Rmu_sc0000808.1_g000040

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000808.1
Physical Location & Seq
Forward (+)
172287 .. 177491
5205 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000808.1_g000040.1.cds

Sequence Viewer

Length: 4278 bp
atggcagctgaattagtgctcactttcgctgctgagggaattctgaccaaggtgtctttacttgcctctcgagaactcactctttcttgggggttcaaggccgaactgaagaagctcggagagtccttatccagcattcaagatctcttacgcggcgctgcggatcatcaggacaaggcagtagagaagtgggtcaagaaactgaaagacatagctcacgatgccgatgaagttttggatgaattcaactatgaagttctccggcgcaaagtggaactgcaaaaccacatgaagagaaaggtactcaacttcctttctgcctctaatccccttttgtttcgtctcaaaatggcgcataagattaagaagattaatgatgctttggaggagcttgggaaagaggcagatcgcatcagcttggttgaaaagaaaagccctggaggggaacagccggatcgagatcaaacggattcattttttgagaaggatgaaaaggttgttggaagggaggatgttgtgtcaaaaatagttgagagcttgaccaactccaacaatcagcaggatctttcggttatggccattgttggaatgcctggactgggaaagacgactgtggctaaatcagtgtaccatgaacctgccatagatacacacttccatcagaaaatatgggtgtgtgtatctaacatttttaaagtggatacgattttaagccagatgttagaatctctaaagggacataatgctggaatgacaaatcgagatgcattgcttaaatctcttcgagaagagctgacagggaagaaatatgttcttgtactagatgatgtttggagcgatgatagatcacaatgggaaagtttgatgagttgtctgtcaaagctgaattctaatccgggaagcagcattatcatcaccacccgcaatgctgatgtggcatctgttgctgaaacaccgagtcttactcggtgtgaattggacaaactatcaaatgatgaatgttggtccatcttgaagaaaagagcattgaatttagaggtgaatgatgtcattgatgcagatctagatagaattgggagggtgattgctgaaaagtgtggaggtgtacccttagtggcaaaggttttgggcagcataatgcgctctaaaactagtagagatgaatggttggaaattcaagaaagtgaaatatgggacttacctggagaagatgatagaatcaagtcggtattgaagttgagttttaataacttgaagtcactgcatttgaagcaatgttttgcatattgctcaatgttggagaaagattttgaagttgaaagagataatttgatccaactttggatggctcagggattgcttcagctttcaactcatgatgaaatggaggatacaggcgaaaaatattttgatgctctattaaaaaactccttatttcaagtggtaactgaaggtggcactattaccaagtacacgatgcacgatcttgtgcatgatcttgcagaagaagtatccaaaagtgacagcttgacacaaaatttgaatgatacatgccaggttcgacatgttgctgcacgtattcctccaacaacactagataacatgtcagaagtaactgttaggagattgcaatcattattttcaaatgatcaagtctcagatatcattttctccaagttcagagcattgcgcgtcttaaatttacagggggaaaatattcaagagttgccaaattcatttggcaagttgaagcacttgagatatctagacgtctcatattcaagaatcaaagcacttcccaagtcaataggcaagctgtataaccttcaaacattgagaatgcaggaaactgattgtctcaacgaggttccaagggaaatgcaaaacttgatcaacttgaggcatctttattttgacgagacaatggaatttccagccggattattgcgggaattaactaatctccgaacattgtcttactttaatgtgagtaaggagatgggtgttggagttgaggaattggttggcttgaaccacttgaaaggtgaattaatcattcgtaatctgcaaaatataagggatgaagaagaagcgaagaaggcaaaattagaggacaagaaaaatgtactggagctaagttatgtatgggtaagaagcagaagcaatccagaaggtttgaagagtaggccaagcagcaacattaatgacgagaatgtgctagaaggactcaaaccacataccaagttggagagcttgaggattgaaaacttcatgggtgataaatttccttcatggatgatgagaaaccctttgcctctcaacaatttgaagaaggtcctcctttttggctgtctcaaatgcgaagaactcccgatactaggccatctgccggatcttggacatgtcgagatttatgaaatgtataacctaaaacgcttgggaagtgaattttatggttataatcatgtttacgaggctgctgtggctacccgagagaaggtcttatttccagcactgaaaacattaagcattgaagggtgcgatgagctaactgaatggatggaagcacccacaacgatggcatcgtcaacaacaggaaaagtagtggtgttcccttgcctggagaagttggctctctggtggtgtcccttattgagagatgctccaagtcatttcccatctctcaaggagttgtcgatatggggcatggacagcgagaagccgatggcaagtatatgcaatgaagtgagcactctgacttctctccatataaataacatcaaggggcttacttcgctgtcctcggagatgttgaataagaacaagaatctcacatctttggagatcgagaattgtgatgagatcattcgtattgctccaaatgtatttggctgctgcgcaaatcttagggagctgtccattcggaattgtcaaaaactggagcagctagccgagggtctagacacgctccctcttctggagaagttgaccataagacgttgtcgtactctagagttcattccgattgaccacgacatggcatccctccgcgaattggagatagaagattgtgatggattatctagaatcggcctactcgattactgcacctctctacaggaattgaagatacggggatgtagaaatctaacatcgattccaatctcacaaggccttgaatctctccgcgaattgaagatttacagctgtgatggattatctagtattggcatactcgatcactgcacctctctacaagaattgaggataagcggatgtggaaatctaacatcgattccaatctcacaaggccttgcatctctccgcaaattggatatttacagctgtggtgggttaacgggcctaccgtgcgggattgaaaactgcacctctcttcaaaaattaatgatatccggtttctcaagtctagagaccatttcgtttacacgtgtcctcccatctctcctcaaattgcaagtttacagctgcgatgaattatcttgcttggctgtcctcgaatactgcccctcgcttcagaaattgagtgtaagcaaatgccccaagctagcatccatttcattttctccggatttgaatccatgtcttaaggagttgcgtatagatgattgcaatggtgtacaatcccttccagatttccgcagtttcacatccctccttgtattggagattggaaaatgtgcggggatacaaagtctggtttgtgggtttcatatcccggtgtctctggaggagttgcggatttctcaatgccataacctagagtgtattccaagtttagatgaatgcacatccctccgtcagttacaagtttgggattgtgagaaattgaagtctctctcaacagggctgcgctgcctcgctcgtctcgagaaattggttttaggtcctttttgggaggagctcgactccttccctgattttcaagctccatcacaacaacttgacagattagagttgagcgggtggcctaaactcaagtctcttcctcaacaagttcaacacttcacttcgctgacagacttgactataagatctttcaatggagtggaggctttaccggagtggttgggcaaccttgcatctctcaagaaactgactatttgggattgtgagaatctcaagtatctaccttcactcaaagcaatgcaacgcctcaccaaattagaggttctacgaattcgtaggtgtccacttctacaggaaagatgcaccaaggacagcggcgaagaatggcccaagatttctcacattccatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

1425

Amino Acids

160.96

Weight (kDa)

5.68

Isoelectric Point (pI)

42.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000029)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g13530 FvH4_4g18270 FvH4_6g12200 FvH4_6g12460 FvH4_6g12461 FvH4_6g13450 FvH4_6g15090 FvH4_6g15220 FvH4_6g15230 FvH4_6g15250 FvH4_6g15251 FvH4_6g15340 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47980 FvH4_6g47980 FvH4_6g47980 FvH4_6g48170 FvH4_6g48310 FvH4_6g48310 FvH4_6g48850 FvH4_6g48881 FvH4_7g11830
malus_domestica MD02G1059900.v1.1 MD02G1069600.v1.1 MD02G1069700.v1.1 MD02G1070100.v1.1 MD02G1070200.v1.1 MD02G1070300.v1.1 MD02G1070800.v1.1 MD02G1070900.v1.1 MD02G1071200.v1.1 MD02G1071400.v1.1 MD02G1071900.v1.1 MD02G1075200.v1.1 MD03G1048000.v1.1 MD03G1049100.v1.1 MD03G1049200.v1.1 MD03G1052500.v1.1 MD03G1054100.v1.1 MD03G1054300.v1.1 MD03G1054400.v1.1 MD04G1113400.v1.1 MD04G1211100.v1.1 MD04G1211200.v1.1 MD05G1174900.v1.1 MD05G1175000.v1.1 MD05G1175900.v1.1 MD05G1243400.v1.1 MD07G1031500.v1.1 MD07G1031600.v1.1 MD07G1032500.v1.1 MD11G1046800.v1.1 MD11G1046900.v1.1 MD11G1047000.v1.1 MD11G1050400.v1.1 MD11G1050600.v1.1 MD11G1050800.v1.1 MD11G1051100.v1.1 MD11G1051600.v1.1 MD11G1051700.v1.1 MD11G1054600.v1.1 MD11G1055600.v1.1 MD11G1055700.v1.1 MD11G1055800.v1.1 MD11G1056000.v1.1 MD12G1126600.v1.1 MD12G1126700.v1.1 MD12G1126800.v1.1 MD12G1127300.v1.1 MD12G1127600.v1.1 MD12G1127900.v1.1 MD12G1128100.v1.1 MD12G1128300.v1.1 MD15G1261500.v1.1
prunus_persica Prupe.1G010700_v2.0.a1 Prupe.1G010800_v2.0.a1 Prupe.1G011000_v2.0.a1 Prupe.1G159600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163800_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G235500_v2.0.a1 Prupe.2G067400_v2.0.a1 Prupe.2G067500_v2.0.a1 Prupe.2G111700_v2.0.a1 Prupe.2G111800_v2.0.a1 Prupe.3G012000_v2.0.a1 Prupe.6G243400_v2.0.a1 Prupe.6G243500_v2.0.a1 Prupe.6G243600_v2.0.a1 Prupe.6G243700_v2.0.a1 Prupe.6G243800_v2.0.a1 Prupe.6G243900_v2.0.a1
pyrus_communis pycom02g04860 pycom02g04880 pycom02g04890 pycom02g05510 pycom02g05520 pycom02g05600 pycom02g05930 pycom02g06000 pycom02g06010 pycom03g03800 pycom03g03860 pycom03g03880 pycom03g03890 pycom03g03910 pycom03g03920 pycom03g04200 pycom03g04290 pycom03g04300 pycom03g04310 pycom03g04320 pycom03g09260 pycom04g10150 pycom04g10160 pycom04g10170 pycom05g16180 pycom05g16190 pycom05g16240 pycom05g21980 pycom05g21990 pycom07g02280 pycom11g03800 pycom11g03810 pycom11g04080 pycom11g04140 pycom11g04150 pycom11g04160 pycom11g04570 pycom11g04580 pycom11g04590 pycom11g04610 pycom12g12470 pycom12g12490 pycom13g22050
rosa_chinensis RchiOBHm_Chr1g0317761 RchiOBHm_Chr1g0317821 RchiOBHm_Chr1g0317831 RchiOBHm_Chr1g0317871 RchiOBHm_Chr1g0350501 RchiOBHm_Chr2g0107631 RchiOBHm_Chr3g0452091 RchiOBHm_Chr3g0464001 RchiOBHm_Chr3g0464281 RchiOBHm_Chr3g0466331 RchiOBHm_Chr3g0467341 RchiOBHm_Chr3g0467381 RchiOBHm_Chr3g0467731 RchiOBHm_Chr3g0468291 RchiOBHm_Chr3g0468321 RchiOBHm_Chr3g0468341 RchiOBHm_Chr3g0468391 RchiOBHm_Chr3g0468411 RchiOBHm_Chr3g0468571 RchiOBHm_Chr3g0468591 RchiOBHm_Chr3g0490721 RchiOBHm_Chr3g0490751 RchiOBHm_Chr3g0490761 RchiOBHm_Chr3g0490771 RchiOBHm_Chr3g0490951 RchiOBHm_Chr3g0491001 RchiOBHm_Chr3g0491011 RchiOBHm_Chr4g0412461 RchiOBHm_Chr4g0414161 RchiOBHm_Chr4g0414181 RchiOBHm_Chr4g0414191 RchiOBHm_Chr4g0414281 RchiOBHm_Chr4g0414441 RchiOBHm_Chr4g0414521 RchiOBHm_Chr4g0414531 RchiOBHm_Chr4g0417011 RchiOBHm_Chr4g0417021 RchiOBHm_Chr4g0417041 RchiOBHm_Chr4g0417071 RchiOBHm_Chr4g0417101 RchiOBHm_Chr4g0417531 RchiOBHm_Chr4g0417641 RchiOBHm_Chr4g0417651 RchiOBHm_Chr4g0417701 RchiOBHm_Chr4g0417731 RchiOBHm_Chr4g0417741 RchiOBHm_Chr4g0417781 RchiOBHm_Chr4g0418751 RchiOBHm_Chr4g0418791 RchiOBHm_Chr4g0418861 RchiOBHm_Chr4g0418881 RchiOBHm_Chr4g0418901 RchiOBHm_Chr4g0422451 RchiOBHm_Chr4g0422461 RchiOBHm_Chr4g0422471 RchiOBHm_Chr4g0422541 RchiOBHm_Chr4g0422561 RchiOBHm_Chr4g0422591 RchiOBHm_Chr4g0422651 RchiOBHm_Chr4g0422661 RchiOBHm_Chr5g0003251 RchiOBHm_Chr5g0003261 RchiOBHm_Chr5g0055871 RchiOBHm_Chr7g0204701 RchiOBHm_Chr7g0204741
rosa_laevigata RLG00000007607 RLG00000007932 RLG00000017606 RLG00000024418 RLG00000025629 RLG00000030586
rosa_multiflora Rmu_co7959167.1_g000001 Rmu_co8021330.1_g000001 Rmu_co8132128.1_g000001 Rmu_co8224744.1_g000001 Rmu_co8281865.1_g000001 Rmu_co8298487.1_g000001 Rmu_co8319035.1_g000001 Rmu_co8380035.1_g000001 Rmu_co8385371.1_g000001 Rmu_co8398173.1_g000001 Rmu_co8423363.1_g000001 Rmu_co8438275.1_g000001 Rmu_co8474729.1_g000001 Rmu_sc0000057.1_g000008 Rmu_sc0000350.1_g000023 Rmu_sc0000480.1_g000005 Rmu_sc0000654.1_g000021 Rmu_sc0000654.1_g000029 Rmu_sc0000654.1_g000032 Rmu_sc0000654.1_g000041 Rmu_sc0000654.1_g000045 Rmu_sc0000772.1_g000002 Rmu_sc0000772.1_g000041 Rmu_sc0000808.1_g000040 Rmu_sc0000830.1_g000062 Rmu_sc0000830.1_g000065 Rmu_sc0000830.1_g000072 Rmu_sc0000830.1_g000073 Rmu_sc0000935.1_g000020 Rmu_sc0000935.1_g000024 Rmu_sc0000935.1_g000026 Rmu_sc0000935.1_g000027 Rmu_sc0000935.1_g000031 Rmu_sc0000935.1_g000033 Rmu_sc0000962.1_g000033 Rmu_sc0000962.1_g000036 Rmu_sc0000962.1_g000063 Rmu_sc0000962.1_g000064 Rmu_sc0000962.1_g000065 Rmu_sc0001029.1_g000007 Rmu_sc0001063.1_g000014 Rmu_sc0001149.1_g000010 Rmu_sc0001149.1_g000011 Rmu_sc0001358.1_g000009 Rmu_sc0001448.1_g000003 Rmu_sc0001448.1_g000004 Rmu_sc0001729.1_g000005 Rmu_sc0001729.1_g000007 Rmu_sc0001729.1_g000020 Rmu_sc0001729.1_g000023 Rmu_sc0001793.1_g000015 Rmu_sc0002494.1_g000018 Rmu_sc0002494.1_g000019 Rmu_sc0002604.1_g000022 Rmu_sc0002922.1_g000011 Rmu_sc0003008.1_g000009 Rmu_sc0003221.1_g000061 Rmu_sc0003221.1_g000062 Rmu_sc0003459.1_g000014 Rmu_sc0003480.1_g000015 Rmu_sc0003541.1_g000016 Rmu_sc0003541.1_g000020 Rmu_sc0004035.1_g000001 Rmu_sc0004035.1_g000005 Rmu_sc0004035.1_g000011 Rmu_sc0004142.1_g000004 Rmu_sc0004142.1_g000010 Rmu_sc0004353.1_g000008 Rmu_sc0004616.1_g000009 Rmu_sc0004616.1_g000010 Rmu_sc0005231.1_g000004 Rmu_sc0006380.1_g000025 Rmu_sc0006492.1_g000010 Rmu_sc0006895.1_g000001 Rmu_sc0006895.1_g000002 Rmu_sc0006895.1_g000005 Rmu_sc0007034.1_g000004 Rmu_sc0007104.1_g000006 Rmu_sc0008990.1_g000003 Rmu_sc0008990.1_g000004 Rmu_sc0009106.1_g000003 Rmu_sc0009516.1_g000002 Rmu_sc0009516.1_g000003 Rmu_sc0009516.1_g000004 Rmu_sc0009516.1_g000005 Rmu_sc0009645.1_g000001 Rmu_sc0010274.1_g000001 Rmu_sc0010274.1_g000002 Rmu_sc0010419.1_g000003 Rmu_sc0010917.1_g000017 Rmu_sc0011213.1_g000001 Rmu_sc0011228.1_g000007 Rmu_sc0011538.1_g000011 Rmu_sc0011538.1_g000014 Rmu_sc0011538.1_g000015 Rmu_sc0012211.1_g000006 Rmu_sc0012351.1_g000003 Rmu_sc0012351.1_g000005 Rmu_sc0012915.1_g000002 Rmu_sc0013088.1_g000001 Rmu_sc0013459.1_g000001 Rmu_sc0013765.1_g000004 Rmu_sc0013765.1_g000005 Rmu_sc0014003.1_g000012 Rmu_sc0014003.1_g000014 Rmu_sc0014698.1_g000001 Rmu_sc0015740.1_g000001 Rmu_sc0016429.1_g000003 Rmu_sc0018885.1_g000001 Rmu_sc0020345.1_g000001 Rmu_sc0027791.1_g000001 Rmu_sc0037325.1_g000001 Rmu_ssc0000010.1_g000024 Rmu_ssc0000010.1_g000025 Rmu_ssc0000083.1_g000021 Rmu_ssc0000340.1_g000002 Rmu_ssc0000386.1_g000002 Rmu_ssc0000386.1_g000024 Rmu_ssc0000386.1_g000025 Rmu_ssc0000386.1_g000034 Rmu_ssc0000386.1_g000037 Rmu_ssc0000477.1_g000001
rosa_roxburghii Rroxscaffold_161G00448010 Rroxscaffold_164G00436080 Rroxscaffold_1G00024500 Rroxscaffold_2G00124290 Rroxscaffold_3G00222940 Rroxscaffold_3G00227440 Rroxscaffold_4G00304810 Rroxscaffold_4G00330180 Rroxscaffold_4G00330200 Rroxscaffold_5G00356620 Rroxscaffold_5G00358170 Rroxscaffold_5G00360880 Rroxscaffold_5G00361220 Rroxscaffold_5G00361950 Rroxscaffold_5G00361960 Rroxscaffold_5G00361990 Rroxscaffold_5G00362370 Rroxscaffold_5G00364540 Rroxscaffold_5G00364550 Rroxscaffold_5G00364580 Rroxscaffold_5G00364600 Rroxscaffold_6G00393290 Rroxscaffold_6G00412680 Rroxscaffold_6G00412790 Rroxscaffold_6G00413470 Rroxscaffold_6G00413720 Rroxscaffold_6G00416070 Rroxscaffold_7G00205400
rosa_rugosa Rorug01G0017300 Rorug01G0017400 Rorug01G0018000 Rorug01G0018100 Rorug01G0211500 Rorug02G0638200 Rorug03G0070000 Rorug03G0071200 Rorug03G0081000 Rorug03G0086500 Rorug03G0089300 Rorug03G0095300 Rorug03G0096000 Rorug03G0096000 Rorug04G0055000 Rorug04G0078300 Rorug04G0104100.1 Rorug04G0113800 Rorug04G0126700 Rorug04G0128000 Rorug04G0145900 Rorug04G0148700 Rorug04G0149100 Rorug04G0149100 Rorug04G0149200 Rorug04G0149300 Rorug04G0154900 Rorug04G0180400 Rorug04G0180500 Rorug04G0180700 Rorug04G0180800 Rorug04G0401500 Rorug04G0402100 Rorug05G0288600 Rorug05G0334100 Rorug07G0176400
rosa_samantha Rh1DG043200 Rh1DG043500 Rh1DG043900 Rh1DG222800 Rh3CG039900 Rh3CG156200 Rh3CG328500 Rh3CG328800 Rh3DG165000 Rh4AG208400 Rh4BG205600 Rh4BG213900 Rh4BG243900 Rh4CG198800 Rh4DG168600 Rh4DG180100 Rh4DG180300 Rh4DG180600 Rh4DG181200 Rh4DG181600 Rh4DG181700 Rh4DG183700 Rh4DG184000 Rh4DG184400 Rh4DG184700 Rh4DG206100 Rh4DG206200 Rh4DG206300 Rh4DG215600 Rh4DG238700 Rh4DG238900 Rh5DG390300
rosa_wichuraiana Rw0G005050 Rw0G009260 Rw0G009280 Rw0G015600 Rw0G023570 Rw1G002140 Rw1G002170 Rw1G002210 Rw1G002240 Rw1G019500 Rw2G015490 Rw3G003020 Rw3G010900 Rw3G012030 Rw3G012790 Rw3G013050 Rw3G013540 Rw3G013640 Rw3G013650 Rw3G026050 Rw3G026070 Rw4G015740 Rw4G015790 Rw4G015910 Rw4G015930 Rw4G015950 Rw4G017900 Rw4G017930 Rw4G018440 Rw4G018450 Rw4G018530 Rw4G020720 Rw4G020760 Rw5G019250 Rw5G034370 Rw7G018700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 2460
AasI GACNNNNNNGTC 1 cut(s) 52
AatII GACGTC 1 cut(s) 1773
Acc16I TGCGCA 1 cut(s) 2899
Acc36I ACCTGC 1 cut(s) 646
AccB7I CCANNNNNTGG 1 cut(s) 3037
AccBSI CCGCTC 1 cut(s) 3981
AccII CGCG 4 cut(s) 153, 1692, 3051, 3189
AccIII TCCGGA 1 cut(s) 3586
AclWI GGATC 5 cut(s) 171, 462, 570, 1327, 2400
AcoI YGGCCR 1 cut(s) 576
AcuI CTGAAG 4 cut(s) 128, 1346, 1470, 3518
AcvI CACGTG 1 cut(s) 3449
AcyI GRCGYC 1 cut(s) 1770
AfaI GTAC 8 cut(s) 303, 629, 819, 1107, 1472, 2127, 3007, 3639
AflII CTTAAG 1 cut(s) 3605
AflIII ACRYGT 5 cut(s) 1564, 1602, 2401, 3446, 3448
AhlI ACTAGT 1 cut(s) 1151
AjnI CCWGG 5 cut(s) 436, 592, 1201, 1554, 2619
AjuI GAANNNNNNNTTGG 2 cut(s) 483, 515
Alw21I GWGCWC 3 cut(s) 21, 2753, 3924
AlwI GGATC 5 cut(s) 171, 462, 570, 1327, 2400
Ama87I CYCGRG 3 cut(s) 69, 2490, 3887
Aor13HI TCCGGA 1 cut(s) 3586
ArsI GACNNNNNNTTYG 2 cut(s) 1522, 1554
AseI ATTAAT 4 cut(s) 372, 2051, 2202, 3404
Asp700I GAANNNNTTC 1 cut(s) 1716
AspLEI GCGC 7 cut(s) 158, 267, 355, 1143, 1692, 2900, 3873
AspS9I GGNCC 5 cut(s) 1005, 2335, 3361, 3905, 4254
AsuC2I CCSGG 2 cut(s) 897, 3737
AsuHPI GGTGA 6 cut(s) 907, 1051, 1093, 2057, 2288, 4168
AsuNHI GCTAGC 2 cut(s) 2947, 3565
AvaI CYCGRG 3 cut(s) 69, 2490, 3887
AvaII GGWCC 3 cut(s) 1005, 2335, 3905
BalI TGGCCA 1 cut(s) 578
BanII GRGCYC 1 cut(s) 3924
BarI GAAGNNNNNNTAC 2 cut(s) 3630, 3662
BbrPI CACGTG 1 cut(s) 3449
Bbv12I GWGCWC 3 cut(s) 21, 2753, 3924
BbvCI CCTCAGC 1 cut(s) 33
BciT130I CCWGG 5 cut(s) 438, 594, 1203, 1556, 2621
BciVI GTATCC 4 cut(s) 694, 1384, 1522, 3699
BclI TGATCA 2 cut(s) 1648, 1890
BcnI CCSGG 2 cut(s) 897, 3737
BcuI ACTAGT 1 cut(s) 1151
BfmI CTRYAG 2 cut(s) 3116, 4217
BfoI RGCGCY 1 cut(s) 159
BfrI CTTAAG 1 cut(s) 3605
BfuAI ACCTGC 1 cut(s) 646
BfuI GTATCC 4 cut(s) 694, 1384, 1522, 3699
BglII AGATCT 3 cut(s) 142, 1060, 4052
Bme1390I CCNGG 7 cut(s) 438, 594, 897, 1203, 1556, 2621, 3737
Bme18I GGWCC 3 cut(s) 1005, 2335, 3905
BmeT110I CYCGRG 3 cut(s) 69, 2490, 3887
BmgT120I GGNCC 5 cut(s) 1005, 2335, 3361, 3905, 4254
BmiI GGNNCC 1 cut(s) 1869
BmrFI CCNGG 7 cut(s) 438, 594, 897, 1203, 1556, 2621, 3737
BmrI ACTGGG 1 cut(s) 608
BmtI GCTAGC 2 cut(s) 2951, 3569
BmuI ACTGGG 1 cut(s) 608
BplI GAGNNNNNCTC 6 cut(s) 949, 981, 2647, 2679, 3911, 3943
BpmI CTGGAG 7 cut(s) 459, 1224, 2150, 2642, 2960, 2999, 3767
Bpu10I CCTNAGC 2 cut(s) 33, 1350
BpuEI CTTGAG 8 cut(s) 1777, 1918, 2275, 2669, 3406, 3980, 4091, 4124
BpuMI CCSGG 2 cut(s) 897, 3737
Bsa29I ATCGAT 2 cut(s) 3155, 3293
BsaAI YACGTR 2 cut(s) 1577, 3449
BsaBI GATNNNNATC 6 cut(s) 459, 1059, 1630, 3161, 3299, 3594
BsaHI GRCGYC 1 cut(s) 1770
BsaI GGTCTC 1 cut(s) 3425
BsaJI CCNNGG 6 cut(s) 48, 436, 1871, 2802, 2952, 4233
BsaWI WCCGGW 3 cut(s) 3413, 3586, 4078
BsaXI ACNNNNNCTCC 2 cut(s) 3438, 3468
Bse1I ACTGG 3 cut(s) 603, 2133, 2943
Bse3DI GCAATG 7 cut(s) 767, 931, 1280, 1685, 2746, 3637, 4170
Bse8I GATNNNNATC 6 cut(s) 459, 1059, 1630, 3161, 3299, 3594
BseAI TCCGGA 1 cut(s) 3586
BseBI CCWGG 5 cut(s) 438, 594, 1203, 1556, 2621
BseCI ATCGAT 2 cut(s) 3155, 3293
BseDI CCNNGG 6 cut(s) 48, 436, 1871, 2802, 2952, 4233
BseJI GATNNNNATC 6 cut(s) 459, 1059, 1630, 3161, 3299, 3594
BseMI GCAATG 7 cut(s) 767, 931, 1280, 1685, 2746, 3637, 4170
BseMII CTCAG 3 cut(s) 24, 1364, 1671
BseNI ACTGG 3 cut(s) 603, 2133, 2943
BseRI GAGGAG 4 cut(s) 401, 3455, 3764, 3932
BsgI GTGCAG 4 cut(s) 1557, 3091, 3229, 3370
Bsh1236I CGCG 4 cut(s) 153, 1692, 3051, 3189
BshVI ATCGAT 2 cut(s) 3155, 3293
BsiHKAI GWGCWC 3 cut(s) 21, 2753, 3924
BsiHKCI CYCGRG 3 cut(s) 69, 2490, 3887
BsiSI CCGG 9 cut(s) 262, 452, 896, 1938, 2390, 3414, 3587, 3737, 4079
BslFI GGGAC 3 cut(s) 750, 1208, 2631
BsmBI CGTCTC 3 cut(s) 347, 1777, 3890
BsmFI GGGAC 3 cut(s) 750, 1208, 2631
BsmI GAATGC 4 cut(s) 135, 594, 1845, 3809
Bso31I GGTCTC 1 cut(s) 3425
BsoBI CYCGRG 3 cut(s) 69, 2490, 3887
Bsp1286I GDGCHC 3 cut(s) 21, 2753, 3924
Bsp13I TCCGGA 1 cut(s) 3586
Bsp1407I TGTACA 1 cut(s) 3637
BspCNI CTCAG 3 cut(s) 25, 1363, 1670
BspDI ATCGAT 2 cut(s) 3155, 3293
BspEI TCCGGA 1 cut(s) 3586
BspFNI CGCG 4 cut(s) 153, 1692, 3051, 3189
BspHI TCATGA 1 cut(s) 1375
BspLI GGNNCC 1 cut(s) 1869
BspMI ACCTGC 1 cut(s) 646
BspOI GCTAGC 2 cut(s) 2951, 3569
BspPI GGATC 5 cut(s) 171, 462, 570, 1327, 2400
BspQI GCTCTTC 1 cut(s) 783
BspTI CTTAAG 1 cut(s) 3605
BspTNI GGTCTC 1 cut(s) 3425
BsrBI CCGCTC 1 cut(s) 3981
BsrDI GCAATG 7 cut(s) 767, 931, 1280, 1685, 2746, 3637, 4170
BsrGI TGTACA 1 cut(s) 3637
BsrI ACTGG 3 cut(s) 603, 2133, 2943
BssECI CCNNGG 6 cut(s) 48, 436, 1871, 2802, 2952, 4233
BssNI GRCGYC 1 cut(s) 1770
BssT1I CCWWGG 3 cut(s) 48, 1871, 4233
Bst2UI CCWGG 5 cut(s) 438, 594, 1203, 1556, 2621
Bst4CI ACNGT 3 cut(s) 613, 1618, 3369
Bst6I CTCTTC 7 cut(s) 287, 783, 786, 2174, 2979, 3399, 4008
BstACI GRCGYC 1 cut(s) 1770
BstAFI CTTAAG 1 cut(s) 3605
BstAPI GCANNNNNTGC 1 cut(s) 944
BstAUI TGTACA 1 cut(s) 3637
BstBAI YACGTR 2 cut(s) 1577, 3449
BstC8I GCNNGC 3 cut(s) 1814, 2949, 3567
BstDEI CTNAG 6 cut(s) 33, 1111, 1350, 1657, 2135, 2906
BstFNI CGCG 4 cut(s) 153, 1692, 3051, 3189
BstH2I RGCGCY 1 cut(s) 159
BstHHI GCGC 7 cut(s) 158, 267, 355, 1143, 1692, 2900, 3873
BstNI CCWGG 5 cut(s) 438, 594, 1203, 1556, 2621
BstNSI RCATGY 4 cut(s) 1554, 1568, 1606, 2405
BstSCI CCNGG 7 cut(s) 436, 592, 895, 1201, 1554, 2619, 3735
BstSFI CTRYAG 2 cut(s) 3116, 4217
BstUI CGCG 4 cut(s) 153, 1692, 3051, 3189
BstX2I RGATCY 5 cut(s) 142, 562, 1060, 2392, 4052
BstXI CCANNNNNNTGG 1 cut(s) 2578
BstYI RGATCY 5 cut(s) 142, 562, 1060, 2392, 4052
Bsu15I ATCGAT 2 cut(s) 3155, 3293
BsuI GTATCC 4 cut(s) 694, 1384, 1522, 3699
BsuTUI ATCGAT 2 cut(s) 3155, 3293
BtgZI GCGATG 3 cut(s) 852, 2556, 3504
BtsI GCAGTG 2 cut(s) 1259, 3241
BtsIMutI CAGTG 4 cut(s) 630, 1259, 2513, 3241
BveI ACCTGC 1 cut(s) 646
Cac8I GCNNGC 3 cut(s) 1814, 2949, 3567
CciI TCATGA 1 cut(s) 1375
CfoI GCGC 7 cut(s) 158, 267, 355, 1143, 1692, 2900, 3873
Cfr13I GGNCC 5 cut(s) 1005, 2335, 3361, 3905, 4254
ClaI ATCGAT 2 cut(s) 3155, 3293
CseI GACGC 1 cut(s) 1681
Csp6I GTAC 8 cut(s) 302, 628, 818, 1106, 1471, 2126, 3006, 3638
CviQI GTAC 8 cut(s) 302, 628, 818, 1106, 1471, 2126, 3006, 3638
DdeI CTNAG 6 cut(s) 33, 1111, 1350, 1657, 2135, 2906
DraI TTTAAA 1 cut(s) 694
DrdI GACNNNNNNGTC 1 cut(s) 52
DseDI GACNNNNNNGTC 1 cut(s) 52
EaeI YGGCCR 1 cut(s) 576
Eam1104I CTCTTC 7 cut(s) 287, 783, 786, 2174, 2979, 3399, 4008
EarI CTCTTC 7 cut(s) 287, 783, 786, 2174, 2979, 3399, 4008
Ecl136II GAGCTC 1 cut(s) 3922
Eco130I CCWWGG 3 cut(s) 48, 1871, 4233
Eco147I AGGCCT 2 cut(s) 3174, 3312
Eco24I GRGCYC 1 cut(s) 3924
Eco31I GGTCTC 1 cut(s) 3425
Eco32I GATATC 3 cut(s) 1663, 1763, 3411
Eco47I GGWCC 3 cut(s) 1005, 2335, 3905
Eco53kI GAGCTC 1 cut(s) 3922
Eco57I CTGAAG 4 cut(s) 128, 1346, 1470, 3518
Eco72I CACGTG 1 cut(s) 3449
Eco88I CYCGRG 3 cut(s) 69, 2490, 3887
EcoICRI GAGCTC 1 cut(s) 3922
EcoO109I RGGNCCY 2 cut(s) 2335, 3905
EcoRI GAATTC 4 cut(s) 39, 242, 886, 4197
EcoRII CCWGG 5 cut(s) 436, 592, 1201, 1554, 2619
EcoRV GATATC 3 cut(s) 1663, 1763, 3411
EcoT14I CCWWGG 3 cut(s) 48, 1871, 4233
EcoT22I ATGCAT 1 cut(s) 769
EcoT38I GRGCYC 1 cut(s) 3924
ErhI CCWWGG 3 cut(s) 48, 1871, 4233
Esp3I CGTCTC 3 cut(s) 347, 1777, 3890
FaqI GGGAC 3 cut(s) 750, 1208, 2631
FauI CCCGC 5 cut(s) 929, 1941, 3365, 3694, 3974
FbaI TGATCA 2 cut(s) 1648, 1890
FriOI GRGCYC 1 cut(s) 3924
FspI TGCGCA 1 cut(s) 2899
GlaI GCGC 7 cut(s) 157, 266, 354, 1142, 1691, 2899, 3872
GsuI CTGGAG 7 cut(s) 459, 1224, 2150, 2642, 2960, 2999, 3767
HaeII RGCGCY 1 cut(s) 159
HapII CCGG 9 cut(s) 262, 452, 896, 1938, 2390, 3414, 3587, 3737, 4079
HgaI GACGC 1 cut(s) 1681
HhaI GCGC 7 cut(s) 158, 267, 355, 1143, 1692, 2900, 3873
Hin1I GRCGYC 1 cut(s) 1770
Hin6I GCGC 7 cut(s) 156, 265, 353, 1141, 1690, 2898, 3871
HinP1I GCGC 7 cut(s) 156, 265, 353, 1141, 1690, 2898, 3871
HincII GTYRAC 3 cut(s) 2589, 2988, 3357
HindII GTYRAC 3 cut(s) 2589, 2988, 3357
HpaI GTTAAC 1 cut(s) 3357
HpaII CCGG 9 cut(s) 262, 452, 896, 1938, 2390, 3414, 3587, 3737, 4079
HphI GGTGA 6 cut(s) 907, 1051, 1093, 2057, 2288, 4168
HpyCH4III ACNGT 3 cut(s) 613, 1618, 3369
HpyCH4IV ACGT 4 cut(s) 1576, 1770, 2998, 3448
HpyF3I CTNAG 6 cut(s) 33, 1111, 1350, 1657, 2135, 2906
HpySE526I ACGT 4 cut(s) 1576, 1770, 2998, 3448
Hsp92I GRCGYC 1 cut(s) 1770
HspAI GCGC 7 cut(s) 156, 265, 353, 1141, 1690, 2898, 3871
Kpn2I TCCGGA 1 cut(s) 3586
Ksp22I TGATCA 2 cut(s) 1648, 1890
KspAI GTTAAC 1 cut(s) 3357
LguI GCTCTTC 1 cut(s) 783
MaeII ACGT 4 cut(s) 1576, 1770, 2998, 3448
MaeIII GTNAC 5 cut(s) 1257, 1444, 1520, 1612, 3822
MbiI CCGCTC 1 cut(s) 3981
MflI RGATCY 5 cut(s) 142, 562, 1060, 2392, 4052
MhlI GDGCHC 3 cut(s) 21, 2753, 3924
MlsI TGGCCA 1 cut(s) 578
MluNI TGGCCA 1 cut(s) 578
MlyI GAGTC 4 cut(s) 131, 967, 2220, 3920
MmeI TCCRAC 9 cut(s) 481, 565, 573, 1149, 1278, 1360, 1610, 1987, 2226
Mox20I TGGCCA 1 cut(s) 578
Mph1103I ATGCAT 1 cut(s) 769
MroI TCCGGA 1 cut(s) 3586
MroXI GAANNNNTTC 1 cut(s) 1716
MscI TGGCCA 1 cut(s) 578
MslI CAYNNNNRTG 1 cut(s) 2576
Msp20I TGGCCA 1 cut(s) 578
MspA1I CMGCKG 5 cut(s) 8, 3207, 3345, 3486, 4242
MspCI CTTAAG 1 cut(s) 3605
MspI CCGG 9 cut(s) 262, 452, 896, 1938, 2390, 3414, 3587, 3737, 4079
MspR9I CCNGG 7 cut(s) 438, 594, 897, 1203, 1556, 2621, 3737
Mva1269I GAATGC 4 cut(s) 135, 594, 1845, 3809
MvaI CCWGG 5 cut(s) 438, 594, 1203, 1556, 2621
MvnI CGCG 4 cut(s) 153, 1692, 3051, 3189
NciI CCSGG 2 cut(s) 897, 3737
NheI GCTAGC 2 cut(s) 2947, 3565
NlaIV GGNNCC 1 cut(s) 1869
NmeAIII GCCGAG 1 cut(s) 2977
NmuCI GTSAC 2 cut(s) 1257, 1520
NsbI TGCGCA 1 cut(s) 2899
NsiI ATGCAT 1 cut(s) 769
NspI RCATGY 4 cut(s) 1554, 1568, 1606, 2405
PaeR7I CTCGAG 2 cut(s) 69, 3887
PagI TCATGA 1 cut(s) 1375
PceI AGGCCT 2 cut(s) 3174, 3312
PciI ACATGT 3 cut(s) 1564, 1602, 2401
PciSI GCTCTTC 1 cut(s) 783
PcsI WCGNNNNNNNCGW 4 cut(s) 2582, 3096, 3365, 3885
PctI GAATGC 4 cut(s) 135, 594, 1845, 3809
PdmI GAANNNNTTC 1 cut(s) 1716
PflFI GACNNNGTC 1 cut(s) 3000
PflMI CCANNNNNTGG 1 cut(s) 3037
PfoI TCCNGGA 1 cut(s) 895
PleI GAGTC 4 cut(s) 130, 966, 2220, 3920
PmaCI CACGTG 1 cut(s) 3449
PmlI CACGTG 1 cut(s) 3449
PpsI GAGTC 4 cut(s) 130, 966, 2220, 3920
Ppu21I YACGTR 2 cut(s) 1577, 3449
PpuMI RGGWCCY 2 cut(s) 2335, 3905
PscI ACATGT 3 cut(s) 1564, 1602, 2401
PshBI ATTAAT 4 cut(s) 372, 2051, 2202, 3404
PsiI TTATAA 1 cut(s) 2460
Psp124BI GAGCTC 1 cut(s) 3924
Psp5II RGGWCCY 2 cut(s) 2335, 3905
Psp6I CCWGG 5 cut(s) 436, 592, 1201, 1554, 2619
PspCI CACGTG 1 cut(s) 3449
PspGI CCWGG 5 cut(s) 436, 592, 1201, 1554, 2619
PspN4I GGNNCC 1 cut(s) 1869
PspPI GGNCC 5 cut(s) 1005, 2335, 3361, 3905, 4254
PspPPI RGGWCCY 2 cut(s) 2335, 3905
PsrI GAACNNNNNNTAC 2 cut(s) 2358, 2390
PsuI RGATCY 5 cut(s) 142, 562, 1060, 2392, 4052
PsyI GACNNNGTC 1 cut(s) 3000
PvuII CAGCTG 4 cut(s) 8, 3207, 3345, 3486
RsaI GTAC 8 cut(s) 303, 629, 819, 1107, 1472, 2127, 3007, 3639
RsaNI GTAC 8 cut(s) 302, 628, 818, 1106, 1471, 2126, 3006, 3638
RseI CAYNNNNRTG 1 cut(s) 2576
SacI GAGCTC 1 cut(s) 3924
SapI GCTCTTC 1 cut(s) 783
Sau96I GGNCC 5 cut(s) 1005, 2335, 3361, 3905, 4254
SchI GAGTC 4 cut(s) 131, 967, 2220, 3920
ScrFI CCNGG 7 cut(s) 438, 594, 897, 1203, 1556, 2621, 3737
SduI GDGCHC 3 cut(s) 21, 2753, 3924
SfcI CTRYAG 2 cut(s) 3116, 4217
Sfr274I CTCGAG 2 cut(s) 69, 3887
SinI GGWCC 3 cut(s) 1005, 2335, 3905
SlaI CTCGAG 2 cut(s) 69, 3887
SmiMI CAYNNNNRTG 1 cut(s) 2576
SpeI ACTAGT 1 cut(s) 1151
SseBI AGGCCT 2 cut(s) 3174, 3312
SspI AATATT 2 cut(s) 1406, 1717
SstI GAGCTC 1 cut(s) 3924
StuI AGGCCT 2 cut(s) 3174, 3312
StyD4I CCNGG 7 cut(s) 436, 592, 895, 1201, 1554, 2619, 3735
StyI CCWWGG 3 cut(s) 48, 1871, 4233
TaaI ACNGT 3 cut(s) 613, 1618, 3369
TaiI ACGT 4 cut(s) 1579, 1773, 3001, 3451
TatI WGTACW 4 cut(s) 817, 1470, 2125, 3637
TauI GCSGC 2 cut(s) 156, 4245
TscAI CASTG 4 cut(s) 630, 1266, 2520, 3248
TseFI GTSAC 2 cut(s) 1257, 1520
Tsp45I GTSAC 2 cut(s) 1257, 1520
TspGWI ACGGA 2 cut(s) 482, 3806
TspRI CASTG 4 cut(s) 630, 1266, 2520, 3248
Tth111I GACNNNGTC 1 cut(s) 3000
Van91I CCANNNNNTGG 1 cut(s) 3037
Vha464I CTTAAG 1 cut(s) 3605
VpaK11BI GGWCC 3 cut(s) 1005, 2335, 3905
VspI ATTAAT 4 cut(s) 372, 2051, 2202, 3404
XbaI TCTAGA 6 cut(s) 1063, 1765, 2959, 3010, 3083, 3427
XceI RCATGY 4 cut(s) 1554, 1568, 1606, 2405
XhoI CTCGAG 2 cut(s) 69, 3887
XmnI GAANNNNTTC 1 cut(s) 1716
ZraI GACGTC 1 cut(s) 1771
Zsp2I ATGCAT 1 cut(s) 769
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.