Rmu_sc0006968.1_g000022

G-type lectin S-receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006968.1
OG0000201
Physical Location & Seq
Forward (+)
99809 .. 102039
2231 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006968.1_g000022.1.cds

Sequence Viewer

Length: 732 bp
atgttttggtcgctggcgacggtgactgcagaggtaaattcttggcttgagtctccggcggaggcaagttcttgggtcttcggccagaacggagccgggatgagaactgattttcaatttttgggtatcaagaagagatacgaaatacctttgcagaagccattttccaatttgataacagtacatttggttctccatgtttcccagaagccatatatcagccatgggggatatgaaatgggtttcttgagtagaccaaagggtgttcataggaggagtcttttggcctcaacttctggagactattgtgacaacaatgacctttgtggccccaatggaatgtgtgtcatcagcaattcaccggtttgtacttgtttaaatgggtttgaacccaaggcaccagaagaatataactctggggactattcaggtggttgtgtccaggctcaaccttccaactgccaaaataaggatgacgggtttgagatatatgctggggtcaaattgccagataccacagattctcgggctaaccagagtatgagtgtcgaggactgcagggaaaattgcttgaacaactgttcctgtgtggcttatgcaagctctaatgtcaatggctgcactatctggtttggtgatttaaacaacattaggaagctttcagatggtgggggggatctgaacgttcgaatacctgcttcagaattaagtatgtgcaacagattttcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
B_lectin DUF3403 PAN_2 Pkinase_Tyr S_locus_glycop

Protein Analysis

243

Amino Acids

26.55

Weight (kDa)

5.22

Isoelectric Point (pI)

44.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000201)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G21366
fragaria_vesca FvH4_3g15730 FvH4_3g21351 FvH4_3g21401 FvH4_3g21420
malus_domestica MD00G1151400.v1.1 MD03G1185300.v1.1 MD05G1217100.v1.1 MD05G1217400.v1.1 MD05G1220300.v1.1 MD05G1232800.v1.1 MD05G1332500.v1.1 MD05G1332800.v1.1 MD09G1059900.v1.1 MD10G1308300.v1.1 MD11G1231000.v1.1 MD12G1047500.v1.1 MD17G1273100.v1.1
prunus_persica Prupe.4G031700_v2.0.a1 Prupe.4G031700_v2.0.a1 Prupe.4G142200_v2.0.a1 Prupe.4G142700_v2.0.a1 Prupe.4G195200_v2.0.a1 Prupe.4G195600_v2.0.a1 Prupe.4G195800_v2.0.a1 Prupe.4G196000_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196200_v2.0.a1 Prupe.4G196400_v2.0.a1 Prupe.4G237800_v2.0.a1
pyrus_communis pycom03g16470 pycom03g16480 pycom03g16490 pycom03g16500 pycom03g16510 pycom05g19890 pycom05g20180 pycom05g20300 pycom05g30520 pycom09g02440 pycom11g20450
rosa_chinensis RchiOBHm_Chr1g0363501 RchiOBHm_Chr3g0477311 RchiOBHm_Chr3g0483581 RchiOBHm_Chr4g0411701 RchiOBHm_Chr5g0025991 RchiOBHm_Chr5g0026501 RchiOBHm_Chr5g0026541 RchiOBHm_Chr5g0026771 RchiOBHm_Chr5g0035631 RchiOBHm_Chr5g0035871 RchiOBHm_Chr5g0036451 RchiOBHm_Chr5g0036751 RchiOBHm_Chr5g0036771 RchiOBHm_Chr5g0036781 RchiOBHm_Chr5g0036801 RchiOBHm_Chr5g0036851
rosa_laevigata RLG00000031277 RLG00000032829 RLG00000032831 RLG00000032890 RLG00000032895 RLG00000032899 RLG00000032924 RLG00000033714 RLG00000033715 RLG00000033719 RLG00000033720 RLG00000033722 RLG00000033726
rosa_multiflora Rmu_co8109542.1_g000001 Rmu_co8147940.1_g000001 Rmu_co8162180.1_g000001 Rmu_co8193822.1_g000001 Rmu_co8362785.1_g000001 Rmu_co8410231.1_g000001 Rmu_co8422055.1_g000001 Rmu_sc0000149.1_g000048 Rmu_sc0000399.1_g000001 Rmu_sc0000555.1_g000013 Rmu_sc0000593.1_g000001 Rmu_sc0001348.1_g000035 Rmu_sc0004371.1_g000010 Rmu_sc0004371.1_g000019 Rmu_sc0005555.1_g000004 Rmu_sc0006059.1_g000074 Rmu_sc0006968.1_g000016 Rmu_sc0006968.1_g000018 Rmu_sc0006968.1_g000022 Rmu_sc0008732.1_g000004 Rmu_sc0010714.1_g000004 Rmu_sc0015364.1_g000001 Rmu_sc0015448.1_g000001 Rmu_sc0016543.1_g000005 Rmu_sc0025001.1_g000005
rosa_roxburghii Rroxscaffold_176G00431020 Rroxscaffold_1G00007210 Rroxscaffold_1G00044150 Rroxscaffold_1G00044170 Rroxscaffold_1G00044190 Rroxscaffold_1G00044220 Rroxscaffold_1G00044860 Rroxscaffold_1G00044870 Rroxscaffold_1G00052580 Rroxscaffold_1G00052940 Rroxscaffold_1G00053250 Rroxscaffold_1G00070620 Rroxscaffold_1G00070690 Rroxscaffold_1G00070720 Rroxscaffold_5G00353610 Rroxscaffold_6G00398200 Rroxscaffold_7G00204580
rosa_rugosa Rorug01G0307900 Rorug03G0207300 Rorug05G0086700 Rorug05G0156300 Rorug05G0157800 Rorug05G0157900 Rorug05G0157900 Rorug05G0157900
rosa_samantha Rh1BG280000 Rh3AG255400 Rh5AG189100 Rh5AG250500 Rh5BG252100 Rh5CG198600 Rh5CG203300 Rh5CG205400 Rh5CG206200 Rh5CG206600 Rh5CG281100 Rh5CG282300 Rh5CG283600 Rh5CG283800 Rh5CG284100 Rh5CG424200 Rh5DG181000 Rh5DG258000 Rh5DG260000 Rh5DG260400 Rh5DG260500
rosa_wichuraiana Rw1G028060 Rw3G023100 Rw5G016880 Rw5G017170 Rw5G022990 Rw5G023010 Rw5G023030 Rw5G023040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 703
AccB1I GGYRCC 1 cut(s) 397
AccI GTMKAC 1 cut(s) 253
AciI CCGC 1 cut(s) 59
AclI AACGTT 1 cut(s) 684
AclWI GGATC 1 cut(s) 684
AcoI YGGCCR 1 cut(s) 82
AcsI RAATTY 1 cut(s) 37
AcuI CTGAAG 1 cut(s) 684
AfaI GTAC 2 cut(s) 183, 370
AfiI CCNNNNNNNGG 1 cut(s) 469
AgeI ACCGGT 1 cut(s) 361
AgsI TTSAA 3 cut(s) 116, 389, 574
AjnI CCWGG 1 cut(s) 441
AloI GAACNNNNNNTCC 2 cut(s) 566, 598
AluBI AGCT 2 cut(s) 603, 658
AluI AGCT 2 cut(s) 603, 658
Alw26I GTCTC 2 cut(s) 57, 294
AlwI GGATC 1 cut(s) 684
Ama87I CYCGRG 1 cut(s) 525
AoxI GGCC 3 cut(s) 82, 285, 328
ApeKI GCWGC 1 cut(s) 618
ApoI RAATTY 1 cut(s) 37
AsiGI ACCGGT 1 cut(s) 361
AspS9I GGNCC 1 cut(s) 329
AsuC2I CCSGG 1 cut(s) 97
AsuHPI GGTGA 3 cut(s) 34, 351, 647
AsuII TTCGAA 1 cut(s) 688
AvaI CYCGRG 1 cut(s) 525
BanI GGYRCC 1 cut(s) 397
BbsI GAAGAC 1 cut(s) 70
BbvI GCAGC 1 cut(s) 605
BccI CCATC 1 cut(s) 659
BciT130I CCWGG 1 cut(s) 443
BcnI CCSGG 1 cut(s) 97
BcoDI GTCTC 2 cut(s) 57, 294
BfmI CTRYAG 2 cut(s) 27, 556
BfuAI ACCTGC 1 cut(s) 703
BisI GCNGC 1 cut(s) 619
BlsI GCNGC 1 cut(s) 620
Bme1390I CCNGG 2 cut(s) 97, 443
BmeT110I CYCGRG 1 cut(s) 525
BmgT120I GGNCC 1 cut(s) 329
BmiI GGNNCC 3 cut(s) 94, 331, 399
BmrFI CCNGG 2 cut(s) 97, 443
BpiI GAAGAC 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 318
Bpu14I TTCGAA 1 cut(s) 688
BpuEI CTTGAG 2 cut(s) 68, 268
BpuMI CCSGG 1 cut(s) 97
BsaJI CCNNGG 2 cut(s) 223, 393
BsaWI WCCGGW 1 cut(s) 361
Bsc4I CCNNNNNNNGG 1 cut(s) 469
Bse118I RCCGGY 1 cut(s) 361
BseBI CCWGG 1 cut(s) 443
BseDI CCNNGG 2 cut(s) 223, 393
BseGI GGATG 2 cut(s) 105, 478
BseLI CCNNNNNNNGG 1 cut(s) 469
BseRI GAGGAG 1 cut(s) 289
BseXI GCAGC 1 cut(s) 605
BseYI CCCAGC 1 cut(s) 494
BsgI GTGCAG 1 cut(s) 604
BshFI GGCC 3 cut(s) 84, 287, 330
BshNI GGYRCC 1 cut(s) 397
BshTI ACCGGT 1 cut(s) 361
BsiHKCI CYCGRG 1 cut(s) 525
BsiSI CCGG 3 cut(s) 56, 96, 362
BslFI GGGAC 1 cut(s) 434
BslI CCNNNNNNNGG 1 cut(s) 469
BsmAI GTCTC 2 cut(s) 57, 294
BsmFI GGGAC 1 cut(s) 434
BsnI GGCC 3 cut(s) 84, 287, 330
BsoBI CYCGRG 1 cut(s) 525
Bsp119I TTCGAA 1 cut(s) 688
Bsp143I GATC 1 cut(s) 676
Bsp19I CCATGG 1 cut(s) 223
BspACI CCGC 1 cut(s) 59
BspANI GGCC 3 cut(s) 84, 287, 330
BspLI GGNNCC 3 cut(s) 94, 331, 399
BspMAI CTGCAG 2 cut(s) 31, 560
BspMI ACCTGC 1 cut(s) 703
BspPI GGATC 1 cut(s) 684
BspT104I TTCGAA 1 cut(s) 688
BspT107I GGYRCC 1 cut(s) 397
BsrFI RCCGGY 1 cut(s) 361
BssAI RCCGGY 1 cut(s) 361
BssECI CCNNGG 2 cut(s) 223, 393
BssMI GATC 1 cut(s) 676
BssT1I CCWWGG 2 cut(s) 223, 393
Bst2UI CCWGG 1 cut(s) 443
Bst4CI ACNGT 3 cut(s) 22, 181, 581
Bst6I CTCTTC 1 cut(s) 128
BstBI TTCGAA 1 cut(s) 688
BstC8I GCNNGC 2 cut(s) 15, 601
BstDSI CCRYGG 1 cut(s) 223
BstF5I GGATG 2 cut(s) 105, 478
BstKTI GATC 1 cut(s) 679
BstMAI GTCTC 2 cut(s) 57, 294
BstMBI GATC 1 cut(s) 676
BstNI CCWGG 1 cut(s) 443
BstSCI CCNGG 2 cut(s) 95, 441
BstSFI CTRYAG 2 cut(s) 27, 556
BstV1I GCAGC 1 cut(s) 605
BstV2I GAAGAC 1 cut(s) 70
BstX2I RGATCY 1 cut(s) 676
BstYI RGATCY 1 cut(s) 676
BsuRI GGCC 3 cut(s) 84, 287, 330
BtgI CCRYGG 1 cut(s) 223
BtsCI GGATG 2 cut(s) 105, 478
BveI ACCTGC 1 cut(s) 703
Cac8I GCNNGC 2 cut(s) 15, 601
Cfr10I RCCGGY 1 cut(s) 361
Cfr13I GGNCC 1 cut(s) 329
Csp6I GTAC 2 cut(s) 182, 369
CspAI ACCGGT 1 cut(s) 361
CviAII CATG 2 cut(s) 197, 224
CviQI GTAC 2 cut(s) 182, 369
DpnI GATC 1 cut(s) 678
DpnII GATC 1 cut(s) 676
DraI TTTAAA 2 cut(s) 378, 642
EaeI YGGCCR 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
EciI GGCGGA 1 cut(s) 74
Eco130I CCWWGG 2 cut(s) 223, 393
Eco57I CTGAAG 1 cut(s) 684
Eco88I CYCGRG 1 cut(s) 525
EcoRII CCWGG 1 cut(s) 441
EcoT14I CCWWGG 2 cut(s) 223, 393
ErhI CCWWGG 2 cut(s) 223, 393
FaeI CATG 2 cut(s) 200, 227
FaqI GGGAC 1 cut(s) 434
FatI CATG 2 cut(s) 196, 223
FblI GTMKAC 1 cut(s) 253
Fnu4HI GCNGC 1 cut(s) 619
FokI GGATG 2 cut(s) 112, 485
Fsp4HI GCNGC 1 cut(s) 619
GluI GCNGC 1 cut(s) 619
GsaI CCCAGC 1 cut(s) 498
GsuI CTGGAG 1 cut(s) 318
HaeIII GGCC 3 cut(s) 84, 287, 330
HapII CCGG 3 cut(s) 56, 96, 362
Hin1II CATG 2 cut(s) 200, 227
HindIII AAGCTT 1 cut(s) 656
HinfI GANTC 3 cut(s) 50, 277, 521
HpaII CCGG 3 cut(s) 56, 96, 362
HphI GGTGA 3 cut(s) 34, 351, 647
Hpy166II GTNNAC 1 cut(s) 254
Hpy188I TCNGA 3 cut(s) 664, 681, 703
Hpy188III TCNNGA 3 cut(s) 130, 247, 297
Hpy8I GTNNAC 1 cut(s) 254
Hpy99I CGWCG 1 cut(s) 22
HpyAV CCTTC 1 cut(s) 462
HpyCH4III ACNGT 3 cut(s) 22, 181, 581
HpyCH4IV ACGT 1 cut(s) 684
HpyCH4V TGCA 6 cut(s) 29, 154, 558, 599, 621, 717
HpySE526I ACGT 1 cut(s) 684
Hsp92II CATG 2 cut(s) 200, 227
Kzo9I GATC 1 cut(s) 676
LmnI GCTCC 1 cut(s) 92
Lsp1109I GCAGC 1 cut(s) 605
MaeII ACGT 1 cut(s) 684
MaeIII GTNAC 2 cut(s) 22, 308
MalI GATC 1 cut(s) 678
MboI GATC 1 cut(s) 676
MboII GAAGA 3 cut(s) 70, 145, 416
MflI RGATCY 1 cut(s) 676
MluCI AATT 7 cut(s) 37, 116, 169, 355, 503, 565, 704
MlyI GAGTC 2 cut(s) 59, 286
MmeI TCCRAC 1 cut(s) 480
MnlI CCTC 5 cut(s) 25, 55, 267, 298, 544
MseI TTAA 3 cut(s) 377, 641, 707
MspI CCGG 3 cut(s) 56, 96, 362
MspR9I CCNGG 2 cut(s) 97, 443
MvaI CCWGG 1 cut(s) 443
NciI CCSGG 1 cut(s) 97
NcoI CCATGG 1 cut(s) 223
NdeII GATC 1 cut(s) 676
NlaIII CATG 2 cut(s) 200, 227
NlaIV GGNNCC 3 cut(s) 94, 331, 399
NmuCI GTSAC 2 cut(s) 22, 308
NspV TTCGAA 1 cut(s) 688
PfeI GAWTC 1 cut(s) 521
PinAI ACCGGT 1 cut(s) 361
PkrI GCNGC 1 cut(s) 620
PleI GAGTC 2 cut(s) 58, 285
PpsI GAGTC 2 cut(s) 58, 285
Psp1406I AACGTT 1 cut(s) 684
Psp6I CCWGG 1 cut(s) 441
PspFI CCCAGC 1 cut(s) 494
PspGI CCWGG 1 cut(s) 441
PspN4I GGNNCC 3 cut(s) 94, 331, 399
PspPI GGNCC 1 cut(s) 329
PsrI GAACNNNNNNTAC 2 cut(s) 174, 206
PstI CTGCAG 2 cut(s) 31, 560
PsuI RGATCY 1 cut(s) 676
RsaI GTAC 2 cut(s) 183, 370
RsaNI GTAC 2 cut(s) 182, 369
SaqAI TTAA 3 cut(s) 377, 641, 707
SatI GCNGC 1 cut(s) 619
Sau3AI GATC 1 cut(s) 676
Sau96I GGNCC 1 cut(s) 329
SchI GAGTC 2 cut(s) 59, 286
ScrFI CCNGG 2 cut(s) 97, 443
SetI ASST 9 cut(s) 36, 151, 324, 433, 454, 605, 660, 687, 697
SfcI CTRYAG 2 cut(s) 27, 556
SfuI TTCGAA 1 cut(s) 688
SmlI CTYRAG 2 cut(s) 47, 247
SmoI CTYRAG 2 cut(s) 47, 247
Sse9I AATT 7 cut(s) 37, 116, 169, 355, 503, 565, 704
SsiI CCGC 1 cut(s) 59
StyD4I CCNGG 2 cut(s) 95, 441
StyI CCWWGG 2 cut(s) 223, 393
TaaI ACNGT 3 cut(s) 22, 181, 581
TaiI ACGT 1 cut(s) 687
TaqI TCGA 2 cut(s) 549, 688
TasI AATT 7 cut(s) 37, 116, 169, 355, 503, 565, 704
TatI WGTACW 2 cut(s) 181, 368
TfiI GAWTC 1 cut(s) 521
Tru1I TTAA 3 cut(s) 377, 641, 707
Tru9I TTAA 3 cut(s) 377, 641, 707
TseFI GTSAC 2 cut(s) 22, 308
TseI GCWGC 1 cut(s) 618
Tsp45I GTSAC 2 cut(s) 22, 308
TspDTI ATGAA 2 cut(s) 249, 257
TspGWI ACGGA 1 cut(s) 105
XapI RAATTY 1 cut(s) 37
XmiI GTMKAC 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.