Rmu_sc0001348.1_g000035

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001348.1
OG0000201
Physical Location & Seq
Forward (+)
112143 .. 112412
270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001348.1_g000035.1.cds

Sequence Viewer

Length: 270 bp
atgggaacgtcagggaggatgagacgaaaggtttggctcgggtgcgcctgtcgaaggtggcctttccggcccgtcggcctccagctcaatattgggcagaagcttgtgcctacgtcgccgattctgatcgaggaggaggacgaggaacgagatggtgtggtgtggagcttcagatcgaagggaggtggaggtggaagcgttgttgtcgatatagagaaggcgagagagagggagcgagagaagaagaaaaaattaagagagaaaaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.21

Weight (kDa)

10.1

Isoelectric Point (pI)

87.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000201)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21366
fragaria_vesca FvH4_3g15730 FvH4_3g21351 FvH4_3g21401 FvH4_3g21420
malus_domestica MD00G1151400.v1.1 MD03G1185300.v1.1 MD05G1217100.v1.1 MD05G1217400.v1.1 MD05G1220300.v1.1 MD05G1232800.v1.1 MD05G1332500.v1.1 MD05G1332800.v1.1 MD09G1059900.v1.1 MD10G1308300.v1.1 MD11G1231000.v1.1 MD12G1047500.v1.1 MD17G1273100.v1.1
prunus_persica Prupe.4G031700_v2.0.a1 Prupe.4G031700_v2.0.a1 Prupe.4G142200_v2.0.a1 Prupe.4G142700_v2.0.a1 Prupe.4G195200_v2.0.a1 Prupe.4G195600_v2.0.a1 Prupe.4G195800_v2.0.a1 Prupe.4G196000_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196400_v2.0.a1 Prupe.4G237800_v2.0.a1
pyrus_communis pycom03g16470 pycom03g16480 pycom03g16490 pycom03g16500 pycom03g16510 pycom05g19890 pycom05g20180 pycom05g20300 pycom05g30520 pycom09g02440 pycom11g20450
rosa_chinensis RchiOBHm_Chr1g0363501 RchiOBHm_Chr3g0477311 RchiOBHm_Chr3g0483581 RchiOBHm_Chr4g0411701 RchiOBHm_Chr5g0025991 RchiOBHm_Chr5g0026501 RchiOBHm_Chr5g0026541 RchiOBHm_Chr5g0026771 RchiOBHm_Chr5g0035631 RchiOBHm_Chr5g0035871 RchiOBHm_Chr5g0036451 RchiOBHm_Chr5g0036751 RchiOBHm_Chr5g0036771 RchiOBHm_Chr5g0036781 RchiOBHm_Chr5g0036801 RchiOBHm_Chr5g0036851
rosa_laevigata RLG00000031277 RLG00000032829 RLG00000032831 RLG00000032890 RLG00000032895 RLG00000032899 RLG00000032924 RLG00000033714 RLG00000033715 RLG00000033719 RLG00000033720 RLG00000033722 RLG00000033726
rosa_multiflora Rmu_co8109542.1_g000001 Rmu_co8147940.1_g000001 Rmu_co8162180.1_g000001 Rmu_co8193822.1_g000001 Rmu_co8362785.1_g000001 Rmu_co8410231.1_g000001 Rmu_co8422055.1_g000001 Rmu_sc0000149.1_g000048 Rmu_sc0000399.1_g000001 Rmu_sc0000555.1_g000013 Rmu_sc0000593.1_g000001 Rmu_sc0001348.1_g000035 Rmu_sc0004371.1_g000010 Rmu_sc0004371.1_g000019 Rmu_sc0005555.1_g000004 Rmu_sc0006059.1_g000074 Rmu_sc0006968.1_g000016 Rmu_sc0006968.1_g000018 Rmu_sc0006968.1_g000022 Rmu_sc0008732.1_g000004 Rmu_sc0010714.1_g000004 Rmu_sc0015364.1_g000001 Rmu_sc0015448.1_g000001 Rmu_sc0016543.1_g000005 Rmu_sc0025001.1_g000005
rosa_roxburghii Rroxscaffold_176G00431020 Rroxscaffold_1G00007210 Rroxscaffold_1G00044150 Rroxscaffold_1G00044170 Rroxscaffold_1G00044190 Rroxscaffold_1G00044220 Rroxscaffold_1G00044860 Rroxscaffold_1G00044870 Rroxscaffold_1G00052580 Rroxscaffold_1G00052940 Rroxscaffold_1G00053250 Rroxscaffold_1G00070620 Rroxscaffold_1G00070690 Rroxscaffold_1G00070720 Rroxscaffold_5G00353610 Rroxscaffold_6G00398200 Rroxscaffold_7G00204580
rosa_rugosa Rorug01G0307900 Rorug03G0207300 Rorug05G0086700 Rorug05G0156300 Rorug05G0157800 Rorug05G0157900 Rorug05G0157900 Rorug05G0157900
rosa_samantha Rh1BG280000 Rh3AG255400 Rh5AG189100 Rh5AG250500 Rh5BG252100 Rh5CG198600 Rh5CG203300 Rh5CG205400 Rh5CG206200 Rh5CG206600 Rh5CG281100 Rh5CG282300 Rh5CG283600 Rh5CG283800 Rh5CG284100 Rh5CG424200 Rh5DG181000 Rh5DG258000 Rh5DG260000 Rh5DG260400 Rh5DG260500
rosa_wichuraiana Rw1G028060 Rw3G023100 Rw5G016880 Rw5G017170 Rw5G022990 Rw5G023010 Rw5G023030 Rw5G023040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 154
AfiI CCNNNNNNNGG 1 cut(s) 54
AluBI AGCT 3 cut(s) 85, 103, 168
AluI AGCT 3 cut(s) 85, 103, 168
Alw26I GTCTC 1 cut(s) 16
Ama87I CYCGRG 1 cut(s) 38
AoxI GGCC 3 cut(s) 59, 68, 76
ArsI GACNNNNNNTTYG 2 cut(s) 15, 47
AspLEI GCGC 1 cut(s) 47
AspS9I GGNCC 1 cut(s) 69
AvaI CYCGRG 1 cut(s) 38
BccI CCATC 1 cut(s) 146
BcoDI GTCTC 1 cut(s) 16
BglI GCCNNNNNGGC 1 cut(s) 67
BmeT110I CYCGRG 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 69
BpmI CTGGAG 1 cut(s) 65
BsaBI GATNNNNATC 1 cut(s) 125
Bsc4I CCNNNNNNNGG 1 cut(s) 54
Bse8I GATNNNNATC 1 cut(s) 125
BseGI GGATG 1 cut(s) 24
BseJI GATNNNNATC 1 cut(s) 125
BseLI CCNNNNNNNGG 1 cut(s) 54
BseRI GAGGAG 2 cut(s) 146, 149
BshFI GGCC 3 cut(s) 61, 70, 78
BsiHKCI CYCGRG 1 cut(s) 38
BsiSI CCGG 1 cut(s) 67
BslI CCNNNNNNNGG 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 16
BsmBI CGTCTC 1 cut(s) 16
BsnI GGCC 3 cut(s) 61, 70, 78
BsoBI CYCGRG 1 cut(s) 38
Bsp143I GATC 2 cut(s) 126, 173
BspANI GGCC 3 cut(s) 61, 70, 78
BssMI GATC 2 cut(s) 126, 173
BstENI CCTNNNNNAGG 1 cut(s) 52
BstF5I GGATG 1 cut(s) 24
BstHHI GCGC 1 cut(s) 47
BstKTI GATC 2 cut(s) 129, 176
BstMAI GTCTC 1 cut(s) 16
BstMBI GATC 2 cut(s) 126, 173
BstMWI GCNNNNNNNGC 2 cut(s) 67, 115
BsuRI GGCC 3 cut(s) 61, 70, 78
BtsCI GGATG 1 cut(s) 24
CfoI GCGC 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 69
CviJI RGCY 7 cut(s) 37, 61, 70, 78, 85, 103, 168
CviKI_1 RGCY 7 cut(s) 37, 61, 70, 78, 85, 103, 168
DpnI GATC 2 cut(s) 128, 175
DpnII GATC 2 cut(s) 126, 173
Eco57I CTGAAG 1 cut(s) 154
Eco88I CYCGRG 1 cut(s) 38
EcoNI CCTNNNNNAGG 1 cut(s) 52
Esp3I CGTCTC 1 cut(s) 16
FaiI YATR 1 cut(s) 212
FalI AAGNNNNNCTT 2 cut(s) 46, 78
FokI GGATG 1 cut(s) 31
GlaI GCGC 1 cut(s) 46
GsuI CTGGAG 1 cut(s) 65
HaeIII GGCC 3 cut(s) 61, 70, 78
HapII CCGG 1 cut(s) 67
HhaI GCGC 1 cut(s) 47
Hin6I GCGC 1 cut(s) 45
HinP1I GCGC 1 cut(s) 45
HindIII AAGCTT 1 cut(s) 101
HinfI GANTC 1 cut(s) 121
HpaII CCGG 1 cut(s) 67
Hpy188I TCNGA 2 cut(s) 126, 173
Hpy99I CGWCG 2 cut(s) 77, 118
HpyAV CCTTC 3 cut(s) 48, 172, 211
HpyCH4IV ACGT 2 cut(s) 8, 113
HpyF10VI GCNNNNNNNGC 2 cut(s) 67, 115
HpySE526I ACGT 2 cut(s) 8, 113
HspAI GCGC 1 cut(s) 45
Kzo9I GATC 2 cut(s) 126, 173
LmnI GCTCC 2 cut(s) 165, 232
LpnPI CCDG 3 cut(s) 61, 80, 95
MaeII ACGT 2 cut(s) 8, 113
MalI GATC 2 cut(s) 128, 175
MboI GATC 2 cut(s) 126, 173
MboII GAAGA 2 cut(s) 253, 256
MluCI AATT 2 cut(s) 251, 265
MnlI CCTC 9 cut(s) 9, 89, 124, 127, 130, 136, 176, 182, 222
MseI TTAA 1 cut(s) 254
MspI CCGG 1 cut(s) 67
MwoI GCNNNNNNNGC 2 cut(s) 67, 115
NdeII GATC 2 cut(s) 126, 173
PfeI GAWTC 1 cut(s) 121
PspPI GGNCC 1 cut(s) 69
SaqAI TTAA 1 cut(s) 254
Sau3AI GATC 2 cut(s) 126, 173
Sau96I GGNCC 1 cut(s) 69
SetI ASST 9 cut(s) 11, 33, 59, 87, 105, 116, 170, 187, 193
SfiI GGCCNNNNNGGCC 1 cut(s) 67
Sse9I AATT 2 cut(s) 251, 265
SspI AATATT 1 cut(s) 91
TaiI ACGT 2 cut(s) 11, 116
TaqI TCGA 4 cut(s) 52, 129, 176, 207
TasI AATT 2 cut(s) 251, 265
TfiI GAWTC 1 cut(s) 121
Tru1I TTAA 1 cut(s) 254
Tru9I TTAA 1 cut(s) 254
XagI CCTNNNNNAGG 1 cut(s) 52
XcmI CCANNNNNNNNNTGG 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.