MD14G1173900.v1.1

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0000106
Physical Location & Seq
Forward (+)
26753821 .. 26758939
5119 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1173900.v1.1.491

Sequence Viewer

Length: 207 bp
ATGACCTATGTGTTCATGAAGGATGTGAAGGCTCTAGGAATCATACAAAATGCAGTCTCTAACCAGATCTTCCCTCGGATTGCCAACGCTGATTCAACTAAGATGGCATGTGATATGTTGTATAGAGAATACCATGGTGGTAATCAGGGTGGCAAAACTACCAGATCTGAAAGCACAAGTCGTGTAGCAACAAAATTGGCTCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4219 Retrotran_gag_2 gag_pre-integrs zf-CCHC

Protein Analysis

69

Amino Acids

7.54

Weight (kDa)

9.8

Isoelectric Point (pI)

37.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000106)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G20980 AT3G21000
fragaria_vesca FvH4_1g15931 FvH4_1g15931 FvH4_1g18381 FvH4_1g18382 FvH4_1g22571 FvH4_1g24950 FvH4_1g29372 FvH4_2g03582 FvH4_2g09851 FvH4_2g13112 FvH4_2g20843 FvH4_2g22701 FvH4_2g22702 FvH4_2g23403 FvH4_2g40201 FvH4_3g03542 FvH4_3g03543 FvH4_3g04761 FvH4_3g10464 FvH4_3g12741 FvH4_3g15781 FvH4_3g30981 FvH4_4g00985 FvH4_4g07035 FvH4_4g08192 FvH4_4g08211 FvH4_4g08553 FvH4_4g14242 FvH4_4g14243 FvH4_4g14641 FvH4_4g14843 FvH4_4g14844 FvH4_4g15061 FvH4_4g16281 FvH4_4g19152 FvH4_4g26451 FvH4_5g06442 FvH4_5g22521 FvH4_5g24301 FvH4_5g38641 FvH4_6g02393 FvH4_6g12782 FvH4_6g13871 FvH4_6g19391 FvH4_6g20105 FvH4_6g21292 FvH4_6g23581 FvH4_6g29153 FvH4_6g29691 FvH4_6g30871 FvH4_6g33351 FvH4_6g37042 FvH4_6g38781 FvH4_6g40340 FvH4_7g11221 FvH4_7g23352 FvH4_7g23352 FvH4_7g31212 FvH4_7g32172 FvH4_7g32173 FvH4_7g33701
malus_domestica MD03G1006900.v1.1 MD04G1039100.v1.1 MD04G1239100.v1.1 MD05G1048700.v1.1 MD08G1001800.v1.1 MD09G1165800.v1.1 MD11G1065200.v1.1 MD11G1138200.v1.1 MD14G1033300.v1.1 MD14G1173900.v1.1 MD15G1218200.v1.1 MD16G1034000.v1.1
prunus_persica Prupe.1G219500_v2.0.a1 Prupe.2G169400_v2.0.a1 Prupe.4G109700_v2.0.a1 Prupe.7G022000_v2.0.a1
pyrus_communis pycom01g02000 pycom02g13350 pycom03g01010 pycom04g05000 pycom04g06100 pycom05g05580 pycom05g09950 pycom05g13280 pycom05g26610 pycom06g05940 pycom06g07760 pycom07g06120 pycom07g24780 pycom08g08820 pycom09g03600 pycom09g07200 pycom10g01280 pycom10g06730 pycom10g08410 pycom10g25520 pycom11g00470 pycom11g05250 pycom11g25180 pycom12g08050 pycom13g14760 pycom13g28170 pycom15g14310 pycom15g19880 pycom15g24230 pycom15g33640 pycom16g02150 pycom16g16240 pycom16g20050 pycom16g21090 pycom17g06100
rosa_chinensis RchiOBHm_Chr1g0322161 RchiOBHm_Chr1g0326341 RchiOBHm_Chr1g0357701 RchiOBHm_Chr1g0379861 RchiOBHm_Chr1g0383421 RchiOBHm_Chr2g0093981 RchiOBHm_Chr2g0139051 RchiOBHm_Chr2g0145501 RchiOBHm_Chr3g0450971 RchiOBHm_Chr3g0451441 RchiOBHm_Chr3g0457411 RchiOBHm_Chr4g0436261 RchiOBHm_Chr5g0051431 RchiOBHm_Chr5g0064031 RchiOBHm_Chr5g0073141 RchiOBHm_Chr5g0080061 RchiOBHm_Chr7g0200561 RchiOBHm_Chr7g0235911
rosa_laevigata RLG00000000145 RLG00000000429 RLG00000020339 RLG00000035212
rosa_multiflora Rmu_co7977988.1_g000001 Rmu_co8037866.1_g000001 Rmu_co8243895.1_g000001 Rmu_co8363787.1_g000001 Rmu_co8381003.1_g000001 Rmu_sc0000263.1_g000006 Rmu_sc0000349.1_g000002 Rmu_sc0000455.1_g000031 Rmu_sc0000936.1_g000022 Rmu_sc0001035.1_g000023 Rmu_sc0001169.1_g000019 Rmu_sc0001250.1_g000026 Rmu_sc0002200.1_g000051 Rmu_sc0002230.1_g000027 Rmu_sc0002591.1_g000039 Rmu_sc0003182.1_g000003 Rmu_sc0003441.1_g000068 Rmu_sc0003722.1_g000018 Rmu_sc0003764.1_g000007 Rmu_sc0006014.1_g000016 Rmu_sc0012582.1_g000002 Rmu_sc0013519.1_g000002 Rmu_sc0014550.1_g000005 Rmu_sc0014857.1_g000007 Rmu_sc0019855.1_g000001 Rmu_sc0030839.1_g000001 Rmu_sc0031308.1_g000001
rosa_roxburghii Rroxscaffold_1G00011290 Rroxscaffold_1G00041340 Rroxscaffold_1G00053780 Rroxscaffold_1G00059130 Rroxscaffold_1G00061580 Rroxscaffold_2G00080940 Rroxscaffold_2G00109540 Rroxscaffold_3G00228400 Rroxscaffold_3G00237710 Rroxscaffold_4G00285210 Rroxscaffold_4G00299600 Rroxscaffold_4G00324940 Rroxscaffold_4G00330580 Rroxscaffold_5G00333000 Rroxscaffold_5G00347920 Rroxscaffold_5G00375310 Rroxscaffold_6G00394760 Rroxscaffold_6G00406260 Rroxscaffold_7G00165690 Rroxscaffold_7G00187680
rosa_rugosa Rorug01G0050200 Rorug02G0273800 Rorug06G0490600 Rorug06G0490600 Rorug06G0490700
rosa_samantha Rh1AG348400 Rh5AG222600 Rh6DG000500 Rh6DG194500 Rh7BG452700
rosa_wichuraiana Rw0G003060 Rw0G010530 Rw0G012970 Rw0G022560 Rw0G023390 Rw1G001270 Rw1G001530 Rw1G006070 Rw1G008210 Rw1G022090 Rw1G023320 Rw2G003790 Rw2G004140 Rw2G005280 Rw2G006460 Rw2G019620 Rw2G019840 Rw2G022530 Rw2G023280 Rw2G024990 Rw2G042380 Rw2G051390 Rw3G001640 Rw3G016720 Rw3G017100 Rw3G020890 Rw3G020900 Rw3G021100 Rw4G004820 Rw4G014950 Rw4G030920 Rw4G031400 Rw5G008500 Rw5G017950 Rw5G020170 Rw5G030160 Rw5G033050 Rw5G034640 Rw5G043920 Rw6G005060 Rw6G005540 Rw6G006720 Rw6G008460 Rw6G008670 Rw6G014780 Rw6G019100 Rw6G019350 Rw6G026310 Rw7G016810 Rw7G019180 Rw7G022890 Rw7G025880 Rw7G026390 Rw7G028340 Rw7G034850 Rw7G035170 Rw7G035420 Rw7G037990 Rw7G041560

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 61
BccI CCATC 1 cut(s) 97
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 1 cut(s) 35
BglII AGATCT 2 cut(s) 66, 164
BsaJI CCNNGG 2 cut(s) 74, 133
BseDI CCNNGG 2 cut(s) 74, 133
BseGI GGATG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 61
Bsp143I GATC 2 cut(s) 66, 164
Bsp19I CCATGG 1 cut(s) 133
BspHI TCATGA 1 cut(s) 15
BssECI CCNNGG 2 cut(s) 74, 133
BssMI GATC 2 cut(s) 66, 164
BssT1I CCWWGG 1 cut(s) 133
BstDEI CTNAG 1 cut(s) 99
BstDSI CCRYGG 1 cut(s) 133
BstF5I GGATG 1 cut(s) 28
BstKTI GATC 2 cut(s) 69, 167
BstMAI GTCTC 1 cut(s) 61
BstMBI GATC 2 cut(s) 66, 164
BstNSI RCATGY 1 cut(s) 111
BstX2I RGATCY 2 cut(s) 66, 164
BstYI RGATCY 2 cut(s) 66, 164
BtgI CCRYGG 1 cut(s) 133
BtsCI GGATG 1 cut(s) 28
CciI TCATGA 1 cut(s) 15
CviAII CATG 3 cut(s) 16, 108, 134
CviJI RGCY 2 cut(s) 32, 200
CviKI_1 RGCY 2 cut(s) 32, 200
DdeI CTNAG 1 cut(s) 99
DpnI GATC 2 cut(s) 68, 166
DpnII GATC 2 cut(s) 66, 164
Eco130I CCWWGG 1 cut(s) 133
EcoT14I CCWWGG 1 cut(s) 133
ErhI CCWWGG 1 cut(s) 133
FaeI CATG 3 cut(s) 19, 111, 137
FaiI YATR 7 cut(s) 9, 17, 44, 109, 116, 123, 135
FatI CATG 3 cut(s) 15, 107, 133
FokI GGATG 1 cut(s) 35
FspBI CTAG 1 cut(s) 35
Hin1II CATG 3 cut(s) 19, 111, 137
HinfI GANTC 2 cut(s) 39, 92
Hpy188I TCNGA 2 cut(s) 78, 169
Hpy188III TCNNGA 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 13, 22
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 99
Hsp92II CATG 3 cut(s) 19, 111, 137
Kzo9I GATC 2 cut(s) 66, 164
LpnPI CCDG 3 cut(s) 77, 131, 175
MaeI CTAG 1 cut(s) 35
MalI GATC 2 cut(s) 68, 166
MboI GATC 2 cut(s) 66, 164
MboII GAAGA 1 cut(s) 61
MflI RGATCY 2 cut(s) 66, 164
MluCI AATT 1 cut(s) 194
MnlI CCTC 1 cut(s) 84
NcoI CCATGG 1 cut(s) 133
NdeII GATC 2 cut(s) 66, 164
NlaIII CATG 3 cut(s) 19, 111, 137
NspI RCATGY 1 cut(s) 111
PagI TCATGA 1 cut(s) 15
PfeI GAWTC 2 cut(s) 39, 92
PsuI RGATCY 2 cut(s) 66, 164
Sau3AI GATC 2 cut(s) 66, 164
SetI ASST 1 cut(s) 8
Sse9I AATT 1 cut(s) 194
SspMI CTAG 1 cut(s) 35
StyI CCWWGG 1 cut(s) 133
TaqI TCGA 1 cut(s) 202
TasI AATT 1 cut(s) 194
TfiI GAWTC 2 cut(s) 39, 92
TspDTI ATGAA 2 cut(s) 4, 32
XceI RCATGY 1 cut(s) 111
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.