Rh5CG206200

divergent subfamily of APPLE domains

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000201
Physical Location & Seq
Reverse (-)
20822201 .. 20822548
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG206200.1

Sequence Viewer

Length: 348 bp
ATGCAGTCCATCCTACTAACATGTTCTTCGTTTTGTTCAAAGGCATGGACACTATGGACTCAAAATAATCCTCTGGAACTGGTTGATGTGACGTTATGTGATTCTTGCAACACATCCGGAGTGTTGAGATGTCTTCATGTGGGCCTGTTATGTGTGCAACAATCACCTGAAGATAGACCAAGCATGTCATCTGTGGTTCTAATGTTGGGAAGTGAAATTAAGTTGCCTACGCCAAAAGAGCCTGGTTTTTACACTGGACGGACCGTTCCAGTTCCTGAATCAACATCGACGACAAGTGACTTGTGCTCAGCAAATAGTTTTAGCACAATGTTCTTAGAATCTCGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase Pkinase_Tyr S_locus_glycop

Protein Analysis

115

Amino Acids

12.54

Weight (kDa)

4.91

Isoelectric Point (pI)

59.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000201)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21366
fragaria_vesca FvH4_3g15730 FvH4_3g21351 FvH4_3g21401 FvH4_3g21420
malus_domestica MD00G1151400.v1.1 MD03G1185300.v1.1 MD05G1217100.v1.1 MD05G1217400.v1.1 MD05G1220300.v1.1 MD05G1232800.v1.1 MD05G1332500.v1.1 MD05G1332800.v1.1 MD09G1059900.v1.1 MD10G1308300.v1.1 MD11G1231000.v1.1 MD12G1047500.v1.1 MD17G1273100.v1.1
prunus_persica Prupe.4G031700_v2.0.a1 Prupe.4G031700_v2.0.a1 Prupe.4G142200_v2.0.a1 Prupe.4G142700_v2.0.a1 Prupe.4G195200_v2.0.a1 Prupe.4G195600_v2.0.a1 Prupe.4G195800_v2.0.a1 Prupe.4G196000_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196400_v2.0.a1 Prupe.4G237800_v2.0.a1
pyrus_communis pycom03g16470 pycom03g16480 pycom03g16490 pycom03g16500 pycom03g16510 pycom05g19890 pycom05g20180 pycom05g20300 pycom05g30520 pycom09g02440 pycom11g20450
rosa_chinensis RchiOBHm_Chr1g0363501 RchiOBHm_Chr3g0477311 RchiOBHm_Chr3g0483581 RchiOBHm_Chr4g0411701 RchiOBHm_Chr5g0025991 RchiOBHm_Chr5g0026501 RchiOBHm_Chr5g0026541 RchiOBHm_Chr5g0026771 RchiOBHm_Chr5g0035631 RchiOBHm_Chr5g0035871 RchiOBHm_Chr5g0036451 RchiOBHm_Chr5g0036751 RchiOBHm_Chr5g0036771 RchiOBHm_Chr5g0036781 RchiOBHm_Chr5g0036801 RchiOBHm_Chr5g0036851
rosa_laevigata RLG00000031277 RLG00000032829 RLG00000032831 RLG00000032890 RLG00000032895 RLG00000032899 RLG00000032924 RLG00000033714 RLG00000033715 RLG00000033719 RLG00000033720 RLG00000033722 RLG00000033726
rosa_multiflora Rmu_co8109542.1_g000001 Rmu_co8147940.1_g000001 Rmu_co8162180.1_g000001 Rmu_co8193822.1_g000001 Rmu_co8362785.1_g000001 Rmu_co8410231.1_g000001 Rmu_co8422055.1_g000001 Rmu_sc0000149.1_g000048 Rmu_sc0000399.1_g000001 Rmu_sc0000555.1_g000013 Rmu_sc0000593.1_g000001 Rmu_sc0001348.1_g000035 Rmu_sc0004371.1_g000010 Rmu_sc0004371.1_g000019 Rmu_sc0005555.1_g000004 Rmu_sc0006059.1_g000074 Rmu_sc0006968.1_g000016 Rmu_sc0006968.1_g000018 Rmu_sc0006968.1_g000022 Rmu_sc0008732.1_g000004 Rmu_sc0010714.1_g000004 Rmu_sc0015364.1_g000001 Rmu_sc0015448.1_g000001 Rmu_sc0016543.1_g000005 Rmu_sc0025001.1_g000005
rosa_roxburghii Rroxscaffold_176G00431020 Rroxscaffold_1G00007210 Rroxscaffold_1G00044150 Rroxscaffold_1G00044170 Rroxscaffold_1G00044190 Rroxscaffold_1G00044220 Rroxscaffold_1G00044860 Rroxscaffold_1G00044870 Rroxscaffold_1G00052580 Rroxscaffold_1G00052940 Rroxscaffold_1G00053250 Rroxscaffold_1G00070620 Rroxscaffold_1G00070690 Rroxscaffold_1G00070720 Rroxscaffold_5G00353610 Rroxscaffold_6G00398200 Rroxscaffold_7G00204580
rosa_rugosa Rorug01G0307900 Rorug03G0207300 Rorug05G0086700 Rorug05G0156300 Rorug05G0157800 Rorug05G0157900 Rorug05G0157900 Rorug05G0157900
rosa_samantha Rh1BG280000 Rh3AG255400 Rh5AG189100 Rh5AG250500 Rh5BG252100 Rh5CG198600 Rh5CG203300 Rh5CG205400 Rh5CG206200 Rh5CG206600 Rh5CG281100 Rh5CG282300 Rh5CG283600 Rh5CG283800 Rh5CG284100 Rh5CG424200 Rh5DG181000 Rh5DG258000 Rh5DG260000 Rh5DG260400 Rh5DG260500
rosa_wichuraiana Rw1G028060 Rw3G023100 Rw5G016880 Rw5G017170 Rw5G022990 Rw5G023010 Rw5G023030 Rw5G023040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 116
AcuI CTGAAG 1 cut(s) 189
AflIII ACRYGT 1 cut(s) 20
AgsI TTSAA 1 cut(s) 39
AjnI CCWGG 1 cut(s) 241
AloI GAACNNNNNNTCC 2 cut(s) 249, 281
Alw21I GWGCWC 1 cut(s) 308
AlwNI CAGNNNCTG 1 cut(s) 275
Aor13HI TCCGGA 1 cut(s) 116
AoxI GGCC 1 cut(s) 142
AspS9I GGNCC 2 cut(s) 142, 261
AsuHPI GGTGA 1 cut(s) 156
AvaII GGWCC 1 cut(s) 261
BbsI GAAGAC 1 cut(s) 125
Bbv12I GWGCWC 1 cut(s) 308
BccI CCATC 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 243
BfaI CTAG 1 cut(s) 346
BlpI GCTNAGC 1 cut(s) 307
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 1 cut(s) 261
BmgT120I GGNCC 2 cut(s) 142, 261
BmrFI CCNGG 1 cut(s) 243
BpiI GAAGAC 1 cut(s) 125
Bpu1102I GCTNAGC 1 cut(s) 307
BsaWI WCCGGW 1 cut(s) 116
Bse1I ACTGG 3 cut(s) 84, 259, 269
BseAI TCCGGA 1 cut(s) 116
BseBI CCWGG 1 cut(s) 243
BseGI GGATG 2 cut(s) 9, 113
BseMII CTCAG 1 cut(s) 321
BseNI ACTGG 3 cut(s) 84, 259, 269
BshFI GGCC 1 cut(s) 144
BsiHKAI GWGCWC 1 cut(s) 308
BsiSI CCGG 1 cut(s) 117
BsnI GGCC 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 308
Bsp13I TCCGGA 1 cut(s) 116
Bsp1720I GCTNAGC 1 cut(s) 307
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 1 cut(s) 320
BspEI TCCGGA 1 cut(s) 116
BsrI ACTGG 3 cut(s) 84, 259, 269
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 265
BstDEI CTNAG 2 cut(s) 307, 334
BstF5I GGATG 2 cut(s) 9, 113
BstMWI GCNNNNNNNGC 1 cut(s) 238
BstNI CCWGG 1 cut(s) 243
BstNSI RCATGY 2 cut(s) 24, 187
BstSCI CCNGG 1 cut(s) 241
BstV2I GAAGAC 1 cut(s) 125
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 2 cut(s) 9, 113
BtsIMutI CAGTG 1 cut(s) 252
CaiI CAGNNNCTG 1 cut(s) 275
Cfr13I GGNCC 2 cut(s) 142, 261
CpoI CGGWCCG 1 cut(s) 261
CspI CGGWCCG 1 cut(s) 261
CviAII CATG 4 cut(s) 21, 45, 137, 184
CviJI RGCY 2 cut(s) 144, 241
CviKI_1 RGCY 2 cut(s) 144, 241
DdeI CTNAG 2 cut(s) 307, 334
Eco47I GGWCC 1 cut(s) 261
Eco57I CTGAAG 1 cut(s) 189
EcoRII CCWGG 1 cut(s) 241
FaeI CATG 4 cut(s) 24, 48, 140, 187
FaiI YATR 7 cut(s) 22, 46, 55, 97, 138, 151, 185
FatI CATG 4 cut(s) 20, 44, 136, 183
FokI GGATG 1 cut(s) 100
FspBI CTAG 1 cut(s) 346
HaeIII GGCC 1 cut(s) 144
HapII CCGG 1 cut(s) 117
Hin1II CATG 4 cut(s) 24, 48, 140, 187
HinfI GANTC 4 cut(s) 58, 101, 278, 338
HpaII CCGG 1 cut(s) 117
HphI GGTGA 1 cut(s) 156
Hpy188III TCNNGA 3 cut(s) 74, 117, 275
Hpy99I CGWCG 1 cut(s) 292
HpyCH4III ACNGT 1 cut(s) 265
HpyCH4IV ACGT 1 cut(s) 92
HpyCH4V TGCA 3 cut(s) 4, 108, 157
HpyF10VI GCNNNNNNNGC 1 cut(s) 238
HpyF3I CTNAG 2 cut(s) 307, 334
HpySE526I ACGT 1 cut(s) 92
Hsp92II CATG 4 cut(s) 24, 48, 140, 187
Kpn2I TCCGGA 1 cut(s) 116
MaeI CTAG 1 cut(s) 346
MaeII ACGT 1 cut(s) 92
MaeIII GTNAC 2 cut(s) 88, 296
MboII GAAGA 3 cut(s) 18, 125, 182
MhlI GDGCHC 1 cut(s) 308
MluCI AATT 1 cut(s) 216
MlyI GAGTC 1 cut(s) 52
MnlI CCTC 1 cut(s) 81
MroI TCCGGA 1 cut(s) 116
MseI TTAA 1 cut(s) 219
MspI CCGG 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
MwoI GCNNNNNNNGC 1 cut(s) 238
NlaIII CATG 4 cut(s) 24, 48, 140, 187
NmuCI GTSAC 2 cut(s) 88, 296
NspI RCATGY 2 cut(s) 24, 187
PciI ACATGT 1 cut(s) 20
PfeI GAWTC 3 cut(s) 101, 278, 338
PleI GAGTC 1 cut(s) 52
PpsI GAGTC 1 cut(s) 52
PscI ACATGT 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspPI GGNCC 2 cut(s) 142, 261
PstNI CAGNNNCTG 1 cut(s) 275
Rsr2I CGGWCCG 1 cut(s) 261
RsrII CGGWCCG 1 cut(s) 261
SaqAI TTAA 1 cut(s) 219
Sau96I GGNCC 2 cut(s) 142, 261
SchI GAGTC 1 cut(s) 52
ScrFI CCNGG 1 cut(s) 243
SduI GDGCHC 1 cut(s) 308
SetI ASST 2 cut(s) 95, 169
SinI GGWCC 1 cut(s) 261
Sse9I AATT 1 cut(s) 216
SspMI CTAG 1 cut(s) 346
StyD4I CCNGG 1 cut(s) 241
TaaI ACNGT 1 cut(s) 265
TaiI ACGT 1 cut(s) 95
TaqI TCGA 1 cut(s) 287
TasI AATT 1 cut(s) 216
TfiI GAWTC 3 cut(s) 101, 278, 338
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TscAI CASTG 1 cut(s) 259
TseFI GTSAC 2 cut(s) 88, 296
Tsp45I GTSAC 2 cut(s) 88, 296
TspDTI ATGAA 1 cut(s) 125
TspGWI ACGGA 1 cut(s) 274
TspRI CASTG 1 cut(s) 259
VpaK11BI GGWCC 1 cut(s) 261
XceI RCATGY 2 cut(s) 24, 187
XspI CTAG 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.