Rmu_sc0006059.1_g000074

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006059.1
Physical Location & Seq
Reverse (-)
264202 .. 265385
1184 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006059.1_g000074.1.cds

Sequence Viewer

Length: 900 bp
atggaagggcaagaaataggggtgaaaaggctttcaagaagttcgagacaaggaatcaaagagttcaagaatgaagtattatgcatttccaagctacagcaccgcaaccttgtgaagcttctgggatgttgcactgaaggccaagaaaggctgttgatatatgaatacatgcccaacaagagcttggacttcttcatattcaaggaacagcaaagtataattctggactggcctaagcgtttccacattatcaatgggatagctagagggctactttatcttcatcaagattccagactgaggataatccatcgtgatctaaaagccagcaatgtcttactagacaatgaactgaatccaaaaatttcagattttggcattgctaggagtttcggaggagatgaaactgaagcaaatacgaagagagtggttggaacatacggttacatgtctccagaatatgcaattgatggtgtcttctcagtgaaatctgatgtttttagctttggtgttttggtacttgagatagtgagtggaaagaagaacagaggattttctcacacagaccacaagcttaaccttcttggacatgcctggaggctcttcaaagaaggcaagccatttgaaatgatgcatacatctataaagaacaaaaacacaagcagtatgtccgaggtattacgatcagtccacgtggctctattatgcgtgcaacagagtccagaagaaaggcctagtatgtcaaatgtagttctcatgctaagtagtgatattacattgccacagcctaaagaaccaggctttttcacagaaaggcatctgctatctatggcttcctcatcaagccagcgtgaaagttcttcatccaacagactatccatttcactagaggctcgatag

Protein Analysis

299

Amino Acids

33.95

Weight (kDa)

9.2

Isoelectric Point (pI)

59.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000201)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21366
fragaria_vesca FvH4_3g15730 FvH4_3g21351 FvH4_3g21401 FvH4_3g21420
malus_domestica MD00G1151400.v1.1 MD03G1185300.v1.1 MD05G1217100.v1.1 MD05G1217400.v1.1 MD05G1220300.v1.1 MD05G1232800.v1.1 MD05G1332500.v1.1 MD05G1332800.v1.1 MD09G1059900.v1.1 MD10G1308300.v1.1 MD11G1231000.v1.1 MD12G1047500.v1.1 MD17G1273100.v1.1
prunus_persica Prupe.4G031700_v2.0.a1 Prupe.4G031700_v2.0.a1 Prupe.4G142200_v2.0.a1 Prupe.4G142700_v2.0.a1 Prupe.4G195200_v2.0.a1 Prupe.4G195600_v2.0.a1 Prupe.4G195800_v2.0.a1 Prupe.4G196000_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196400_v2.0.a1 Prupe.4G237800_v2.0.a1
pyrus_communis pycom03g16470 pycom03g16480 pycom03g16490 pycom03g16500 pycom03g16510 pycom05g19890 pycom05g20180 pycom05g20300 pycom05g30520 pycom09g02440 pycom11g20450
rosa_chinensis RchiOBHm_Chr1g0363501 RchiOBHm_Chr3g0477311 RchiOBHm_Chr3g0483581 RchiOBHm_Chr4g0411701 RchiOBHm_Chr5g0025991 RchiOBHm_Chr5g0026501 RchiOBHm_Chr5g0026541 RchiOBHm_Chr5g0026771 RchiOBHm_Chr5g0035631 RchiOBHm_Chr5g0035871 RchiOBHm_Chr5g0036451 RchiOBHm_Chr5g0036751 RchiOBHm_Chr5g0036771 RchiOBHm_Chr5g0036781 RchiOBHm_Chr5g0036801 RchiOBHm_Chr5g0036851
rosa_laevigata RLG00000031277 RLG00000032829 RLG00000032831 RLG00000032890 RLG00000032895 RLG00000032899 RLG00000032924 RLG00000033714 RLG00000033715 RLG00000033719 RLG00000033720 RLG00000033722 RLG00000033726
rosa_multiflora Rmu_co8109542.1_g000001 Rmu_co8147940.1_g000001 Rmu_co8162180.1_g000001 Rmu_co8193822.1_g000001 Rmu_co8362785.1_g000001 Rmu_co8410231.1_g000001 Rmu_co8422055.1_g000001 Rmu_sc0000149.1_g000048 Rmu_sc0000399.1_g000001 Rmu_sc0000555.1_g000013 Rmu_sc0000593.1_g000001 Rmu_sc0001348.1_g000035 Rmu_sc0004371.1_g000010 Rmu_sc0004371.1_g000019 Rmu_sc0005555.1_g000004 Rmu_sc0006059.1_g000074 Rmu_sc0006968.1_g000016 Rmu_sc0006968.1_g000018 Rmu_sc0006968.1_g000022 Rmu_sc0008732.1_g000004 Rmu_sc0010714.1_g000004 Rmu_sc0015364.1_g000001 Rmu_sc0015448.1_g000001 Rmu_sc0016543.1_g000005 Rmu_sc0025001.1_g000005
rosa_roxburghii Rroxscaffold_176G00431020 Rroxscaffold_1G00007210 Rroxscaffold_1G00044150 Rroxscaffold_1G00044170 Rroxscaffold_1G00044190 Rroxscaffold_1G00044220 Rroxscaffold_1G00044860 Rroxscaffold_1G00044870 Rroxscaffold_1G00052580 Rroxscaffold_1G00052940 Rroxscaffold_1G00053250 Rroxscaffold_1G00070620 Rroxscaffold_1G00070690 Rroxscaffold_1G00070720 Rroxscaffold_5G00353610 Rroxscaffold_6G00398200 Rroxscaffold_7G00204580
rosa_rugosa Rorug01G0307900 Rorug03G0207300 Rorug05G0086700 Rorug05G0156300 Rorug05G0157800 Rorug05G0157900 Rorug05G0157900 Rorug05G0157900
rosa_samantha Rh1BG280000 Rh3AG255400 Rh5AG189100 Rh5AG250500 Rh5BG252100 Rh5CG198600 Rh5CG203300 Rh5CG205400 Rh5CG206200 Rh5CG206600 Rh5CG281100 Rh5CG282300 Rh5CG283600 Rh5CG283800 Rh5CG284100 Rh5CG424200 Rh5DG181000 Rh5DG258000 Rh5DG260000 Rh5DG260400 Rh5DG260500
rosa_wichuraiana Rw1G028060 Rw3G023100 Rw5G016880 Rw5G017170 Rw5G022990 Rw5G023010 Rw5G023030 Rw5G023040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 103
AcsI RAATTY 1 cut(s) 363
AcuI CTGAAG 2 cut(s) 156, 429
AcvI CACGTG 1 cut(s) 694
AfaI GTAC 1 cut(s) 519
AfiI CCNNNNNNNGG 1 cut(s) 300
AflIII ACRYGT 1 cut(s) 447
AgsI TTSAA 5 cut(s) 36, 67, 202, 607, 626
AjnI CCWGG 2 cut(s) 593, 796
AluBI AGCT 6 cut(s) 94, 118, 183, 263, 504, 574
AluI AGCT 6 cut(s) 94, 118, 183, 263, 504, 574
Alw26I GTCTC 2 cut(s) 40, 456
AoxI GGCC 3 cut(s) 139, 230, 731
ApoI RAATTY 1 cut(s) 363
AsuHPI GGTGA 1 cut(s) 34
BbrPI CACGTG 1 cut(s) 694
BbsI GAAGAC 1 cut(s) 469
BccI CCATC 2 cut(s) 318, 464
BciT130I CCWGG 2 cut(s) 595, 798
BcoDI GTCTC 2 cut(s) 40, 456
BfaI CTAG 5 cut(s) 264, 341, 384, 735, 887
BfmI CTRYAG 1 cut(s) 95
Bme1390I CCNGG 2 cut(s) 595, 798
BmrFI CCNGG 2 cut(s) 595, 798
BmsI GCATC 2 cut(s) 621, 826
BpiI GAAGAC 1 cut(s) 469
BpmI CTGGAG 2 cut(s) 438, 616
Bpu10I CCTNAGC 1 cut(s) 234
BpuEI CTTGAG 1 cut(s) 542
BsaAI YACGTR 1 cut(s) 694
BsaJI CCNNGG 1 cut(s) 672
Bsc4I CCNNNNNNNGG 1 cut(s) 300
Bse1I ACTGG 1 cut(s) 233
Bse3DI GCAATG 3 cut(s) 337, 378, 776
BseBI CCWGG 2 cut(s) 595, 798
BseDI CCNNGG 1 cut(s) 672
BseGI GGATG 2 cut(s) 131, 863
BseLI CCNNNNNNNGG 1 cut(s) 300
BseMI GCAATG 3 cut(s) 337, 378, 776
BseMII CTCAG 2 cut(s) 290, 495
BseNI ACTGG 1 cut(s) 233
BseRI GAGGAG 1 cut(s) 411
BshFI GGCC 3 cut(s) 141, 232, 733
BslI CCNNNNNNNGG 1 cut(s) 300
BsmAI GTCTC 2 cut(s) 40, 456
BsnI GGCC 3 cut(s) 141, 232, 733
Bsp143I GATC 2 cut(s) 316, 683
BspACI CCGC 1 cut(s) 103
BspANI GGCC 3 cut(s) 141, 232, 733
BspCNI CTCAG 2 cut(s) 291, 494
BspQI GCTCTTC 1 cut(s) 608
BsrDI GCAATG 3 cut(s) 337, 378, 776
BsrI ACTGG 1 cut(s) 233
BssECI CCNNGG 1 cut(s) 672
BssMI GATC 2 cut(s) 316, 683
Bst2UI CCWGG 2 cut(s) 595, 798
Bst4CI ACNGT 1 cut(s) 443
Bst6I CTCTTC 2 cut(s) 416, 608
BstBAI YACGTR 1 cut(s) 694
BstC8I GCNNGC 4 cut(s) 328, 617, 710, 848
BstDEI CTNAG 4 cut(s) 234, 299, 481, 761
BstF5I GGATG 2 cut(s) 131, 863
BstKTI GATC 2 cut(s) 319, 686
BstMAI GTCTC 2 cut(s) 40, 456
BstMBI GATC 2 cut(s) 316, 683
BstMWI GCNNNNNNNGC 1 cut(s) 138
BstNI CCWGG 2 cut(s) 595, 798
BstNSI RCATGY 3 cut(s) 172, 451, 593
BstSCI CCNGG 2 cut(s) 593, 796
BstSFI CTRYAG 1 cut(s) 95
BstV2I GAAGAC 1 cut(s) 469
BsuRI GGCC 3 cut(s) 141, 232, 733
BtsCI GGATG 2 cut(s) 131, 863
BtsIMutI CAGTG 2 cut(s) 132, 489
Cac8I GCNNGC 4 cut(s) 328, 617, 710, 848
Csp6I GTAC 1 cut(s) 518
CviAII CATG 4 cut(s) 169, 448, 590, 757
CviQI GTAC 1 cut(s) 518
DdeI CTNAG 4 cut(s) 234, 299, 481, 761
DpnI GATC 2 cut(s) 318, 685
DpnII GATC 2 cut(s) 316, 683
Eam1104I CTCTTC 2 cut(s) 416, 608
EarI CTCTTC 2 cut(s) 416, 608
Eco147I AGGCCT 1 cut(s) 733
Eco57I CTGAAG 2 cut(s) 156, 429
Eco72I CACGTG 1 cut(s) 694
EcoRII CCWGG 2 cut(s) 593, 796
EcoT22I ATGCAT 2 cut(s) 86, 636
FaeI CATG 4 cut(s) 172, 451, 593, 760
FatI CATG 4 cut(s) 168, 447, 589, 756
FokI GGATG 2 cut(s) 138, 850
FspBI CTAG 5 cut(s) 264, 341, 384, 735, 887
GsuI CTGGAG 2 cut(s) 438, 616
HaeIII GGCC 3 cut(s) 141, 232, 733
Hin1II CATG 4 cut(s) 172, 451, 593, 760
HindIII AAGCTT 2 cut(s) 116, 572
HinfI GANTC 4 cut(s) 54, 290, 355, 718
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 691
Hpy188I TCNGA 4 cut(s) 370, 395, 493, 673
Hpy188III TCNNGA 9 cut(s) 36, 45, 67, 224, 287, 294, 314, 455, 722
Hpy8I GTNNAC 1 cut(s) 691
HpyAV CCTTC 3 cut(s) 131, 590, 605
HpyCH4III ACNGT 1 cut(s) 443
HpyCH4IV ACGT 1 cut(s) 693
HpyCH4V TGCA 5 cut(s) 84, 132, 464, 634, 712
HpyF10VI GCNNNNNNNGC 1 cut(s) 138
HpyF3I CTNAG 4 cut(s) 234, 299, 481, 761
HpySE526I ACGT 1 cut(s) 693
Hsp92II CATG 4 cut(s) 172, 451, 593, 760
Kzo9I GATC 2 cut(s) 316, 683
LguI GCTCTTC 1 cut(s) 608
LweI GCATC 2 cut(s) 621, 826
MaeI CTAG 5 cut(s) 264, 341, 384, 735, 887
MaeII ACGT 1 cut(s) 693
MaeIII GTNAC 1 cut(s) 443
MalI GATC 2 cut(s) 318, 685
MboI GATC 2 cut(s) 316, 683
MboII GAAGA 8 cut(s) 184, 272, 433, 469, 553, 595, 737, 852
MfeI CAATTG 1 cut(s) 465
MluCI AATT 3 cut(s) 219, 363, 465
MlyI GAGTC 1 cut(s) 727
MmeI TCCRAC 2 cut(s) 412, 891
MnlI CCTC 8 cut(s) 260, 294, 389, 542, 591, 667, 847, 883
Mph1103I ATGCAT 2 cut(s) 86, 636
MseI TTAA 1 cut(s) 576
MspR9I CCNGG 2 cut(s) 595, 798
MunI CAATTG 1 cut(s) 465
MvaI CCWGG 2 cut(s) 595, 798
MwoI GCNNNNNNNGC 1 cut(s) 138
NdeII GATC 2 cut(s) 316, 683
NlaIII CATG 4 cut(s) 172, 451, 593, 760
NsiI ATGCAT 2 cut(s) 86, 636
NspI RCATGY 3 cut(s) 172, 451, 593
PceI AGGCCT 1 cut(s) 733
PciI ACATGT 1 cut(s) 447
PciSI GCTCTTC 1 cut(s) 608
PfeI GAWTC 3 cut(s) 54, 290, 355
PleI GAGTC 1 cut(s) 726
PmaCI CACGTG 1 cut(s) 694
PmlI CACGTG 1 cut(s) 694
PpsI GAGTC 1 cut(s) 726
Ppu21I YACGTR 1 cut(s) 694
PscI ACATGT 1 cut(s) 447
Psp6I CCWGG 2 cut(s) 593, 796
PspCI CACGTG 1 cut(s) 694
PspGI CCWGG 2 cut(s) 593, 796
RsaI GTAC 1 cut(s) 519
RsaNI GTAC 1 cut(s) 518
SapI GCTCTTC 1 cut(s) 608
SaqAI TTAA 1 cut(s) 576
Sau3AI GATC 2 cut(s) 316, 683
SchI GAGTC 1 cut(s) 727
ScrFI CCNGG 2 cut(s) 595, 798
SfaNI GCATC 2 cut(s) 621, 826
SfcI CTRYAG 1 cut(s) 95
SmlI CTYRAG 1 cut(s) 521
SmoI CTYRAG 1 cut(s) 521
Sse9I AATT 3 cut(s) 219, 363, 465
SseBI AGGCCT 1 cut(s) 733
SsiI CCGC 1 cut(s) 103
SspMI CTAG 5 cut(s) 264, 341, 384, 735, 887
StuI AGGCCT 1 cut(s) 733
StyD4I CCNGG 2 cut(s) 593, 796
TaaI ACNGT 1 cut(s) 443
TaiI ACGT 1 cut(s) 696
TaqI TCGA 2 cut(s) 44, 895
TasI AATT 3 cut(s) 219, 363, 465
TfiI GAWTC 3 cut(s) 54, 290, 355
Tru1I TTAA 1 cut(s) 576
Tru9I TTAA 1 cut(s) 576
TscAI CASTG 2 cut(s) 139, 489
TspDTI ATGAA 7 cut(s) 87, 177, 184, 272, 363, 417, 852
TspRI CASTG 2 cut(s) 139, 489
XapI RAATTY 1 cut(s) 363
XceI RCATGY 3 cut(s) 172, 451, 593
XcmI CCANNNNNNNNNTGG 2 cut(s) 181, 251
XspI CTAG 5 cut(s) 264, 341, 384, 735, 887
Zsp2I ATGCAT 2 cut(s) 86, 636
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.