAGTC 3 cut(s) 272, 407, 617
ScrFI CCNGG 3 cut(s) 250, 675, 709
SfaNI GCATC 3 cut(s) 717, 732, 762
SinI GGWCC 1 cut(s) 375
SmlI CTYRAG 2 cut(s) 506, 826
SmoI CTYRAG 2 cut(s) 506, 826
Sse9I AATT 1 cut(s) 167
SseBI AGGCCT 1 cut(s) 707
SsiI CCGC 4 cut(s) 463, 735, 765, 795
SspMI CTAG 3 cut(s) 69, 224, 330
StuI AGGCCT 1 cut(s) 707
StyD4I CCNGG 3 cut(s) 248, 673, 707
StyI CCWWGG 1 cut(s) 68
TaaI ACNGT 3 cut(s) 375, 629, 635
TaiI ACGT 1 cut(s) 817
TaqI TCGA 2 cut(s) 572, 725
TasI AATT 1 cut(s) 167
TfiI GAWTC 3 cut(s) 245, 479, 622
TscAI CASTG 2 cut(s) 425, 634
TseFI GTSAC 1 cut(s) 629
TseI GCWGC 2 cut(s) 361, 523
Tsp45I GTSAC 1 cut(s) 629
TspDTI ATGAA 1 cut(s) 596
TspGWI ACGGA 1 cut(s) 283
TspRI CASTG 2 cut(s) 425, 634
Van91I CCANNNNNTGG 2 cut(s) 690, 818
VpaK11BI GGWCC 1 cut(s) 375
XceI RCATGY 3 cut(s) 120, 212, 554
XmaJI CCTAGG 1 cut(s) 68
XmnI GAANNNNTTC 1 cut(s) 244
XspI CTAG 3 cut(s) 69, 224, 330
Zsp2I ATGCAT 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.