Rmu_sc0008732.1_g000004

divergent subfamily of APPLE domains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008732.1
Physical Location & Seq
Forward (+)
16917 .. 18397
1481 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008732.1_g000004.1.cds

Sequence Viewer

Length: 726 bp
atgctgaagagatctactctttcagaagcccgaagaaagctggattccagaaagggggattaccgtggagaagaccgggaagacatggagttaccattatttgacttgaccactattgctaatgccactaatgacttttcaagcagcaacaagctgggtgaaggtggttttgggcctgtgtacaagggaactttggttggaggagaggaaattgcagtaaagaggctctcaaagaactctggacagggattgagagagtttaaaaacgaagttctactgatagccaaacttcagcataggaatcttgtaaagcttcttggttgttgcattcaagaagatgaagaaattttagtatatgaattcatgcctaacagaagcttggacttctttatctttgatcaagaaagacagaagtttctcgactggcccacgtgcttccacattattgacggaattgctcgagggcttctttatctccatcaagactctagattaagaattatccatagagatatgaaggctagcaatatcttgctggacagtgatatgaaaccaaagatttcggacttcggcctggctaaaacatttgggggtgatcaaagtgaagacagtacaaatagagtagttggaacacatgaagttaaattgccttcaccaaagcaacctggtttttacactggacggactgtgacagtctccgaatcaacatcatcaacgaccgactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

241

Amino Acids

27.21

Weight (kDa)

6.25

Isoelectric Point (pI)

51.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000201)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21366
fragaria_vesca FvH4_3g15730 FvH4_3g21351 FvH4_3g21401 FvH4_3g21420
malus_domestica MD00G1151400.v1.1 MD03G1185300.v1.1 MD05G1217100.v1.1 MD05G1217400.v1.1 MD05G1220300.v1.1 MD05G1232800.v1.1 MD05G1332500.v1.1 MD05G1332800.v1.1 MD09G1059900.v1.1 MD10G1308300.v1.1 MD11G1231000.v1.1 MD12G1047500.v1.1 MD17G1273100.v1.1
prunus_persica Prupe.4G031700_v2.0.a1 Prupe.4G031700_v2.0.a1 Prupe.4G142200_v2.0.a1 Prupe.4G142700_v2.0.a1 Prupe.4G195200_v2.0.a1 Prupe.4G195600_v2.0.a1 Prupe.4G195800_v2.0.a1 Prupe.4G196000_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196400_v2.0.a1 Prupe.4G237800_v2.0.a1
pyrus_communis pycom03g16470 pycom03g16480 pycom03g16490 pycom03g16500 pycom03g16510 pycom05g19890 pycom05g20180 pycom05g20300 pycom05g30520 pycom09g02440 pycom11g20450
rosa_chinensis RchiOBHm_Chr1g0363501 RchiOBHm_Chr3g0477311 RchiOBHm_Chr3g0483581 RchiOBHm_Chr4g0411701 RchiOBHm_Chr5g0025991 RchiOBHm_Chr5g0026501 RchiOBHm_Chr5g0026541 RchiOBHm_Chr5g0026771 RchiOBHm_Chr5g0035631 RchiOBHm_Chr5g0035871 RchiOBHm_Chr5g0036451 RchiOBHm_Chr5g0036751 RchiOBHm_Chr5g0036771 RchiOBHm_Chr5g0036781 RchiOBHm_Chr5g0036801 RchiOBHm_Chr5g0036851
rosa_laevigata RLG00000031277 RLG00000032829 RLG00000032831 RLG00000032890 RLG00000032895 RLG00000032899 RLG00000032924 RLG00000033714 RLG00000033715 RLG00000033719 RLG00000033720 RLG00000033722 RLG00000033726
rosa_multiflora Rmu_co8109542.1_g000001 Rmu_co8147940.1_g000001 Rmu_co8162180.1_g000001 Rmu_co8193822.1_g000001 Rmu_co8362785.1_g000001 Rmu_co8410231.1_g000001 Rmu_co8422055.1_g000001 Rmu_sc0000149.1_g000048 Rmu_sc0000399.1_g000001 Rmu_sc0000555.1_g000013 Rmu_sc0000593.1_g000001 Rmu_sc0001348.1_g000035 Rmu_sc0004371.1_g000010 Rmu_sc0004371.1_g000019 Rmu_sc0005555.1_g000004 Rmu_sc0006059.1_g000074 Rmu_sc0006968.1_g000016 Rmu_sc0006968.1_g000018 Rmu_sc0006968.1_g000022 Rmu_sc0008732.1_g000004 Rmu_sc0010714.1_g000004 Rmu_sc0015364.1_g000001 Rmu_sc0015448.1_g000001 Rmu_sc0016543.1_g000005 Rmu_sc0025001.1_g000005
rosa_roxburghii Rroxscaffold_176G00431020 Rroxscaffold_1G00007210 Rroxscaffold_1G00044150 Rroxscaffold_1G00044170 Rroxscaffold_1G00044190 Rroxscaffold_1G00044220 Rroxscaffold_1G00044860 Rroxscaffold_1G00044870 Rroxscaffold_1G00052580 Rroxscaffold_1G00052940 Rroxscaffold_1G00053250 Rroxscaffold_1G00070620 Rroxscaffold_1G00070690 Rroxscaffold_1G00070720 Rroxscaffold_5G00353610 Rroxscaffold_6G00398200 Rroxscaffold_7G00204580
rosa_rugosa Rorug01G0307900 Rorug03G0207300 Rorug05G0086700 Rorug05G0156300 Rorug05G0157800 Rorug05G0157900 Rorug05G0157900 Rorug05G0157900
rosa_samantha Rh1BG280000 Rh3AG255400 Rh5AG189100 Rh5AG250500 Rh5BG252100 Rh5CG198600 Rh5CG203300 Rh5CG205400 Rh5CG206200 Rh5CG206600 Rh5CG281100 Rh5CG282300 Rh5CG283600 Rh5CG283800 Rh5CG284100 Rh5CG424200 Rh5DG181000 Rh5DG258000 Rh5DG260000 Rh5DG260400 Rh5DG260500
rosa_wichuraiana Rw1G028060 Rw3G023100 Rw5G016880 Rw5G017170 Rw5G022990 Rw5G023010 Rw5G023030 Rw5G023040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 345, 359
AcuI CTGAAG 2 cut(s) 26, 275
AcvI CACGTG 1 cut(s) 432
AfaI GTAC 2 cut(s) 182, 613
AfiI CCNNNNNNNGG 1 cut(s) 54
AgsI TTSAA 2 cut(s) 141, 332
AjnI CCWGG 2 cut(s) 573, 664
AjuI GAANNNNNNNTTGG 2 cut(s) 153, 185
AluBI AGCT 4 cut(s) 40, 154, 313, 378
AluI AGCT 4 cut(s) 40, 154, 313, 378
Alw26I GTCTC 1 cut(s) 700
Ama87I CYCGRG 1 cut(s) 459
AoxI GGCC 3 cut(s) 173, 425, 571
ApeKI GCWGC 1 cut(s) 144
ApoI RAATTY 2 cut(s) 345, 359
AspS9I GGNCC 2 cut(s) 173, 426
AsuC2I CCSGG 1 cut(s) 77
AsuHPI GGTGA 3 cut(s) 170, 605, 645
AsuNHI GCTAGC 1 cut(s) 521
AvaI CYCGRG 1 cut(s) 459
BbrPI CACGTG 1 cut(s) 432
BbsI GAAGAC 3 cut(s) 78, 87, 612
BbvI GCAGC 1 cut(s) 156
BccI CCATC 1 cut(s) 486
BciT130I CCWGG 2 cut(s) 575, 666
BclI TGATCA 2 cut(s) 397, 595
BcnI CCSGG 1 cut(s) 77
BcoDI GTCTC 1 cut(s) 700
BfaI CTAG 3 cut(s) 489, 522, 724
BglII AGATCT 1 cut(s) 11
BisI GCNGC 1 cut(s) 145
BlsI GCNGC 1 cut(s) 146
Bme1390I CCNGG 3 cut(s) 77, 575, 666
BmeT110I CYCGRG 1 cut(s) 459
BmgT120I GGNCC 2 cut(s) 173, 426
BmrFI CCNGG 3 cut(s) 77, 575, 666
BmtI GCTAGC 1 cut(s) 525
BpiI GAAGAC 3 cut(s) 78, 87, 612
BplI GAGNNNNNCTC 1 cut(s) 33
BpuMI CCSGG 1 cut(s) 77
BsaAI YACGTR 1 cut(s) 432
BsaJI CCNNGG 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 54
Bse1I ACTGG 2 cut(s) 428, 682
BseBI CCWGG 2 cut(s) 575, 666
BseDI CCNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 54
BseNI ACTGG 2 cut(s) 428, 682
BseRI GAGGAG 1 cut(s) 216
BseXI GCAGC 1 cut(s) 156
BseYI CCCAGC 1 cut(s) 154
Bsh1285I CGRYCG 1 cut(s) 720
BshFI GGCC 3 cut(s) 175, 427, 573
BsiEI CGRYCG 1 cut(s) 720
BsiHKCI CYCGRG 1 cut(s) 459
BsiSI CCGG 1 cut(s) 76
BslI CCNNNNNNNGG 1 cut(s) 54
BsmAI GTCTC 1 cut(s) 700
BsmI GAATGC 1 cut(s) 327
BsnI GGCC 3 cut(s) 175, 427, 573
BsoBI CYCGRG 1 cut(s) 459
Bsp1407I TGTACA 1 cut(s) 180
Bsp143I GATC 3 cut(s) 11, 397, 595
BspANI GGCC 3 cut(s) 175, 427, 573
BspOI GCTAGC 1 cut(s) 525
BsrGI TGTACA 1 cut(s) 180
BsrI ACTGG 2 cut(s) 428, 682
BssECI CCNNGG 1 cut(s) 64
BssMI GATC 3 cut(s) 11, 397, 595
Bst2UI CCWGG 2 cut(s) 575, 666
Bst4CI ACNGT 5 cut(s) 65, 542, 611, 688, 694
Bst6I CTCTTC 1 cut(s) 2
BstAUI TGTACA 1 cut(s) 180
BstBAI YACGTR 1 cut(s) 432
BstC8I GCNNGC 1 cut(s) 523
BstDSI CCRYGG 1 cut(s) 64
BstKTI GATC 3 cut(s) 14, 400, 598
BstMAI GTCTC 1 cut(s) 700
BstMBI GATC 3 cut(s) 11, 397, 595
BstMCI CGRYCG 1 cut(s) 720
BstNI CCWGG 2 cut(s) 575, 666
BstSCI CCNGG 3 cut(s) 75, 573, 664
BstV1I GCAGC 1 cut(s) 156
BstV2I GAAGAC 3 cut(s) 78, 87, 612
BstX2I RGATCY 1 cut(s) 11
BstYI RGATCY 1 cut(s) 11
BsuRI GGCC 3 cut(s) 175, 427, 573
BtgI CCRYGG 1 cut(s) 64
BtsIMutI CAGTG 2 cut(s) 547, 675
Cac8I GCNNGC 1 cut(s) 523
Cfr13I GGNCC 2 cut(s) 173, 426
CsiI ACCWGGT 1 cut(s) 664
Csp6I GTAC 2 cut(s) 181, 612
CviAII CATG 3 cut(s) 85, 364, 635
CviQI GTAC 2 cut(s) 181, 612
DpnI GATC 3 cut(s) 13, 399, 597
DpnII GATC 3 cut(s) 11, 397, 595
DraI TTTAAA 1 cut(s) 262
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
Eco57I CTGAAG 2 cut(s) 26, 275
Eco72I CACGTG 1 cut(s) 432
Eco88I CYCGRG 1 cut(s) 459
EcoRI GAATTC 1 cut(s) 359
EcoRII CCWGG 2 cut(s) 573, 664
FaeI CATG 3 cut(s) 88, 367, 638
FaiI YATR 9 cut(s) 86, 297, 355, 357, 365, 507, 515, 548, 636
FatI CATG 3 cut(s) 84, 363, 634
FbaI TGATCA 2 cut(s) 397, 595
Fnu4HI GCNGC 1 cut(s) 145
Fsp4HI GCNGC 1 cut(s) 145
FspBI CTAG 3 cut(s) 489, 522, 724
GluI GCNGC 1 cut(s) 145
GsaI CCCAGC 1 cut(s) 158
HaeIII GGCC 3 cut(s) 175, 427, 573
HapII CCGG 1 cut(s) 76
Hin1II CATG 3 cut(s) 88, 367, 638
HindIII AAGCTT 2 cut(s) 311, 376
HinfI GANTC 4 cut(s) 44, 301, 485, 701
HpaII CCGG 1 cut(s) 76
HphI GGTGA 3 cut(s) 170, 605, 645
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 3 cut(s) 25, 565, 700
Hpy188III TCNNGA 7 cut(s) 48, 240, 332, 401, 419, 482, 489
Hpy8I GTNNAC 1 cut(s) 181
HpyAV CCTTC 3 cut(s) 155, 511, 660
HpyCH4III ACNGT 5 cut(s) 65, 542, 611, 688, 694
HpyCH4IV ACGT 1 cut(s) 431
HpyCH4V TGCA 2 cut(s) 215, 327
HpySE526I ACGT 1 cut(s) 431
Hsp92II CATG 3 cut(s) 88, 367, 638
Ksp22I TGATCA 2 cut(s) 397, 595
Kzo9I GATC 3 cut(s) 11, 397, 595
Lsp1109I GCAGC 1 cut(s) 156
MabI ACCWGGT 1 cut(s) 664
MaeI CTAG 3 cut(s) 489, 522, 724
MaeII ACGT 1 cut(s) 431
MaeIII GTNAC 2 cut(s) 90, 688
MalI GATC 3 cut(s) 13, 399, 597
MboI GATC 3 cut(s) 11, 397, 595
MboII GAAGA 7 cut(s) 19, 45, 83, 92, 347, 353, 617
MflI RGATCY 1 cut(s) 11
MluCI AATT 6 cut(s) 210, 345, 359, 453, 498, 644
MlyI GAGTC 1 cut(s) 479
MmeI TCCRAC 2 cut(s) 178, 607
MnlI CCTC 4 cut(s) 194, 199, 216, 455
MseI TTAA 3 cut(s) 261, 494, 642
MspI CCGG 1 cut(s) 76
MspR9I CCNGG 3 cut(s) 77, 575, 666
Mva1269I GAATGC 1 cut(s) 327
MvaI CCWGG 2 cut(s) 575, 666
NciI CCSGG 1 cut(s) 77
NdeII GATC 3 cut(s) 11, 397, 595
NheI GCTAGC 1 cut(s) 521
NlaIII CATG 3 cut(s) 88, 367, 638
NmuCI GTSAC 1 cut(s) 688
PaeR7I CTCGAG 1 cut(s) 459
PctI GAATGC 1 cut(s) 327
PfeI GAWTC 3 cut(s) 44, 301, 701
PkrI GCNGC 1 cut(s) 146
PleI GAGTC 1 cut(s) 479
PmaCI CACGTG 1 cut(s) 432
PmlI CACGTG 1 cut(s) 432
PpsI GAGTC 1 cut(s) 479
Ppu21I YACGTR 1 cut(s) 432
Psp6I CCWGG 2 cut(s) 573, 664
PspCI CACGTG 1 cut(s) 432
PspFI CCCAGC 1 cut(s) 154
PspGI CCWGG 2 cut(s) 573, 664
PspPI GGNCC 2 cut(s) 173, 426
PspXI VCTCGAGB 1 cut(s) 459
PsuI RGATCY 1 cut(s) 11
RsaI GTAC 2 cut(s) 182, 613
RsaNI GTAC 2 cut(s) 181, 612
SaqAI TTAA 3 cut(s) 261, 494, 642
SatI GCNGC 1 cut(s) 145
Sau3AI GATC 3 cut(s) 11, 397, 595
Sau96I GGNCC 2 cut(s) 173, 426
SchI GAGTC 1 cut(s) 479
ScrFI CCNGG 3 cut(s) 77, 575, 666
SetI ASST 7 cut(s) 42, 156, 166, 315, 380, 434, 667
SexAI ACCWGGT 1 cut(s) 664
Sfr274I CTCGAG 1 cut(s) 459
SlaI CTCGAG 1 cut(s) 459
SmlI CTYRAG 1 cut(s) 459
SmoI CTYRAG 1 cut(s) 459
Sse9I AATT 6 cut(s) 210, 345, 359, 453, 498, 644
SspMI CTAG 3 cut(s) 489, 522, 724
StyD4I CCNGG 3 cut(s) 75, 573, 664
TaaI ACNGT 5 cut(s) 65, 542, 611, 688, 694
TaiI ACGT 1 cut(s) 434
TaqI TCGA 2 cut(s) 420, 460
TasI AATT 6 cut(s) 210, 345, 359, 453, 498, 644
TatI WGTACW 2 cut(s) 180, 611
TfiI GAWTC 3 cut(s) 44, 301, 701
Tru1I TTAA 3 cut(s) 261, 494, 642
Tru9I TTAA 3 cut(s) 261, 494, 642
TscAI CASTG 2 cut(s) 547, 682
TseFI GTSAC 1 cut(s) 688
TseI GCWGC 1 cut(s) 144
Tsp45I GTSAC 1 cut(s) 688
TspDTI ATGAA 6 cut(s) 352, 354, 372, 530, 563, 651
TspGWI ACGGA 2 cut(s) 465, 697
TspRI CASTG 2 cut(s) 547, 682
XapI RAATTY 2 cut(s) 345, 359
XbaI TCTAGA 1 cut(s) 488
XhoI CTCGAG 1 cut(s) 459
XspI CTAG 3 cut(s) 489, 522, 724
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.