pycom908g00040

Nudix hydrolase 3-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00000908
Physical Location & Seq
Reverse (-)
86661 .. 99150
12490 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 876 bp
ATGGCAAACTCATCGAACCTTAGCTTGGAATTGAGCCTTAGCAGTGATACGGGCGCGCCGCGTCAAGGTAACGTATGGCGCCCTTCTTTTTTATCTCCTAACGGTCCTCTTTCAGGTGAAGACTCTGTGATGCAGGACGCCACAACAGCTACAATAGTAGCTAGGAACCTCCTCACTCCAAAAGATAGTAGGCTGCTGTCAGGACGGTCTGATGAGTTGGCCGTTCAAGAGTCCCTCGCACTTAGTGTTCAGTGTGCGAGCTCTGTGTCCAACATGGGCCTACGCCTGCTTGCCCGCTCTCGTCAGGTGGAATCGTTGATGGCAGAGGTGGAAAGACTTAAGCAAGAGATCCAGCAGCTTAAGTACGAGAATAGAAGTTTGCATGTGCTTGCAAATAACTATTCGTCGGGGATGAAAAGGAAGCTTGATGAGCTGCAAGAATCTGAGGGTCGAATTCACAGTGACCGTCAAAGGCTTGCGTCTTATCTCCAGAGGCACCTTTTTCCTGGGTCATCCAGCGCTTGGCCAAGTATTGAGGCCTGGAATGCTCTAGCTCCGATGCCTCCCGCTCCGATGGCTTCCGCTCCGATGCCTCCCACTTCTATGCCTCCCGCTTCCACGATCCTCGTAGTGGGGCTTCACGTAAACAACCTTTTCATTCATTCATTCTCATTCATTCTTCCACATTTCAGAAAATCATCCATTCACACCAAGAAACATCCCCTTGGCCGTGAGTTTCCCTACAAATCCAAACACCACTCCTCTTCCATTTCCATCACTCCCCAAACCATTCACACCATCAAACTATCCTTAGACCTTGTGCTACAACGAAGAGGAAGAGAAGAGTGCCTAAACGTTCATACAATTCAAGTTTGA

Protein Analysis

292

Amino Acids

32.24

Weight (kDa)

9.61

Isoelectric Point (pI)

59.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000120)

Species Orthologous Gene IDs
malus_domestica MD00G1178700.v1.1 MD00G1192600.v1.1 MD01G1178800.v1.1 MD08G1118400.v1.1 MD11G1121800.v1.1 MD11G1175900.v1.1 MD14G1073500.v1.1 MD16G1171800.v1.1
prunus_persica Prupe.5G057200_v2.0.a1 Prupe.7G095400_v2.0.a1 Prupe.7G095500_v2.0.a1 Prupe.8G037200_v2.0.a1
pyrus_communis pycom01g00040 pycom01g00270 pycom01g00550 pycom01g00730 pycom01g00740 pycom01g00820 pycom01g00960 pycom01g01060 pycom01g01180 pycom01g01580 pycom01g01700 pycom01g01770 pycom01g01970 pycom01g02520 pycom01g03120 pycom01g03510 pycom01g07770 pycom01g07800 pycom01g11420 pycom02g06240 pycom02g13440 pycom02g16920 pycom02g17900 pycom02g18220 pycom02g21560 pycom03g10720 pycom03g11710 pycom03g11930 pycom04g05770 pycom04g07600 pycom04g07920 pycom04g07980 pycom04g08250 pycom04g09780 pycom04g12720 pycom04g13700 pycom05g00180 pycom05g01110 pycom05g05940 pycom05g06250 pycom05g06870 pycom05g08470 pycom05g08920 pycom05g09050 pycom05g09420 pycom05g14090 pycom06g05150 pycom06g05430 pycom06g06950 pycom06g09990 pycom06g15520 pycom07g08780 pycom07g11240 pycom07g11990 pycom07g14400 pycom07g27820 pycom08g07740 pycom08g10980 pycom08g12370 pycom09g03580 pycom09g09700 pycom09g13450 pycom09g14910 pycom10g01230 pycom10g02170 pycom10g06850 pycom10g08040 pycom10g08250 pycom10g10100 pycom10g15420 pycom1125g00010 pycom11g04190 pycom11g14150 pycom11g15090 pycom11g15720 pycom11g16230 pycom11g17180 pycom11g20110 pycom1236g00020 pycom12426g00290 pycom12426g00350 pycom12426g00660 pycom12426g00700 pycom12462g00070 pycom12463g00060 pycom12473g00010 pycom12503g00010 pycom12517g00150 pycom1256g00180 pycom1256g00220 pycom12575g00030 pycom12581g00010 pycom12596g00090 pycom12612g00020 pycom12621g00090 pycom12633g00040 pycom12637g00020 pycom12658g00010 pycom12658g00020 pycom12659g00070 pycom12668g00040 pycom12668g00050 pycom12674g00040 pycom12681g00050 pycom12681g00060 pycom12690g00020 pycom12695g00020 pycom12g08040 pycom12g08660 pycom12g09550 pycom12g09560 pycom13g03230 pycom13g18200 pycom13g19230 pycom13g20140 pycom13g20700 pycom13g22210 pycom13g23170 pycom13g25290 pycom13g25590 pycom13g25980 pycom13g26010 pycom13g26280 pycom13g26350 pycom13g27560 pycom13g27570 pycom13g27680 pycom13g27780 pycom13g28070 pycom13g28140 pycom13g28230 pycom13g28280 pycom13g29100 pycom1498g00010 pycom14g01730 pycom14g08250 pycom14g08660 pycom14g09260 pycom14g18640 pycom15g28640 pycom15g30060 pycom15g35030 pycom15g37780 pycom1604g00160 pycom1609g00100 pycom1681g00030 pycom1683g00020 pycom16g13500 pycom16g17920 pycom16g18140 pycom16g19340 pycom16g20200 pycom16g21370 pycom16g22140 pycom16g23170 pycom16g23450 pycom16g25040 pycom16g25790 pycom1729g00130 pycom1729g00180 pycom1739g00060 pycom1774g00010 pycom17g06230 pycom17g15230 pycom17g16620 pycom17g17340 pycom17g17660 pycom17g17810 pycom17g18150 pycom17g19280 pycom17g25050 pycom17g25100 pycom17g25680 pycom17g25690 pycom1880g00030 pycom1912g00020 pycom2002g00120 pycom2002g00160 pycom2177g00180 pycom2185g00070 pycom2189g00010 pycom2218g00030 pycom2320g00010 pycom2328g00040 pycom2339g00100 pycom2424g00030 pycom2466g00010 pycom2552g00010 pycom2599g00010 pycom2627g00040 pycom2749g00080 pycom2789g00010 pycom3027g00010 pycom394g00080 pycom436g00190 pycom436g00310 pycom436g00350 pycom436g00410 pycom436g00420 pycom436g00430 pycom443g00010 pycom505g00030 pycom520g00140 pycom520g00220 pycom520g00620 pycom520g00650 pycom555g00010 pycom57g00030 pycom608g00020 pycom723g00040 pycom775g00040 pycom808g00350 pycom808g00590 pycom808g00640 pycom889g00030 pycom908g00040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 78, 495
AccB7I CCANNNNNTGG 1 cut(s) 522
AccBSI CCGCTC 3 cut(s) 297, 569, 584
AccII CGCG 2 cut(s) 56, 61
AciI CCGC 5 cut(s) 59, 295, 567, 582, 612
AclI AACGTT 1 cut(s) 855
AclWI GGATC 2 cut(s) 343, 616
AcoI YGGCCR 3 cut(s) 219, 524, 727
AcsI RAATTY 1 cut(s) 453
AcyI GRCGYC 2 cut(s) 79, 138
AdeI CACNNNGTG 1 cut(s) 245
AfaI GTAC 1 cut(s) 365
AfeI AGCGCT 1 cut(s) 520
AfiI CCNNNNNNNGG 5 cut(s) 25, 65, 113, 522, 631
AflII CTTAAG 2 cut(s) 338, 359
AgsI TTSAA 2 cut(s) 227, 869
AjnI CCWGG 2 cut(s) 505, 539
AjuI GAANNNNNNNTTGG 2 cut(s) 8, 40
AluBI AGCT 8 cut(s) 24, 149, 161, 261, 358, 424, 433, 554
AluI AGCT 8 cut(s) 24, 149, 161, 261, 358, 424, 433, 554
Alw21I GWGCWC 1 cut(s) 263
AlwI GGATC 2 cut(s) 343, 616
Aor51HI AGCGCT 1 cut(s) 520
AoxI GGCC 5 cut(s) 219, 277, 524, 537, 727
ApeKI GCWGC 3 cut(s) 193, 355, 433
ApoI RAATTY 1 cut(s) 453
AscI GGCGCGCC 1 cut(s) 54
AspLEI GCGC 4 cut(s) 56, 58, 81, 521
AspS9I GGNCC 2 cut(s) 104, 277
AsuHPI GGTGA 1 cut(s) 128
AvaII GGWCC 1 cut(s) 104
BalI TGGCCA 1 cut(s) 526
BanI GGYRCC 2 cut(s) 78, 495
BanII GRGCYC 1 cut(s) 263
BarI GAAGNNNNNNTAC 2 cut(s) 621, 653
BbsI GAAGAC 1 cut(s) 126
Bbv12I GWGCWC 1 cut(s) 263
BbvI GCAGC 3 cut(s) 180, 367, 420
BccI CCATC 4 cut(s) 313, 568, 782, 806
BceAI ACGGC 2 cut(s) 206, 714
BcgI CGANNNNNNTGC 1 cut(s) 28
BciT130I CCWGG 2 cut(s) 507, 541
BfaI CTAG 2 cut(s) 162, 551
BfoI RGCGCY 2 cut(s) 82, 522
BfrI CTTAAG 2 cut(s) 338, 359
BisI GCNGC 4 cut(s) 59, 194, 356, 434
BlsI GCNGC 4 cut(s) 60, 195, 357, 435
Bme1390I CCNGG 2 cut(s) 507, 541
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 2 cut(s) 104, 277
BmiI GGNNCC 3 cut(s) 80, 167, 497
BmrFI CCNGG 2 cut(s) 507, 541
BmsI GCATC 3 cut(s) 120, 549, 579
BpiI GAAGAC 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 473
Bpu10I CCTNAGC 2 cut(s) 20, 38
BsaAI YACGTR 1 cut(s) 643
BsaHI GRCGYC 2 cut(s) 79, 138
BsaJI CCNNGG 2 cut(s) 506, 724
Bsc4I CCNNNNNNNGG 5 cut(s) 25, 65, 113, 522, 631
BseBI CCWGG 2 cut(s) 507, 541
BseDI CCNNGG 2 cut(s) 506, 724
BseGI GGATG 4 cut(s) 417, 512, 698, 718
BseLI CCNNNNNNNGG 5 cut(s) 25, 65, 113, 522, 631
BseMII CTCAG 1 cut(s) 435
BsePI GCGCGC 1 cut(s) 54
BseRI GAGGAG 2 cut(s) 161, 751
BseXI GCAGC 3 cut(s) 180, 367, 420
Bsh1236I CGCG 2 cut(s) 56, 61
BshFI GGCC 5 cut(s) 221, 279, 526, 539, 729
BshNI GGYRCC 2 cut(s) 78, 495
BsiHKAI GWGCWC 1 cut(s) 263
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 5 cut(s) 25, 65, 113, 522, 631
BsmFI GGGAC 1 cut(s) 217
BsmI GAATGC 1 cut(s) 550
BsnI GGCC 5 cut(s) 221, 279, 526, 539, 729
Bsp1286I GDGCHC 1 cut(s) 263
Bsp143I GATC 2 cut(s) 348, 621
BspACI CCGC 5 cut(s) 59, 295, 567, 582, 612
BspANI GGCC 5 cut(s) 221, 279, 526, 539, 729
BspCNI CTCAG 1 cut(s) 436
BspFNI CGCG 2 cut(s) 56, 61
BspLI GGNNCC 3 cut(s) 80, 167, 497
BspPI GGATC 2 cut(s) 343, 616
BspT107I GGYRCC 2 cut(s) 78, 495
BspTI CTTAAG 2 cut(s) 338, 359
BsrBI CCGCTC 3 cut(s) 297, 569, 584
BssECI CCNNGG 2 cut(s) 506, 724
BssHII GCGCGC 1 cut(s) 54
BssMI GATC 2 cut(s) 348, 621
BssNI GRCGYC 2 cut(s) 79, 138
BssT1I CCWWGG 1 cut(s) 724
Bst2UI CCWGG 2 cut(s) 507, 541
Bst4CI ACNGT 4 cut(s) 104, 207, 461, 467
Bst6I CTCTTC 4 cut(s) 769, 826, 832, 837
BstACI GRCGYC 2 cut(s) 79, 138
BstAFI CTTAAG 2 cut(s) 338, 359
BstBAI YACGTR 1 cut(s) 643
BstC8I GCNNGC 7 cut(s) 56, 259, 287, 291, 295, 390, 477
BstDEI CTNAG 5 cut(s) 20, 38, 242, 444, 811
BstENI CCTNNNNNAGG 1 cut(s) 111
BstF5I GGATG 4 cut(s) 417, 512, 698, 718
BstFNI CGCG 2 cut(s) 56, 61
BstH2I RGCGCY 2 cut(s) 82, 522
BstHHI GCGC 4 cut(s) 56, 58, 81, 521
BstKTI GATC 2 cut(s) 351, 624
BstMBI GATC 2 cut(s) 348, 621
BstMWI GCNNNNNNNGC 4 cut(s) 146, 430, 545, 575
BstNI CCWGG 2 cut(s) 507, 541
BstNSI RCATGY 1 cut(s) 386
BstSCI CCNGG 2 cut(s) 505, 539
BstUI CGCG 2 cut(s) 56, 61
BstV1I GCAGC 3 cut(s) 180, 367, 420
BstV2I GAAGAC 1 cut(s) 126
BstX2I RGATCY 1 cut(s) 348
BstYI RGATCY 1 cut(s) 348
BsuRI GGCC 5 cut(s) 221, 279, 526, 539, 729
BtsCI GGATG 4 cut(s) 417, 512, 698, 718
BtsI GCAGTG 1 cut(s) 49
BtsIMutI CAGTG 3 cut(s) 49, 257, 466
Cac8I GCNNGC 7 cut(s) 56, 259, 287, 291, 295, 390, 477
CfoI GCGC 4 cut(s) 56, 58, 81, 521
Cfr13I GGNCC 2 cut(s) 104, 277
CseI GACGC 3 cut(s) 50, 146, 468
Csp6I GTAC 1 cut(s) 364
CviAII CATG 2 cut(s) 274, 383
CviQI GTAC 1 cut(s) 364
DdeI CTNAG 5 cut(s) 20, 38, 242, 444, 811
DinI GGCGCC 1 cut(s) 80
DpnI GATC 2 cut(s) 350, 623
DpnII GATC 2 cut(s) 348, 621
DraIII CACNNNGTG 1 cut(s) 245
EaeI YGGCCR 3 cut(s) 219, 524, 727
Eam1104I CTCTTC 4 cut(s) 769, 826, 832, 837
EarI CTCTTC 4 cut(s) 769, 826, 832, 837
Ecl136II GAGCTC 1 cut(s) 261
Eco130I CCWWGG 1 cut(s) 724
Eco147I AGGCCT 1 cut(s) 539
Eco24I GRGCYC 1 cut(s) 263
Eco47I GGWCC 1 cut(s) 104
Eco47III AGCGCT 1 cut(s) 520
Eco53kI GAGCTC 1 cut(s) 261
EcoICRI GAGCTC 1 cut(s) 261
EcoNI CCTNNNNNAGG 1 cut(s) 111
EcoRI GAATTC 1 cut(s) 453
EcoRII CCWGG 2 cut(s) 505, 539
EcoT14I CCWWGG 1 cut(s) 724
EcoT38I GRGCYC 1 cut(s) 263
EgeI GGCGCC 1 cut(s) 80
EheI GGCGCC 1 cut(s) 80
ErhI CCWWGG 1 cut(s) 724
FaeI CATG 2 cut(s) 277, 386
FaiI YATR 5 cut(s) 76, 275, 384, 605, 861
FaqI GGGAC 1 cut(s) 217
FatI CATG 2 cut(s) 273, 382
FauI CCCGC 3 cut(s) 302, 574, 619
Fnu4HI GCNGC 4 cut(s) 59, 194, 356, 434
FokI GGATG 4 cut(s) 424, 499, 685, 705
FriOI GRGCYC 1 cut(s) 263
Fsp4HI GCNGC 4 cut(s) 59, 194, 356, 434
FspBI CTAG 2 cut(s) 162, 551
GlaI GCGC 4 cut(s) 55, 57, 80, 520
GluI GCNGC 4 cut(s) 59, 194, 356, 434
GsuI CTGGAG 1 cut(s) 473
HaeII RGCGCY 2 cut(s) 82, 522
HaeIII GGCC 5 cut(s) 221, 279, 526, 539, 729
HgaI GACGC 3 cut(s) 50, 146, 468
HhaI GCGC 4 cut(s) 56, 58, 81, 521
Hin1I GRCGYC 2 cut(s) 79, 138
Hin1II CATG 2 cut(s) 277, 386
Hin6I GCGC 4 cut(s) 54, 56, 79, 519
HinP1I GCGC 4 cut(s) 54, 56, 79, 519
HindIII AAGCTT 1 cut(s) 422
HinfI GANTC 4 cut(s) 122, 230, 311, 440
HphI GGTGA 1 cut(s) 128
Hpy166II GTNNAC 1 cut(s) 646
Hpy188I TCNGA 6 cut(s) 211, 445, 558, 573, 588, 692
Hpy188III TCNNGA 3 cut(s) 201, 227, 490
Hpy8I GTNNAC 1 cut(s) 646
Hpy99I CGWCG 1 cut(s) 409
HpyAV CCTTC 1 cut(s) 93
HpyCH4III ACNGT 4 cut(s) 104, 207, 461, 467
HpyCH4IV ACGT 3 cut(s) 72, 642, 855
HpyCH4V TGCA 4 cut(s) 133, 382, 392, 436
HpyF10VI GCNNNNNNNGC 4 cut(s) 146, 430, 545, 575
HpyF3I CTNAG 5 cut(s) 20, 38, 242, 444, 811
HpySE526I ACGT 3 cut(s) 72, 642, 855
Hsp92I GRCGYC 2 cut(s) 79, 138
Hsp92II CATG 2 cut(s) 277, 386
HspAI GCGC 4 cut(s) 54, 56, 79, 519
KasI GGCGCC 1 cut(s) 78
Kzo9I GATC 2 cut(s) 348, 621
LmnI GCTCC 3 cut(s) 559, 574, 589
Lsp1109I GCAGC 3 cut(s) 180, 367, 420
LweI GCATC 3 cut(s) 120, 549, 579
MaeI CTAG 2 cut(s) 162, 551
MaeII ACGT 3 cut(s) 72, 642, 855
MaeIII GTNAC 2 cut(s) 68, 461
MalI GATC 2 cut(s) 350, 623
MbiI CCGCTC 3 cut(s) 297, 569, 584
MboI GATC 2 cut(s) 348, 621
MboII GAAGA 6 cut(s) 131, 671, 756, 843, 849, 854
MflI RGATCY 1 cut(s) 348
MhlI GDGCHC 1 cut(s) 263
MlsI TGGCCA 1 cut(s) 526
MluCI AATT 3 cut(s) 29, 453, 864
MluNI TGGCCA 1 cut(s) 526
Mly113I GGCGCC 1 cut(s) 79
MlyI GAGTC 2 cut(s) 116, 239
MmeI TCCRAC 1 cut(s) 294
Mox20I TGGCCA 1 cut(s) 526
MscI TGGCCA 1 cut(s) 526
MseI TTAA 2 cut(s) 339, 360
MslI CAYNNNNRTG 1 cut(s) 602
Msp20I TGGCCA 1 cut(s) 526
MspCI CTTAAG 2 cut(s) 338, 359
MspR9I CCNGG 2 cut(s) 507, 541
Mva1269I GAATGC 1 cut(s) 550
MvaI CCWGG 2 cut(s) 507, 541
MvnI CGCG 2 cut(s) 56, 61
MwoI GCNNNNNNNGC 4 cut(s) 146, 430, 545, 575
NarI GGCGCC 1 cut(s) 79
NdeII GATC 2 cut(s) 348, 621
NlaIII CATG 2 cut(s) 277, 386
NlaIV GGNNCC 3 cut(s) 80, 167, 497
NmuCI GTSAC 1 cut(s) 461
NspI RCATGY 1 cut(s) 386
PalAI GGCGCGCC 1 cut(s) 54
PauI GCGCGC 1 cut(s) 54
PceI AGGCCT 1 cut(s) 539
PctI GAATGC 1 cut(s) 550
PfeI GAWTC 2 cut(s) 311, 440
PflMI CCANNNNNTGG 1 cut(s) 522
PkrI GCNGC 4 cut(s) 60, 195, 357, 435
PleI GAGTC 2 cut(s) 116, 238
PluTI GGCGCC 1 cut(s) 82
PpsI GAGTC 2 cut(s) 116, 238
Ppu21I YACGTR 1 cut(s) 643
Psp124BI GAGCTC 1 cut(s) 263
Psp1406I AACGTT 1 cut(s) 855
Psp6I CCWGG 2 cut(s) 505, 539
PspGI CCWGG 2 cut(s) 505, 539
PspN4I GGNNCC 3 cut(s) 80, 167, 497
PspPI GGNCC 2 cut(s) 104, 277
PsuI RGATCY 1 cut(s) 348
PteI GCGCGC 1 cut(s) 54
RsaI GTAC 1 cut(s) 365
RsaNI GTAC 1 cut(s) 364
RseI CAYNNNNRTG 1 cut(s) 602
SacI GAGCTC 1 cut(s) 263
SaqAI TTAA 2 cut(s) 339, 360
SatI GCNGC 4 cut(s) 59, 194, 356, 434
Sau3AI GATC 2 cut(s) 348, 621
Sau96I GGNCC 2 cut(s) 104, 277
SchI GAGTC 2 cut(s) 116, 239
ScrFI CCNGG 2 cut(s) 507, 541
SduI GDGCHC 1 cut(s) 263
SfaNI GCATC 3 cut(s) 120, 549, 579
SfoI GGCGCC 1 cut(s) 80
SgsI GGCGCGCC 1 cut(s) 54
SinI GGWCC 1 cut(s) 104
SmiMI CAYNNNNRTG 1 cut(s) 602
SmlI CTYRAG 2 cut(s) 338, 359
SmoI CTYRAG 2 cut(s) 338, 359
Sse9I AATT 3 cut(s) 29, 453, 864
SseBI AGGCCT 1 cut(s) 539
SsiI CCGC 5 cut(s) 59, 295, 567, 582, 612
SspDI GGCGCC 1 cut(s) 78
SspMI CTAG 2 cut(s) 162, 551
SstI GAGCTC 1 cut(s) 263
StuI AGGCCT 1 cut(s) 539
StyD4I CCNGG 2 cut(s) 505, 539
StyI CCWWGG 1 cut(s) 724
TaaI ACNGT 4 cut(s) 104, 207, 461, 467
TaiI ACGT 3 cut(s) 75, 645, 858
TaqI TCGA 2 cut(s) 14, 451
TasI AATT 3 cut(s) 29, 453, 864
TauI GCSGC 1 cut(s) 61
TfiI GAWTC 2 cut(s) 311, 440
Tru1I TTAA 2 cut(s) 339, 360
Tru9I TTAA 2 cut(s) 339, 360
TscAI CASTG 3 cut(s) 49, 257, 466
TseFI GTSAC 1 cut(s) 461
TseI GCWGC 3 cut(s) 193, 355, 433
Tsp45I GTSAC 1 cut(s) 461
TspDTI ATGAA 6 cut(s) 428, 646, 650, 654, 664, 848
TspRI CASTG 3 cut(s) 49, 257, 466
Van91I CCANNNNNTGG 1 cut(s) 522
Vha464I CTTAAG 2 cut(s) 338, 359
VpaK11BI GGWCC 1 cut(s) 104
XagI CCTNNNNNAGG 1 cut(s) 111
XapI RAATTY 1 cut(s) 453
XceI RCATGY 1 cut(s) 386
XspI CTAG 2 cut(s) 162, 551
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.