Rmu_sc0025001.1_g000005

serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025001.1
OG0000201
Physical Location & Seq
Reverse (-)
15359 .. 16081
723 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025001.1_g000005.1.cds

Sequence Viewer

Length: 543 bp
atgaccccaaaaatctcagatttcggcatggcaagaatattccatggggaccaacttcaggataacacaaagaaagttgttggaacatatggctatatgtcaccagagtatgcagtgtttgggagattctctatgaaatcggatgtgtttagttttgggattatactattggagattgttagtggcaagagaaacaatggttcttatgaggagaattactccatgaacctgataggacatgtttggcatgtgtggaaagaaggaatagccttagatattgtggattcatcgctacaatcatataagcatgatgaagttttgagatgcattcaagttggactgttgtgcgtgcaagaagattcaaaggaccggccagccatgtcatccattgtgttcatgttgagtggtgaggcatctcttccatctcctaagcagcctgcatttgtcttccgaagaaattccagcaatgctgctgattgctcaagtccaaaagaattgcattctattaacgacttgacaataactattgtgggagctcgataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase Pkinase_Tyr S_locus_glycop

Protein Analysis

180

Amino Acids

20.06

Weight (kDa)

6.19

Isoelectric Point (pI)

50.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000201)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21366
fragaria_vesca FvH4_3g15730 FvH4_3g21351 FvH4_3g21401 FvH4_3g21420
malus_domestica MD00G1151400.v1.1 MD03G1185300.v1.1 MD05G1217100.v1.1 MD05G1217400.v1.1 MD05G1220300.v1.1 MD05G1232800.v1.1 MD05G1332500.v1.1 MD05G1332800.v1.1 MD09G1059900.v1.1 MD10G1308300.v1.1 MD11G1231000.v1.1 MD12G1047500.v1.1 MD17G1273100.v1.1
prunus_persica Prupe.4G031700_v2.0.a1 Prupe.4G031700_v2.0.a1 Prupe.4G142200_v2.0.a1 Prupe.4G142700_v2.0.a1 Prupe.4G195200_v2.0.a1 Prupe.4G195600_v2.0.a1 Prupe.4G195800_v2.0.a1 Prupe.4G196000_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196400_v2.0.a1 Prupe.4G237800_v2.0.a1
pyrus_communis pycom03g16470 pycom03g16480 pycom03g16490 pycom03g16500 pycom03g16510 pycom05g19890 pycom05g20180 pycom05g20300 pycom05g30520 pycom09g02440 pycom11g20450
rosa_chinensis RchiOBHm_Chr1g0363501 RchiOBHm_Chr3g0477311 RchiOBHm_Chr3g0483581 RchiOBHm_Chr4g0411701 RchiOBHm_Chr5g0025991 RchiOBHm_Chr5g0026501 RchiOBHm_Chr5g0026541 RchiOBHm_Chr5g0026771 RchiOBHm_Chr5g0035631 RchiOBHm_Chr5g0035871 RchiOBHm_Chr5g0036451 RchiOBHm_Chr5g0036751 RchiOBHm_Chr5g0036771 RchiOBHm_Chr5g0036781 RchiOBHm_Chr5g0036801 RchiOBHm_Chr5g0036851
rosa_laevigata RLG00000031277 RLG00000032829 RLG00000032831 RLG00000032890 RLG00000032895 RLG00000032899 RLG00000032924 RLG00000033714 RLG00000033715 RLG00000033719 RLG00000033720 RLG00000033722 RLG00000033726
rosa_multiflora Rmu_co8109542.1_g000001 Rmu_co8147940.1_g000001 Rmu_co8162180.1_g000001 Rmu_co8193822.1_g000001 Rmu_co8362785.1_g000001 Rmu_co8410231.1_g000001 Rmu_co8422055.1_g000001 Rmu_sc0000149.1_g000048 Rmu_sc0000399.1_g000001 Rmu_sc0000555.1_g000013 Rmu_sc0000593.1_g000001 Rmu_sc0001348.1_g000035 Rmu_sc0004371.1_g000010 Rmu_sc0004371.1_g000019 Rmu_sc0005555.1_g000004 Rmu_sc0006059.1_g000074 Rmu_sc0006968.1_g000016 Rmu_sc0006968.1_g000018 Rmu_sc0006968.1_g000022 Rmu_sc0008732.1_g000004 Rmu_sc0010714.1_g000004 Rmu_sc0015364.1_g000001 Rmu_sc0015448.1_g000001 Rmu_sc0016543.1_g000005 Rmu_sc0025001.1_g000005
rosa_roxburghii Rroxscaffold_176G00431020 Rroxscaffold_1G00007210 Rroxscaffold_1G00044150 Rroxscaffold_1G00044170 Rroxscaffold_1G00044190 Rroxscaffold_1G00044220 Rroxscaffold_1G00044860 Rroxscaffold_1G00044870 Rroxscaffold_1G00052580 Rroxscaffold_1G00052940 Rroxscaffold_1G00053250 Rroxscaffold_1G00070620 Rroxscaffold_1G00070690 Rroxscaffold_1G00070720 Rroxscaffold_5G00353610 Rroxscaffold_6G00398200 Rroxscaffold_7G00204580
rosa_rugosa Rorug01G0307900 Rorug03G0207300 Rorug05G0086700 Rorug05G0156300 Rorug05G0157800 Rorug05G0157900 Rorug05G0157900 Rorug05G0157900
rosa_samantha Rh1BG280000 Rh3AG255400 Rh5AG189100 Rh5AG250500 Rh5BG252100 Rh5CG198600 Rh5CG203300 Rh5CG205400 Rh5CG206200 Rh5CG206600 Rh5CG281100 Rh5CG282300 Rh5CG283600 Rh5CG283800 Rh5CG284100 Rh5CG424200 Rh5DG181000 Rh5DG258000 Rh5DG260000 Rh5DG260400 Rh5DG260500
rosa_wichuraiana Rw1G028060 Rw3G023100 Rw5G016880 Rw5G017170 Rw5G022990 Rw5G023010 Rw5G023030 Rw5G023040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 371
AcsI RAATTY 1 cut(s) 457
AcuI CTGAAG 1 cut(s) 41
AfiI CCNNNNNNNGG 1 cut(s) 58
AflIII ACRYGT 1 cut(s) 238
AgsI TTSAA 2 cut(s) 332, 363
AluBI AGCT 1 cut(s) 536
AluI AGCT 1 cut(s) 536
Alw21I GWGCWC 1 cut(s) 538
AoxI GGCC 1 cut(s) 371
ApeKI GCWGC 2 cut(s) 433, 470
ApoI RAATTY 1 cut(s) 457
Asp700I GAANNNNTTC 1 cut(s) 457
AspS9I GGNCC 2 cut(s) 49, 367
AsuHPI GGTGA 2 cut(s) 93, 419
AvaII GGWCC 2 cut(s) 49, 367
BanII GRGCYC 1 cut(s) 538
BbsI GAAGAC 1 cut(s) 439
Bbv12I GWGCWC 1 cut(s) 538
BbvI GCAGC 2 cut(s) 445, 457
BccI CCATC 1 cut(s) 430
BisI GCNGC 2 cut(s) 434, 471
BlsI GCNGC 2 cut(s) 435, 472
Bme18I GGWCC 2 cut(s) 49, 367
BmgT120I GGNCC 2 cut(s) 49, 367
BmiI GGNNCC 1 cut(s) 50
BmsI GCATC 2 cut(s) 314, 422
BpiI GAAGAC 1 cut(s) 439
BplI GAGNNNNNCTC 2 cut(s) 203, 235
Bpu10I CCTNAGC 1 cut(s) 429
BpuEI CTTGAG 1 cut(s) 466
BsaJI CCNNGG 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 58
Bse118I RCCGGY 1 cut(s) 369
Bse3DI GCAATG 1 cut(s) 472
BseDI CCNNGG 1 cut(s) 43
BseGI GGATG 2 cut(s) 148, 383
BseLI CCNNNNNNNGG 1 cut(s) 58
BseMI GCAATG 1 cut(s) 472
BseMII CTCAG 1 cut(s) 30
BseRI GAGGAG 1 cut(s) 224
BseXI GCAGC 2 cut(s) 445, 457
BshFI GGCC 1 cut(s) 373
BsiHKAI GWGCWC 1 cut(s) 538
BsiSI CCGG 1 cut(s) 370
BslFI GGGAC 1 cut(s) 62
BslI CCNNNNNNNGG 1 cut(s) 58
BsmFI GGGAC 1 cut(s) 62
BsmI GAATGC 2 cut(s) 327, 499
BsnI GGCC 1 cut(s) 373
Bsp1286I GDGCHC 1 cut(s) 538
Bsp19I CCATGG 1 cut(s) 43
BspANI GGCC 1 cut(s) 373
BspCNI CTCAG 1 cut(s) 29
BspLI GGNNCC 1 cut(s) 50
BsrDI GCAATG 1 cut(s) 472
BsrFI RCCGGY 1 cut(s) 369
BssAI RCCGGY 1 cut(s) 369
BssECI CCNNGG 1 cut(s) 43
BssT1I CCWWGG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 342
Bst6I CTCTTC 1 cut(s) 423
BstC8I GCNNGC 3 cut(s) 350, 375, 438
BstDEI CTNAG 3 cut(s) 16, 271, 429
BstDSI CCRYGG 1 cut(s) 43
BstF5I GGATG 2 cut(s) 148, 383
BstNSI RCATGY 2 cut(s) 242, 251
BstV1I GCAGC 2 cut(s) 445, 457
BstV2I GAAGAC 1 cut(s) 439
BsuRI GGCC 1 cut(s) 373
BtgI CCRYGG 1 cut(s) 43
BtgZI GCGATG 1 cut(s) 273
BtsCI GGATG 2 cut(s) 148, 383
BtsI GCAGTG 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 120
Cac8I GCNNGC 3 cut(s) 350, 375, 438
Cfr10I RCCGGY 1 cut(s) 369
Cfr13I GGNCC 2 cut(s) 49, 367
CviAII CATG 8 cut(s) 28, 44, 223, 239, 248, 308, 379, 397
CviJI RGCY 6 cut(s) 93, 269, 373, 377, 436, 536
CviKI_1 RGCY 6 cut(s) 93, 269, 373, 377, 436, 536
DdeI CTNAG 3 cut(s) 16, 271, 429
EaeI YGGCCR 1 cut(s) 371
Eam1104I CTCTTC 1 cut(s) 423
EarI CTCTTC 1 cut(s) 423
Ecl136II GAGCTC 1 cut(s) 536
Eco130I CCWWGG 1 cut(s) 43
Eco24I GRGCYC 1 cut(s) 538
Eco47I GGWCC 2 cut(s) 49, 367
Eco53kI GAGCTC 1 cut(s) 536
Eco57I CTGAAG 1 cut(s) 41
EcoICRI GAGCTC 1 cut(s) 536
EcoT14I CCWWGG 1 cut(s) 43
EcoT22I ATGCAT 1 cut(s) 329
EcoT38I GRGCYC 1 cut(s) 538
ErhI CCWWGG 1 cut(s) 43
FaeI CATG 8 cut(s) 31, 47, 226, 242, 251, 311, 382, 400
FaqI GGGAC 1 cut(s) 62
FatI CATG 8 cut(s) 27, 43, 222, 238, 247, 307, 378, 396
FauNDI CATATG 1 cut(s) 88
Fnu4HI GCNGC 2 cut(s) 434, 471
FokI GGATG 2 cut(s) 155, 370
FriOI GRGCYC 1 cut(s) 538
Fsp4HI GCNGC 2 cut(s) 434, 471
GluI GCNGC 2 cut(s) 434, 471
HaeIII GGCC 1 cut(s) 373
HapII CCGG 1 cut(s) 370
Hin1II CATG 8 cut(s) 31, 47, 226, 242, 251, 311, 382, 400
HinfI GANTC 3 cut(s) 126, 284, 359
HpaII CCGG 1 cut(s) 370
HphI GGTGA 2 cut(s) 93, 419
Hpy188I TCNGA 3 cut(s) 19, 142, 452
Hpy188III TCNNGA 1 cut(s) 59
HpyAV CCTTC 1 cut(s) 254
HpyCH4III ACNGT 1 cut(s) 342
HpyCH4V TGCA 5 cut(s) 113, 327, 352, 440, 499
HpyF3I CTNAG 3 cut(s) 16, 271, 429
Hsp92II CATG 8 cut(s) 31, 47, 226, 242, 251, 311, 382, 400
LmnI GCTCC 1 cut(s) 533
LpnPI CCDG 7 cut(s) 44, 117, 242, 383, 387, 450, 475
Lsp1109I GCAGC 2 cut(s) 445, 457
LweI GCATC 2 cut(s) 314, 422
MaeIII GTNAC 1 cut(s) 99
MboII GAAGA 4 cut(s) 368, 410, 439, 465
MhlI GDGCHC 1 cut(s) 538
MluCI AATT 3 cut(s) 214, 457, 494
MmeI TCCRAC 2 cut(s) 61, 316
MnlI CCTC 2 cut(s) 202, 403
Mph1103I ATGCAT 1 cut(s) 329
MroXI GAANNNNTTC 1 cut(s) 457
MseI TTAA 1 cut(s) 507
MspI CCGG 1 cut(s) 370
Mva1269I GAATGC 2 cut(s) 327, 499
NcoI CCATGG 1 cut(s) 43
NdeI CATATG 1 cut(s) 88
NlaIII CATG 8 cut(s) 31, 47, 226, 242, 251, 311, 382, 400
NlaIV GGNNCC 1 cut(s) 50
NmuCI GTSAC 1 cut(s) 99
NsiI ATGCAT 1 cut(s) 329
NspI RCATGY 2 cut(s) 242, 251
PciI ACATGT 1 cut(s) 238
PctI GAATGC 2 cut(s) 327, 499
PdmI GAANNNNTTC 1 cut(s) 457
PfeI GAWTC 3 cut(s) 126, 284, 359
PkrI GCNGC 2 cut(s) 435, 472
PscI ACATGT 1 cut(s) 238
Psp124BI GAGCTC 1 cut(s) 538
PspN4I GGNNCC 1 cut(s) 50
PspPI GGNCC 2 cut(s) 49, 367
SacI GAGCTC 1 cut(s) 538
SaqAI TTAA 1 cut(s) 507
SatI GCNGC 2 cut(s) 434, 471
Sau96I GGNCC 2 cut(s) 49, 367
SduI GDGCHC 1 cut(s) 538
SetI ASST 2 cut(s) 231, 538
SfaNI GCATC 2 cut(s) 314, 422
SinI GGWCC 2 cut(s) 49, 367
SmlI CTYRAG 1 cut(s) 481
SmoI CTYRAG 1 cut(s) 481
Sse9I AATT 3 cut(s) 214, 457, 494
SspI AATATT 1 cut(s) 39
SstI GAGCTC 1 cut(s) 538
StyI CCWWGG 1 cut(s) 43
TaaI ACNGT 1 cut(s) 342
TaqI TCGA 1 cut(s) 538
TasI AATT 3 cut(s) 214, 457, 494
TfiI GAWTC 3 cut(s) 126, 284, 359
Tru1I TTAA 1 cut(s) 507
Tru9I TTAA 1 cut(s) 507
TscAI CASTG 1 cut(s) 120
TseFI GTSAC 1 cut(s) 99
TseI GCWGC 2 cut(s) 433, 470
Tsp45I GTSAC 1 cut(s) 99
TspDTI ATGAA 5 cut(s) 149, 239, 276, 327, 385
TspRI CASTG 1 cut(s) 120
VpaK11BI GGWCC 2 cut(s) 49, 367
XapI RAATTY 1 cut(s) 457
XceI RCATGY 2 cut(s) 242, 251
XmnI GAANNNNTTC 1 cut(s) 457
Zsp2I ATGCAT 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.