Rmu_co8422055.1_g000001

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8422055.1
Physical Location & Seq
Reverse (-)
516 .. 1286
771 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8422055.1_g000001.1.cds

Sequence Viewer

Length: 684 bp
atgctactagattggcctaagcgctttgacatcatcagtggtattgctcgggggctcctctatcttcatcaagattctagactgagagtaattcatagagatctcaaagccggcaatattttattagacaatgaatttaaccccaagatctcagactttggtctagctagaagttttggaggaaatgaaactgtagccgaaacgatgagagtggttggaacctatggttacatgtccccagaatatgcaagtgacgggttctactctaccaaatctgatgtttttagctttggtgtttcggtgttggagataataagtgggaagagaaacagaggattctctcatccagaccacgacctcaaccttcttggacatgcctggaatctatacacagaaggcaggtccatagaattgcttgatacatcagtaggggactccactaatccatccgaggaagttctgcgctcgattcatgtgggtcttttatgtgtgcagaaagatccagaagataggccaagcatgtcagatgttgttcgaatgttgagtggtgaaggtgcattgtctcaacctgaaaaacctgggttttatagtaaaagtagtgataggtctgaaaaccaagccaatcatttatctagagcatgctcggctaatgaagttagttttacgctacttgatgctagatga

Protein Analysis

227

Amino Acids

25.22

Weight (kDa)

5.5

Isoelectric Point (pI)

50.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000201)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21366
fragaria_vesca FvH4_3g15730 FvH4_3g21351 FvH4_3g21401 FvH4_3g21420
malus_domestica MD00G1151400.v1.1 MD03G1185300.v1.1 MD05G1217100.v1.1 MD05G1217400.v1.1 MD05G1220300.v1.1 MD05G1232800.v1.1 MD05G1332500.v1.1 MD05G1332800.v1.1 MD09G1059900.v1.1 MD10G1308300.v1.1 MD11G1231000.v1.1 MD12G1047500.v1.1 MD17G1273100.v1.1
prunus_persica Prupe.4G031700_v2.0.a1 Prupe.4G031700_v2.0.a1 Prupe.4G142200_v2.0.a1 Prupe.4G142700_v2.0.a1 Prupe.4G195200_v2.0.a1 Prupe.4G195600_v2.0.a1 Prupe.4G195800_v2.0.a1 Prupe.4G196000_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196400_v2.0.a1 Prupe.4G237800_v2.0.a1
pyrus_communis pycom03g16470 pycom03g16480 pycom03g16490 pycom03g16500 pycom03g16510 pycom05g19890 pycom05g20180 pycom05g20300 pycom05g30520 pycom09g02440 pycom11g20450
rosa_chinensis RchiOBHm_Chr1g0363501 RchiOBHm_Chr3g0477311 RchiOBHm_Chr3g0483581 RchiOBHm_Chr4g0411701 RchiOBHm_Chr5g0025991 RchiOBHm_Chr5g0026501 RchiOBHm_Chr5g0026541 RchiOBHm_Chr5g0026771 RchiOBHm_Chr5g0035631 RchiOBHm_Chr5g0035871 RchiOBHm_Chr5g0036451 RchiOBHm_Chr5g0036751 RchiOBHm_Chr5g0036771 RchiOBHm_Chr5g0036781 RchiOBHm_Chr5g0036801 RchiOBHm_Chr5g0036851
rosa_laevigata RLG00000031277 RLG00000032829 RLG00000032831 RLG00000032890 RLG00000032895 RLG00000032899 RLG00000032924 RLG00000033714 RLG00000033715 RLG00000033719 RLG00000033720 RLG00000033722 RLG00000033726
rosa_multiflora Rmu_co8109542.1_g000001 Rmu_co8147940.1_g000001 Rmu_co8162180.1_g000001 Rmu_co8193822.1_g000001 Rmu_co8362785.1_g000001 Rmu_co8410231.1_g000001 Rmu_co8422055.1_g000001 Rmu_sc0000149.1_g000048 Rmu_sc0000399.1_g000001 Rmu_sc0000555.1_g000013 Rmu_sc0000593.1_g000001 Rmu_sc0001348.1_g000035 Rmu_sc0004371.1_g000010 Rmu_sc0004371.1_g000019 Rmu_sc0005555.1_g000004 Rmu_sc0006059.1_g000074 Rmu_sc0006968.1_g000016 Rmu_sc0006968.1_g000018 Rmu_sc0006968.1_g000022 Rmu_sc0008732.1_g000004 Rmu_sc0010714.1_g000004 Rmu_sc0015364.1_g000001 Rmu_sc0015448.1_g000001 Rmu_sc0016543.1_g000005 Rmu_sc0025001.1_g000005
rosa_roxburghii Rroxscaffold_176G00431020 Rroxscaffold_1G00007210 Rroxscaffold_1G00044150 Rroxscaffold_1G00044170 Rroxscaffold_1G00044190 Rroxscaffold_1G00044220 Rroxscaffold_1G00044860 Rroxscaffold_1G00044870 Rroxscaffold_1G00052580 Rroxscaffold_1G00052940 Rroxscaffold_1G00053250 Rroxscaffold_1G00070620 Rroxscaffold_1G00070690 Rroxscaffold_1G00070720 Rroxscaffold_5G00353610 Rroxscaffold_6G00398200 Rroxscaffold_7G00204580
rosa_rugosa Rorug01G0307900 Rorug03G0207300 Rorug05G0086700 Rorug05G0156300 Rorug05G0157800 Rorug05G0157900 Rorug05G0157900 Rorug05G0157900
rosa_samantha Rh1BG280000 Rh3AG255400 Rh5AG189100 Rh5AG250500 Rh5BG252100 Rh5CG198600 Rh5CG203300 Rh5CG205400 Rh5CG206200 Rh5CG206600 Rh5CG281100 Rh5CG282300 Rh5CG283600 Rh5CG283800 Rh5CG284100 Rh5CG424200 Rh5DG181000 Rh5DG258000 Rh5DG260000 Rh5DG260400 Rh5DG260500
rosa_wichuraiana Rw1G028060 Rw3G023100 Rw5G016880 Rw5G017170 Rw5G022990 Rw5G023010 Rw5G023030 Rw5G023040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 390
AclWI GGATC 1 cut(s) 494
AcsI RAATTY 1 cut(s) 134
AfeI AGCGCT 1 cut(s) 23
AflIII ACRYGT 1 cut(s) 231
AjnI CCWGG 2 cut(s) 377, 577
AluBI AGCT 2 cut(s) 167, 288
AluI AGCT 2 cut(s) 167, 288
Alw26I GTCTC 1 cut(s) 567
AlwI GGATC 1 cut(s) 494
Ama87I CYCGRG 1 cut(s) 48
Aor51HI AGCGCT 1 cut(s) 23
AoxI GGCC 2 cut(s) 14, 512
ApoI RAATTY 1 cut(s) 134
AspLEI GCGC 2 cut(s) 24, 465
AspS9I GGNCC 1 cut(s) 402
AsuHPI GGTGA 1 cut(s) 560
AsuII TTCGAA 1 cut(s) 535
AvaI CYCGRG 1 cut(s) 48
AvaII GGWCC 1 cut(s) 402
BaeI ACNNNNGTAYC 2 cut(s) 411, 444
BanII GRGCYC 1 cut(s) 57
BccI CCATC 1 cut(s) 454
BciT130I CCWGG 2 cut(s) 379, 579
BcoDI GTCTC 1 cut(s) 567
BfaI CTAG 6 cut(s) 8, 78, 164, 168, 633, 678
BfmI CTRYAG 1 cut(s) 192
BfoI RGCGCY 1 cut(s) 25
BfuAI ACCTGC 1 cut(s) 390
BglII AGATCT 2 cut(s) 100, 147
Bme1390I CCNGG 2 cut(s) 379, 579
Bme18I GGWCC 1 cut(s) 402
BmeT110I CYCGRG 1 cut(s) 48
BmgT120I GGNCC 1 cut(s) 402
BmiI GGNNCC 2 cut(s) 56, 220
BmrFI CCNGG 2 cut(s) 379, 579
BmsI GCATC 1 cut(s) 664
BoxI GACNNNNGTC 1 cut(s) 159
Bpu10I CCTNAGC 1 cut(s) 18
Bpu14I TTCGAA 1 cut(s) 535
BsaJI CCNNGG 2 cut(s) 450, 578
Bse118I RCCGGY 1 cut(s) 110
BseBI CCWGG 2 cut(s) 379, 579
BseDI CCNNGG 2 cut(s) 450, 578
BseGI GGATG 2 cut(s) 343, 446
BseMII CTCAG 2 cut(s) 74, 165
BseRI GAGGAG 1 cut(s) 47
BsgI GTGCAG 1 cut(s) 512
BshFI GGCC 2 cut(s) 16, 514
BsiHKCI CYCGRG 1 cut(s) 48
BsiSI CCGG 1 cut(s) 111
BslFI GGGAC 2 cut(s) 220, 446
BsmAI GTCTC 1 cut(s) 567
BsmFI GGGAC 2 cut(s) 220, 446
BsnI GGCC 2 cut(s) 16, 514
BsoBI CYCGRG 1 cut(s) 48
Bsp119I TTCGAA 1 cut(s) 535
Bsp1286I GDGCHC 1 cut(s) 57
Bsp143I GATC 3 cut(s) 100, 147, 499
BspANI GGCC 2 cut(s) 16, 514
BspCNI CTCAG 2 cut(s) 75, 164
BspLI GGNNCC 2 cut(s) 56, 220
BspMI ACCTGC 1 cut(s) 390
BspPI GGATC 1 cut(s) 494
BspT104I TTCGAA 1 cut(s) 535
BsrFI RCCGGY 1 cut(s) 110
BssAI RCCGGY 1 cut(s) 110
BssECI CCNNGG 2 cut(s) 450, 578
BssMI GATC 3 cut(s) 100, 147, 499
Bst2UI CCWGG 2 cut(s) 379, 579
Bst4CI ACNGT 1 cut(s) 193
Bst6I CTCTTC 1 cut(s) 317
BstBI TTCGAA 1 cut(s) 535
BstC8I GCNNGC 2 cut(s) 112, 640
BstDEI CTNAG 3 cut(s) 18, 83, 151
BstF5I GGATG 2 cut(s) 343, 446
BstH2I RGCGCY 1 cut(s) 25
BstHHI GCGC 2 cut(s) 24, 465
BstKTI GATC 3 cut(s) 103, 150, 502
BstMAI GTCTC 1 cut(s) 567
BstMBI GATC 3 cut(s) 100, 147, 499
BstMWI GCNNNNNNNGC 1 cut(s) 644
BstNI CCWGG 2 cut(s) 379, 579
BstNSI RCATGY 4 cut(s) 235, 377, 523, 642
BstPAI GACNNNNGTC 1 cut(s) 159
BstSCI CCNGG 2 cut(s) 377, 577
BstSFI CTRYAG 1 cut(s) 192
BstX2I RGATCY 3 cut(s) 100, 147, 499
BstYI RGATCY 3 cut(s) 100, 147, 499
BsuRI GGCC 2 cut(s) 16, 514
BtsCI GGATG 2 cut(s) 343, 446
BtsIMutI CAGTG 1 cut(s) 43
BveI ACCTGC 1 cut(s) 390
Cac8I GCNNGC 2 cut(s) 112, 640
CfoI GCGC 2 cut(s) 24, 465
Cfr10I RCCGGY 1 cut(s) 110
Cfr13I GGNCC 1 cut(s) 402
CviAII CATG 5 cut(s) 232, 374, 473, 520, 639
CviJI RGCY 9 cut(s) 16, 55, 110, 167, 197, 288, 514, 620, 647
CviKI_1 RGCY 9 cut(s) 16, 55, 110, 167, 197, 288, 514, 620, 647
DdeI CTNAG 3 cut(s) 18, 83, 151
DpnI GATC 3 cut(s) 102, 149, 501
DpnII GATC 3 cut(s) 100, 147, 499
Eam1104I CTCTTC 1 cut(s) 317
EarI CTCTTC 1 cut(s) 317
Eco24I GRGCYC 1 cut(s) 57
Eco47I GGWCC 1 cut(s) 402
Eco47III AGCGCT 1 cut(s) 23
Eco88I CYCGRG 1 cut(s) 48
EcoRII CCWGG 2 cut(s) 377, 577
EcoT38I GRGCYC 1 cut(s) 57
FaeI CATG 5 cut(s) 235, 377, 476, 523, 642
FaqI GGGAC 2 cut(s) 220, 446
FatI CATG 5 cut(s) 231, 373, 472, 519, 638
FokI GGATG 2 cut(s) 330, 433
FriOI GRGCYC 1 cut(s) 57
FspBI CTAG 6 cut(s) 8, 78, 164, 168, 633, 678
GlaI GCGC 2 cut(s) 23, 464
HaeII RGCGCY 1 cut(s) 25
HaeIII GGCC 2 cut(s) 16, 514
HapII CCGG 1 cut(s) 111
HhaI GCGC 2 cut(s) 24, 465
Hin1II CATG 5 cut(s) 235, 377, 476, 523, 642
Hin6I GCGC 2 cut(s) 22, 463
HinP1I GCGC 2 cut(s) 22, 463
HinfI GANTC 5 cut(s) 74, 336, 382, 434, 469
HpaII CCGG 1 cut(s) 111
HphI GGTGA 1 cut(s) 560
Hpy188I TCNGA 5 cut(s) 154, 277, 451, 526, 610
Hpy188III TCNNGA 5 cut(s) 71, 78, 347, 503, 633
HpyAV CCTTC 3 cut(s) 374, 389, 545
HpyCH4III ACNGT 1 cut(s) 193
HpyCH4V TGCA 3 cut(s) 248, 493, 557
HpyF10VI GCNNNNNNNGC 1 cut(s) 644
HpyF3I CTNAG 3 cut(s) 18, 83, 151
Hsp92II CATG 5 cut(s) 235, 377, 476, 523, 642
HspAI GCGC 2 cut(s) 22, 463
KroI GCCGGC 1 cut(s) 110
KroNI GCCGGC 1 cut(s) 112
Kzo9I GATC 3 cut(s) 100, 147, 499
LmnI GCTCC 1 cut(s) 60
LweI GCATC 1 cut(s) 664
MaeI CTAG 6 cut(s) 8, 78, 164, 168, 633, 678
MaeIII GTNAC 2 cut(s) 227, 251
MalI GATC 3 cut(s) 102, 149, 501
MboI GATC 3 cut(s) 100, 147, 499
MboII GAAGA 3 cut(s) 56, 334, 518
MflI RGATCY 3 cut(s) 100, 147, 499
MhlI GDGCHC 1 cut(s) 57
MluCI AATT 3 cut(s) 90, 134, 410
MlyI GAGTC 1 cut(s) 428
MmeI TCCRAC 2 cut(s) 196, 285
MnlI CCTC 5 cut(s) 68, 173, 326, 368, 445
MroNI GCCGGC 1 cut(s) 110
MseI TTAA 1 cut(s) 138
MspI CCGG 1 cut(s) 111
MspR9I CCNGG 2 cut(s) 379, 579
MvaI CCWGG 2 cut(s) 379, 579
MwoI GCNNNNNNNGC 1 cut(s) 644
NaeI GCCGGC 1 cut(s) 112
NdeII GATC 3 cut(s) 100, 147, 499
NgoMIV GCCGGC 1 cut(s) 110
NlaIII CATG 5 cut(s) 235, 377, 476, 523, 642
NlaIV GGNNCC 2 cut(s) 56, 220
NmeAIII GCCGAG 1 cut(s) 623
NmuCI GTSAC 1 cut(s) 251
NspI RCATGY 4 cut(s) 235, 377, 523, 642
NspV TTCGAA 1 cut(s) 535
PaeI GCATGC 1 cut(s) 642
PciI ACATGT 1 cut(s) 231
PdiI GCCGGC 1 cut(s) 112
PfeI GAWTC 4 cut(s) 74, 336, 382, 469
PleI GAGTC 1 cut(s) 428
PpsI GAGTC 1 cut(s) 428
PscI ACATGT 1 cut(s) 231
PshAI GACNNNNGTC 1 cut(s) 159
Psp6I CCWGG 2 cut(s) 377, 577
PspGI CCWGG 2 cut(s) 377, 577
PspN4I GGNNCC 2 cut(s) 56, 220
PspPI GGNCC 1 cut(s) 402
PsuI RGATCY 3 cut(s) 100, 147, 499
SaqAI TTAA 1 cut(s) 138
Sau3AI GATC 3 cut(s) 100, 147, 499
Sau96I GGNCC 1 cut(s) 402
SchI GAGTC 1 cut(s) 428
ScrFI CCNGG 2 cut(s) 379, 579
SduI GDGCHC 1 cut(s) 57
SfaNI GCATC 1 cut(s) 664
SfcI CTRYAG 1 cut(s) 192
SfuI TTCGAA 1 cut(s) 535
SinI GGWCC 1 cut(s) 402
SphI GCATGC 1 cut(s) 642
Sse9I AATT 3 cut(s) 90, 134, 410
SspI AATATT 1 cut(s) 118
SspMI CTAG 6 cut(s) 8, 78, 164, 168, 633, 678
StyD4I CCNGG 2 cut(s) 377, 577
TaaI ACNGT 1 cut(s) 193
TaqI TCGA 2 cut(s) 467, 535
TasI AATT 3 cut(s) 90, 134, 410
TfiI GAWTC 4 cut(s) 74, 336, 382, 469
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 251
Tsp45I GTSAC 1 cut(s) 251
TspDTI ATGAA 6 cut(s) 56, 83, 147, 201, 461, 666
TspRI CASTG 1 cut(s) 43
VpaK11BI GGWCC 1 cut(s) 402
XapI RAATTY 1 cut(s) 134
XbaI TCTAGA 2 cut(s) 77, 632
XceI RCATGY 4 cut(s) 235, 377, 523, 642
XspI CTAG 6 cut(s) 8, 78, 164, 168, 633, 678
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.