Rmu_sc0000292.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000292.1
OG0000220
Physical Location & Seq
Forward (+)
43797 .. 46609
2813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000292.1_g000005.1.cds

Sequence Viewer

Length: 1221 bp
ctggtctggaggtcggggagggcggggcggggctgttacgtcgtttgcgatcggtggttgctgcgacagtggggagcgacggtggactggaggtcaggatctatcgggaaatgcagcaagaatcgatcggtgctgcgatcggtgttaggttgcagggatctgccggaggaggatcggacagccggtctggacgatgatttgcggtgctctgggttgggtgtggagagcaattggctggccggtctgtggaagggagctgaggctgggctgtgcgcgcggagggatggccgtggaggctgctgcaaggtggtgatgcaggctgttgctgttgcaggtgtggcctgtgggctggaggccggtgaaggcgcgacctggtctgctgcaagggagatacaggccgggccggtctggactgcagagaggaggaggccggtgatagcatggataaagagaaaagattctattaagcaagaaaaggcagctgttcaagatgatattagagaagaactccgcaatgattatcttggcaatcaaacaagtctgtacaatgacgatgacgacaatgatgatgatgatgatggatttcagtatccaccagacatgcaccctgcagaacgacaagattatcatgctgtagtaagatcaaccgtagatcgtgataagaactctcagtttagtagaagtgcaagatttcaatttccaaaacaatcgagaggcgctggaagcggaacaggtggtggaggtgaaagatatgaatatggacaatcttctgtggatggaggattccaatttacatgtgaaggtaattttgatcatgtcacccaagatgaagaccacggagtgagaacagctagtcatggtgctcaagagaagacccgatatgggaggaggactagaggtgcaactgatgatcaaactactcaatctgatgtttcttcaattgccttaagttttgactctatcagtttaggcacagagcgcagtgggatctcaaatgaatctcatgaaagcaacaatcaatttggttatgatgcttatggatataatcaatacggagaagtatatgatcagtcatctagttgggttcatccttattatccccttataggggaaatagtcggcagctctaaagagatctataactatcatgttcatcactacaattcgcactatatgggtcatatgtcttgttctgattattgcattttcatagaccagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF659 Dimer_Tnp_hAT zf-BED

Protein Analysis

406

Amino Acids

45.19

Weight (kDa)

5.35

Isoelectric Point (pI)

50.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000220)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g14882 FvH4_1g25271 FvH4_2g02251 FvH4_2g02251 FvH4_2g12511 FvH4_3g12392 FvH4_4g13981 FvH4_5g27011 FvH4_5g27012 FvH4_6g04722 FvH4_6g19751 FvH4_6g31371 FvH4_6g35011 FvH4_7g02741 FvH4_7g02741 FvH4_7g11332
malus_domestica MD00G1003900.v1.1 MD00G1004000.v1.1 MD10G1094800.v1.1 MD13G1044700.v1.1 MD13G1176700.v1.1 MD15G1343300.v1.1 MD15G1444800.v1.1
prunus_persica Prupe.1G199600_v2.0.a1 Prupe.1G215800_v2.0.a1 Prupe.3G104200_v2.0.a1
pyrus_communis pycom06g06750 pycom08g00120 pycom08g00130 pycom10g02160 pycom11g16040 pycom11g16050 pycom11g17730 pycom15g19390 pycom15g25050 pycom15g25060 pycom16g24700 pycom16g24710 pycom5153684g00040
rosa_chinensis RchiOBHm_Chr1g0361971 RchiOBHm_Chr1g0383751 RchiOBHm_Chr2g0121831 RchiOBHm_Chr2g0121841 RchiOBHm_Chr2g0168971 RchiOBHm_Chr4g0384811 RchiOBHm_Chr4g0385621 RchiOBHm_Chr5g0012611 RchiOBHm_Chr6g0271241 RchiOBHm_Chr6g0289011 RchiOBHm_Chr7g0216171 RchiOBHm_Chr7g0216181 RchiOBHm_Chr7g0239421
rosa_laevigata RLG00000001765 RLG00000002860 RLG00000003609 RLG00000004743 RLG00000018385 RLG00000022782 RLG00000024093 RLG00000035412
rosa_multiflora Rmu_sc0000239.1_g000042 Rmu_sc0000292.1_g000005 Rmu_sc0000414.1_g000004 Rmu_sc0000441.1_g000099 Rmu_sc0000578.1_g000002 Rmu_sc0000666.1_g000019 Rmu_sc0000690.1_g000008 Rmu_sc0000821.1_g000011 Rmu_sc0001068.1_g000021 Rmu_sc0001696.1_g000017 Rmu_sc0001851.1_g000006 Rmu_sc0001940.1_g000018 Rmu_sc0002322.1_g000025 Rmu_sc0002343.1_g000030 Rmu_sc0002351.1_g000020 Rmu_sc0002371.1_g000025 Rmu_sc0002530.1_g000003 Rmu_sc0003206.1_g000001 Rmu_sc0003556.1_g000020 Rmu_sc0003906.1_g000002 Rmu_sc0004122.1_g000002 Rmu_sc0004283.1_g000013 Rmu_sc0004657.1_g000053 Rmu_sc0004657.1_g000054 Rmu_sc0004920.1_g000006 Rmu_sc0004990.1_g000001 Rmu_sc0005046.1_g000011 Rmu_sc0005134.1_g000006 Rmu_sc0005281.1_g000004 Rmu_sc0005704.1_g000010 Rmu_sc0005767.1_g000009 Rmu_sc0005789.1_g000031 Rmu_sc0005849.1_g000010 Rmu_sc0006736.1_g000020 Rmu_sc0006754.1_g000001 Rmu_sc0007663.1_g000010 Rmu_sc0007705.1_g000005 Rmu_sc0007883.1_g000003 Rmu_sc0007941.1_g000003 Rmu_sc0009618.1_g000009 Rmu_sc0009840.1_g000007 Rmu_sc0010800.1_g000007 Rmu_sc0011620.1_g000005 Rmu_sc0013423.1_g000002 Rmu_sc0014544.1_g000001 Rmu_sc0015323.1_g000004 Rmu_sc0023737.1_g000001 Rmu_sc0024470.1_g000005 Rmu_sc0032114.1_g000001 Rmu_ssc0000372.1_g000050 Rmu_ssc0000420.1_g000006
rosa_roxburghii Rroxscaffold_1G00014580 Rroxscaffold_1G00050290 Rroxscaffold_2G00093920 Rroxscaffold_2G00131720 Rroxscaffold_5G00351350 Rroxscaffold_5G00386210 Rroxscaffold_6G00392840 Rroxscaffold_6G00404480 Rroxscaffold_6G00405300
rosa_rugosa Rorug02G0533800 Rorug03G0200600 Rorug05G0329600 Rorug07G0139200 Rorug07G0341500 Rorug07G0341600 Rorug07G0341700 Rorug07G0341800
rosa_samantha Rh2BG114900 Rh2BG222900 Rh2DG253700 Rh3CG200000 Rh4BG186200 Rh4DG156200 Rh5AG145800 Rh5BG370600 Rh6AG123800 Rh6BG424900 Rh6DG105300 Rh7AG381900 Rh7CG288100 Rh7CG401400
rosa_wichuraiana Rw0G008270 Rw1G014540 Rw2G043790 Rw6G021690 Rw7G030100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 323
Acc36I ACCTGC 1 cut(s) 323
AccII CGCG 3 cut(s) 275, 277, 368
AciI CCGC 6 cut(s) 23, 28, 202, 277, 511, 726
AclWI GGATC 4 cut(s) 106, 165, 180, 995
AcoI YGGCCR 2 cut(s) 237, 286
AdeI CACNNNGTG 1 cut(s) 841
AfaI GTAC 1 cut(s) 545
AfiI CCNNNNNNNGG 5 cut(s) 246, 882, 1106, 1107, 1108
AflII CTTAAG 1 cut(s) 946
AflIII ACRYGT 1 cut(s) 794
AgsI TTSAA 3 cut(s) 488, 695, 939
AhdI GACNNNNNGTC 2 cut(s) 91, 183
AjnI CCWGG 1 cut(s) 371
AluBI AGCT 4 cut(s) 257, 482, 851, 1125
AluI AGCT 4 cut(s) 257, 482, 851, 1125
Alw21I GWGCWC 2 cut(s) 209, 865
AlwI GGATC 4 cut(s) 106, 165, 180, 995
AoxI GGCC 7 cut(s) 237, 286, 339, 354, 396, 401, 428
ApeKI GCWGC 8 cut(s) 61, 114, 133, 297, 300, 380, 479, 1122
Asp700I GAANNNNTTC 1 cut(s) 457
AspLEI GCGC 5 cut(s) 275, 277, 368, 719, 981
AspS9I GGNCC 1 cut(s) 401
AsuC2I CCSGG 1 cut(s) 400
AsuHPI GGTGA 5 cut(s) 322, 371, 445, 755, 811
BbsI GAAGAC 2 cut(s) 837, 878
Bbv12I GWGCWC 2 cut(s) 209, 865
BbvCI CCTCAGC 1 cut(s) 258
BbvI GCAGC 8 cut(s) 48, 120, 126, 284, 287, 367, 491, 1134
BccI CCATC 3 cut(s) 278, 572, 770
BceAI ACGGC 1 cut(s) 273
BciT130I CCWGG 1 cut(s) 373
BciVI GTATCC 1 cut(s) 600
BclI TGATCA 3 cut(s) 811, 910, 1066
BcnI CCSGG 1 cut(s) 400
BfaI CTAG 3 cut(s) 852, 894, 1077
BfmI CTRYAG 3 cut(s) 414, 609, 633
BfoI RGCGCY 1 cut(s) 720
BfrI CTTAAG 1 cut(s) 946
BfuAI ACCTGC 1 cut(s) 323
BfuI GTATCC 1 cut(s) 600
BglI GCCNNNNNGGC 1 cut(s) 294
BglII AGATCT 1 cut(s) 1134
BisI GCNGC 8 cut(s) 62, 115, 134, 298, 301, 381, 480, 1123
BlsI GCNGC 8 cut(s) 63, 116, 135, 299, 302, 382, 481, 1124
Bme1390I CCNGG 2 cut(s) 373, 400
BmeRI GACNNNNNGTC 2 cut(s) 91, 183
BmgT120I GGNCC 1 cut(s) 401
BmrFI CCNGG 2 cut(s) 373, 400
BmsI GCATC 2 cut(s) 303, 1021
BpiI GAAGAC 2 cut(s) 837, 878
BplI GAGNNNNNCTC 2 cut(s) 492, 524
BpmI CTGGAG 3 cut(s) 28, 109, 371
Bpu10I CCTNAGC 1 cut(s) 258
BpuEI CTTGAG 1 cut(s) 849
BpuMI CCSGG 1 cut(s) 400
Bsa29I ATCGAT 1 cut(s) 124
BsaJI CCNNGG 2 cut(s) 289, 835
BsaXI ACNNNNNCTCC 2 cut(s) 66, 96
Bsc4I CCNNNNNNNGG 5 cut(s) 246, 882, 1106, 1107, 1108
Bse118I RCCGGY 5 cut(s) 182, 239, 356, 403, 430
Bse1I ACTGG 2 cut(s) 92, 1216
Bse3DI GCAATG 1 cut(s) 520
BseBI CCWGG 1 cut(s) 373
BseCI ATCGAT 1 cut(s) 124
BseDI CCNNGG 2 cut(s) 289, 835
BseGI GGATG 3 cut(s) 289, 781, 1087
BseLI CCNNNNNNNGG 5 cut(s) 246, 882, 1106, 1107, 1108
BseMI GCAATG 1 cut(s) 520
BseMII CTCAG 2 cut(s) 249, 683
BseNI ACTGG 2 cut(s) 92, 1216
BsePI GCGCGC 1 cut(s) 273
BseRI GAGGAG 4 cut(s) 182, 436, 439, 901
BseXI GCAGC 8 cut(s) 48, 120, 126, 284, 287, 367, 491, 1134
BseYI CCCAGC 1 cut(s) 263
Bsh1236I CGCG 3 cut(s) 275, 277, 368
Bsh1285I CGRYCG 3 cut(s) 52, 128, 140
BshFI GGCC 7 cut(s) 239, 288, 341, 356, 398, 403, 430
BshVI ATCGAT 1 cut(s) 124
BsiEI CGRYCG 3 cut(s) 52, 128, 140
BsiHKAI GWGCWC 2 cut(s) 209, 865
BsiSI CCGG 7 cut(s) 164, 183, 240, 357, 399, 404, 431
BslI CCNNNNNNNGG 5 cut(s) 246, 882, 1106, 1107, 1108
BsnI GGCC 7 cut(s) 239, 288, 341, 356, 398, 403, 430
Bsp1286I GDGCHC 2 cut(s) 209, 865
Bsp1407I TGTACA 1 cut(s) 543
BspACI CCGC 6 cut(s) 23, 28, 202, 277, 511, 726
BspANI GGCC 7 cut(s) 239, 288, 341, 356, 398, 403, 430
BspCNI CTCAG 2 cut(s) 250, 682
BspDI ATCGAT 1 cut(s) 124
BspFNI CGCG 3 cut(s) 275, 277, 368
BspHI TCATGA 1 cut(s) 1003
BspMAI CTGCAG 2 cut(s) 418, 613
BspMI ACCTGC 1 cut(s) 323
BspPI GGATC 4 cut(s) 106, 165, 180, 995
BspTI CTTAAG 1 cut(s) 946
BsrDI GCAATG 1 cut(s) 520
BsrFI RCCGGY 5 cut(s) 182, 239, 356, 403, 430
BsrGI TGTACA 1 cut(s) 543
BsrI ACTGG 2 cut(s) 92, 1216
BssAI RCCGGY 5 cut(s) 182, 239, 356, 403, 430
BssECI CCNNGG 2 cut(s) 289, 835
BssHII GCGCGC 1 cut(s) 273
Bst2UI CCWGG 1 cut(s) 373
Bst4CI ACNGT 3 cut(s) 69, 82, 649
BstAFI CTTAAG 1 cut(s) 946
BstAUI TGTACA 1 cut(s) 543
BstC8I GCNNGC 3 cut(s) 237, 275, 318
BstDEI CTNAG 2 cut(s) 258, 669
BstDSI CCRYGG 2 cut(s) 289, 835
BstF5I GGATG 3 cut(s) 289, 781, 1087
BstFNI CGCG 3 cut(s) 275, 277, 368
BstH2I RGCGCY 1 cut(s) 720
BstHHI GCGC 5 cut(s) 275, 277, 368, 719, 981
BstMCI CGRYCG 3 cut(s) 52, 128, 140
BstMWI GCNNNNNNNGC 5 cut(s) 274, 294, 338, 723, 978
BstNI CCWGG 1 cut(s) 373
BstNSI RCATGY 2 cut(s) 604, 798
BstSCI CCNGG 2 cut(s) 371, 398
BstSFI CTRYAG 3 cut(s) 414, 609, 633
BstUI CGCG 3 cut(s) 275, 277, 368
BstV1I GCAGC 8 cut(s) 48, 120, 126, 284, 287, 367, 491, 1134
BstV2I GAAGAC 2 cut(s) 837, 878
BstX2I RGATCY 4 cut(s) 98, 157, 987, 1134
BstYI RGATCY 4 cut(s) 98, 157, 987, 1134
Bsu15I ATCGAT 1 cut(s) 124
BsuI GTATCC 1 cut(s) 600
BsuRI GGCC 7 cut(s) 239, 288, 341, 356, 398, 403, 430
BsuTUI ATCGAT 1 cut(s) 124
BtgI CCRYGG 2 cut(s) 289, 835
BtsCI GGATG 3 cut(s) 289, 781, 1087
BtsI GCAGTG 1 cut(s) 988
BtsIMutI CAGTG 2 cut(s) 74, 988
BveI ACCTGC 1 cut(s) 323
Cac8I GCNNGC 3 cut(s) 237, 275, 318
CciI TCATGA 1 cut(s) 1003
CfoI GCGC 5 cut(s) 275, 277, 368, 719, 981
Cfr10I RCCGGY 5 cut(s) 182, 239, 356, 403, 430
Cfr13I GGNCC 1 cut(s) 401
ClaI ATCGAT 1 cut(s) 124
CsiI ACCWGGT 1 cut(s) 371
Csp6I GTAC 1 cut(s) 544
CviAII CATG 8 cut(s) 441, 601, 629, 795, 815, 857, 1004, 1148
CviQI GTAC 1 cut(s) 544
DdeI CTNAG 2 cut(s) 258, 669
DraIII CACNNNGTG 1 cut(s) 841
DriI GACNNNNNGTC 2 cut(s) 91, 183
EaeI YGGCCR 2 cut(s) 237, 286
Eam1105I GACNNNNNGTC 2 cut(s) 91, 183
EcoRII CCWGG 1 cut(s) 371
FaeI CATG 8 cut(s) 444, 604, 632, 798, 818, 860, 1007, 1151
FatI CATG 8 cut(s) 440, 600, 628, 794, 814, 856, 1003, 1147
FauI CCCGC 2 cut(s) 16, 21
FauNDI CATATG 1 cut(s) 1182
FbaI TGATCA 3 cut(s) 811, 910, 1066
Fnu4HI GCNGC 8 cut(s) 62, 115, 134, 298, 301, 381, 480, 1123
FokI GGATG 3 cut(s) 296, 788, 1074
Fsp4HI GCNGC 8 cut(s) 62, 115, 134, 298, 301, 381, 480, 1123
FspBI CTAG 3 cut(s) 852, 894, 1077
GlaI GCGC 5 cut(s) 274, 276, 367, 718, 980
GluI GCNGC 8 cut(s) 62, 115, 134, 298, 301, 381, 480, 1123
GsaI CCCAGC 1 cut(s) 267
GsuI CTGGAG 3 cut(s) 28, 109, 371
HaeII RGCGCY 1 cut(s) 720
HaeIII GGCC 7 cut(s) 239, 288, 341, 356, 398, 403, 430
HapII CCGG 7 cut(s) 164, 183, 240, 357, 399, 404, 431
HhaI GCGC 5 cut(s) 275, 277, 368, 719, 981
Hin1II CATG 8 cut(s) 444, 604, 632, 798, 818, 860, 1007, 1151
Hin6I GCGC 5 cut(s) 273, 275, 366, 717, 979
HinP1I GCGC 5 cut(s) 273, 275, 366, 717, 979
HinfI GANTC 5 cut(s) 121, 458, 783, 956, 998
HpaII CCGG 7 cut(s) 164, 183, 240, 357, 399, 404, 431
HphI GGTGA 5 cut(s) 322, 371, 445, 755, 811
Hpy166II GTNNAC 1 cut(s) 85
Hpy188I TCNGA 3 cut(s) 177, 928, 1195
Hpy8I GTNNAC 1 cut(s) 85
Hpy99I CGWCG 2 cut(s) 44, 82
HpyAV CCTTC 3 cut(s) 244, 356, 794
HpyCH4III ACNGT 3 cut(s) 69, 82, 649
HpyCH4IV ACGT 1 cut(s) 39
HpyF10VI GCNNNNNNNGC 5 cut(s) 274, 294, 338, 723, 978
HpyF3I CTNAG 2 cut(s) 258, 669
HpySE526I ACGT 1 cut(s) 39
Hsp92II CATG 8 cut(s) 444, 604, 632, 798, 818, 860, 1007, 1151
HspAI GCGC 5 cut(s) 273, 275, 366, 717, 979
Ksp22I TGATCA 3 cut(s) 811, 910, 1066
LmnI GCTCC 2 cut(s) 74, 254
Lsp1109I GCAGC 8 cut(s) 48, 120, 126, 284, 287, 367, 491, 1134
LweI GCATC 2 cut(s) 303, 1021
MabI ACCWGGT 1 cut(s) 371
MaeI CTAG 3 cut(s) 852, 894, 1077
MaeII ACGT 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 35, 817
MboII GAAGA 5 cut(s) 515, 759, 842, 883, 927
MfeI CAATTG 2 cut(s) 229, 939
MflI RGATCY 4 cut(s) 98, 157, 987, 1134
MhlI GDGCHC 2 cut(s) 209, 865
MluCI AATT 7 cut(s) 229, 695, 788, 805, 939, 1019, 1162
MlyI GAGTC 1 cut(s) 950
MroXI GAANNNNTTC 1 cut(s) 457
MseI TTAA 2 cut(s) 465, 947
MspA1I CMGCKG 1 cut(s) 482
MspCI CTTAAG 1 cut(s) 946
MspI CCGG 7 cut(s) 164, 183, 240, 357, 399, 404, 431
MspR9I CCNGG 2 cut(s) 373, 400
MunI CAATTG 2 cut(s) 229, 939
MvaI CCWGG 1 cut(s) 373
MvnI CGCG 3 cut(s) 275, 277, 368
MwoI GCNNNNNNNGC 5 cut(s) 274, 294, 338, 723, 978
NciI CCSGG 1 cut(s) 400
NdeI CATATG 1 cut(s) 1182
NlaIII CATG 8 cut(s) 444, 604, 632, 798, 818, 860, 1007, 1151
NmuCI GTSAC 1 cut(s) 817
NspI RCATGY 2 cut(s) 604, 798
PagI TCATGA 1 cut(s) 1003
PaqCI CACCTGC 1 cut(s) 323
PauI GCGCGC 1 cut(s) 273
PciI ACATGT 1 cut(s) 794
PcsI WCGNNNNNNNCGW 1 cut(s) 45
PdmI GAANNNNTTC 1 cut(s) 457
PfeI GAWTC 4 cut(s) 121, 458, 783, 998
PflFI GACNNNGTC 1 cut(s) 373
PkrI GCNGC 8 cut(s) 63, 116, 135, 299, 302, 382, 481, 1124
Ple19I CGATCG 3 cut(s) 52, 128, 140
PleI GAGTC 1 cut(s) 950
PpsI GAGTC 1 cut(s) 950
PscI ACATGT 1 cut(s) 794
Psp6I CCWGG 1 cut(s) 371
PspFI CCCAGC 1 cut(s) 263
PspGI CCWGG 1 cut(s) 371
PspPI GGNCC 1 cut(s) 401
PstI CTGCAG 2 cut(s) 418, 613
PsuI RGATCY 4 cut(s) 98, 157, 987, 1134
PsyI GACNNNGTC 1 cut(s) 373
PteI GCGCGC 1 cut(s) 273
PvuI CGATCG 3 cut(s) 52, 128, 140
PvuII CAGCTG 1 cut(s) 482
RsaI GTAC 1 cut(s) 545
RsaNI GTAC 1 cut(s) 544
SaqAI TTAA 2 cut(s) 465, 947
SatI GCNGC 8 cut(s) 62, 115, 134, 298, 301, 381, 480, 1123
Sau96I GGNCC 1 cut(s) 401
SchI GAGTC 1 cut(s) 950
ScrFI CCNGG 2 cut(s) 373, 400
SduI GDGCHC 2 cut(s) 209, 865
SexAI ACCWGGT 1 cut(s) 371
SfaNI GCATC 2 cut(s) 303, 1021
SfcI CTRYAG 3 cut(s) 414, 609, 633
SmlI CTYRAG 2 cut(s) 864, 946
SmoI CTYRAG 2 cut(s) 864, 946
Sse9I AATT 7 cut(s) 229, 695, 788, 805, 939, 1019, 1162
SsiI CCGC 6 cut(s) 23, 28, 202, 277, 511, 726
SspMI CTAG 3 cut(s) 852, 894, 1077
StyD4I CCNGG 2 cut(s) 371, 398
TaaI ACNGT 3 cut(s) 69, 82, 649
TaiI ACGT 1 cut(s) 42
TaqI TCGA 2 cut(s) 124, 710
TasI AATT 7 cut(s) 229, 695, 788, 805, 939, 1019, 1162
TatI WGTACW 1 cut(s) 543
TfiI GAWTC 4 cut(s) 121, 458, 783, 998
Tru1I TTAA 2 cut(s) 465, 947
Tru9I TTAA 2 cut(s) 465, 947
TscAI CASTG 2 cut(s) 74, 988
TseFI GTSAC 1 cut(s) 817
TseI GCWGC 8 cut(s) 61, 114, 133, 297, 300, 380, 479, 1122
Tsp45I GTSAC 1 cut(s) 817
TspDTI ATGAA 7 cut(s) 768, 843, 1011, 1020, 1076, 1142, 1198
TspGWI ACGGA 2 cut(s) 852, 1068
TspRI CASTG 2 cut(s) 74, 988
Tth111I GACNNNGTC 1 cut(s) 373
Vha464I CTTAAG 1 cut(s) 946
XceI RCATGY 2 cut(s) 604, 798
XmnI GAANNNNTTC 1 cut(s) 457
XspI CTAG 3 cut(s) 852, 894, 1077
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.