Rmu_sc0005231.1_g000004

Belongs to the disease resistance NB-LRR family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005231.1
Physical Location & Seq
Forward (+)
16700 .. 25446
8747 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005231.1_g000004.1.cds

Sequence Viewer

Length: 4920 bp
atggcattggagattggatcctctctccttctatccgctgccagaggagcagtgggtaatgttgcttcactcgctactgatcaattgaacctcaaaatcgtcttcggtttcgacaaagaactagatcagctcataaaatcctcaactctgattgaagatttgatacatgatgctgcgctagaacccgaagatcaggaacggcgggctatggctaactggaggaagaggcttatgaccgtagcttatgctgcagaagatgtcgtggatgaagttcaatatgaagctgttcggatcaatatagaggggacaatcctcgataagtgcatacgcagaatcttggttcgtcttcagatggcaggcaagattgacaaaatcaataaatccgtggagcatctctacaaacaagcagccggtgtgggactgacaaggagatcaaagggaggtgaagcgtccagtcaaagtctgcaggacagggaaacaacctcattgcttgagaaacatgaattcacctccagagatgcagggatttttggaagggaaaaggctatgtcagatataactgcaaccttgaacgaccccaacaatcaagaaacgatgcttttggtgatggccgttgtaggatcggcaggcgtgggtaaaacaactttggctcgcttacttaccgagcaactgatgaaagaaggtgaaatgacaaagccctttgatgtaactctttgggtgtacgtatctcaaacttttgatgtcaattcaattttaagtcgaatggtcgaatcatgtaaggcgacgacagcaaaccataaaagtcgggaagcattgattcaaagcctccgtgagaagttggaaaataaaaggtattttcttgtacttgatgatgtttggaatgaggatgatataatttgggagggtttgaagagttgtctgcggcaactcgaatctgccaaaggaagcactgtgattgtcactacccgtagtgccagggttgcagaaatcatgcgaacacttcctaataattgcgatttagggattctatcggatgatgaatgttggtccataataaaggatagagcatttaatattcctcatccttcgatagattcagaacaagagcgaatcggaagggagattgccaaaaagtgtgctggtcttccattggtggcaaagattttgggaagcttgatgcattctaagaatagtagtcacatgtggttgtcaattctgcaaagtcctgcatggcagaatagcataatcatgtcgactctgatgttgagttttgacgatttggagccactactgaaaccatgttttgcatattgctcaatgctcgatagaggttccttaattaaaagagatgagttgatccaactatggatggctcaaggttttctcaatccttctcatccttgccaaagaacgcaaaagagggagatggagatggaggatataggcaatgagtattttgatactctactggaaaagtccttgtttcaagatgctacaaaggatgaagatggcgtcatcaccgaatgcaggatgcacgatcttgtgcatgaatttgcaatagaagcatccaagtatgagagctggaaaccaaactttaataagaagatggatcatagtgagattcgacatgctgcccagattcctactccagaactagaaagtatgccagaaacaagtattgcaagactgcgttcactcttttcaaatgtccaggtctctaatattattttcccaaagttaagagctttacgtgtcttaagtttctataaggctgcgactagtgtgactcgagagttgccaaattcacttgacaagctgaagcacttgaggtatctagatctttcccgtacaacaattagagaactcccaaagtctattggcaagctctacaacctccaaacattgagattaccatatcttgataagtgtccgaaggagattcaaaatttgatcaacttaaggcatgtttatgttgatgaaagagagaaacttgaggctgctttttatgttgttgttgttgagagaatgaaatttgaggctgggattttggggcgattaactaatctccgaacattacggtacttcaacgtgggtaaggagataggtcctgcaattgaggagttgggtgggttgaaccaattgagaggccacttaattattgatgggctagaacatgtaagggatggagaagaagcaaagaatgctcgcttagtgcagaagagtcacttacatgagctgacatttgaatggacacacggcggggtagctaatgaaaatcaaactgatgtactagatggcttgaaacctcatggtgagctgcgaaggttaaacattgaatatttcatgggtgctagatttccgtcatggatggagagtctccaaaatttgaaggagattcgattagttggctgcatcaattgtgaagaagtgccgacactcggccatctacctaatctaagatttcttcagattgatggtatgcacaagctgaaacgtgtgggagctgagttttatggtactgttactggtacaactttatttccagcgctgaaaacattagacatctctgagtgtgaagagctcgttgaatggatggaagcagcagctgaagaagaagaagaagtcgtggtatttccttgcctcgaagagttaaatttgagactctgtcccaatttgggaaatgctccgagtcgttttccatgtcttaagacgttgagcatagttaatacgggcaacaaggtgacaatagaaaatgtaagcagtcaacttaccactctcactcgtcttgatatatatggtgtgaagggactcacttgcctaccggaagggatgttgaagaagaacaagtgtctcacgtatctgaggatacgtaattgtgatgagttgacttgtattgctcctcatgtatttggctgttgcgaatctcttcgatcacttgttgttatgcactgtaaaagactaagtcatttacctgatgggctagacaaactccctcttcttgagcgcttgttcatagatgattgtcgcagcctcaagtcgattcggatcacacggggcatcgcatctctacgtgaattgaacatccagagttgtgagggattatcaagcctagaggttgggctccagtactgcacctctcttcaggaattgaaccaattgaagattgttggttgtcagagattattaagcctaccgagtgggctccaattctgcacctctcttcagcatctggatgtacgcgagtgctctagtctagtatcgatttcagtatcctatcatgtgtgcgaccacccagactcaacgaatcaaccggagggagtctttagaggtcttgttcaatatttgtctatacaggaggactgccctattccagctcatctccgtcagtcgctgatatgtgattgttgtgggaaattgaaatatgggcccacaggatttcaccgcctcactcgtttgaagtggctggaaatcggtaagttttgggaggggctggacgccttccctgattttcagcttccaccaccaccacatgattcaaaatttgaagagttacatttgtggggtgtgctcgactactgcacctctcttcaggaattggagatcgaggtttgtgataatctaacatcaattccaatcacagagggcatcacatctctccagaggttgaagattgttggttgtcagagattattaagcctaccgagtgggctccaattctgcacctctcttcagcatctggatgtacgcgagtgctctagtctagtatcgatttcagtatcctatcatgtgtgcgaccacccagactcaacgaatcaaccggagggagtctttagaggtcttgttcaatatttgtctatacaggaggactgccctattccagctcatctccgtcagtcgctgatatgtgattgttgtgggaaattgaaatatgggcccacaggatttcaccgcctcactcgtttgaagtggctggaaatcggtaagttttgggaggggctggacgccttccctgattttcagcttccaccaccaccacatgattcaaaatttgaagagttacatttgtggggttggcctaagctcaagtctctgccccaacaaattcagcactacactagtttaaaaactctctggatacttggtttcgggggaatagaggctcttcctgagtggttgggaaatcttacatctcttgagactctgactatctggttctgtggaaatctcaagtctctgcctacacaagatgctatgaaaaacctcaccaaattgaagaagctcaccattaatgcatgccccctgctccaggaaagatgcaccaaggagactggccccgaatggcacaagatttctcacatcccaaaaattgagcgtggggaaagctccgaaagtactggcaattcaacatcttctccaagaaatgctgggaatttaacatcttttccaagaaatgctgtgtttgattttgtgcgtgattacttccattcatgttctatgtgcaaccagtttttaaaatcattgctctatcctactcaaatggaagaacaacttaactggacccagcatggtgcgaactcagttcagattttgtccccagtatcaaggaattggagcacccaaatgtgctcttgcgaaggctggtatgacatcagttgtggtttcacgattgtggatccagatgaagttccatctacggaggcacaagcagcatctaagcaagcgcagaggcacgccccgtggcgaaggcaaagtcagagcaagtttattagggtgggtgggaacaagaagccacccgcgggagaacaagacagaaagacagacggggcggagaaagcagtaaggcagaaggacaagaaaaggacggtcaaacaggccgaaaaggcaggaaagaaaatagaagtttggggccttatccgatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

1639

Amino Acids

185.43

Weight (kDa)

6.39

Isoelectric Point (pI)

50.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000029)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g13530 FvH4_4g18270 FvH4_6g12200 FvH4_6g12460 FvH4_6g12461 FvH4_6g13450 FvH4_6g15090 FvH4_6g15220 FvH4_6g15230 FvH4_6g15250 FvH4_6g15251 FvH4_6g15340 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47980 FvH4_6g47980 FvH4_6g47980 FvH4_6g48170 FvH4_6g48310 FvH4_6g48310 FvH4_6g48850 FvH4_6g48881 FvH4_7g11830
malus_domestica MD02G1059900.v1.1 MD02G1069600.v1.1 MD02G1069700.v1.1 MD02G1070100.v1.1 MD02G1070200.v1.1 MD02G1070300.v1.1 MD02G1070800.v1.1 MD02G1070900.v1.1 MD02G1071200.v1.1 MD02G1071400.v1.1 MD02G1071900.v1.1 MD02G1075200.v1.1 MD03G1048000.v1.1 MD03G1049100.v1.1 MD03G1049200.v1.1 MD03G1052500.v1.1 MD03G1054100.v1.1 MD03G1054300.v1.1 MD03G1054400.v1.1 MD04G1113400.v1.1 MD04G1211100.v1.1 MD04G1211200.v1.1 MD05G1174900.v1.1 MD05G1175000.v1.1 MD05G1175900.v1.1 MD05G1243400.v1.1 MD07G1031500.v1.1 MD07G1031600.v1.1 MD07G1032500.v1.1 MD11G1046800.v1.1 MD11G1046900.v1.1 MD11G1047000.v1.1 MD11G1050400.v1.1 MD11G1050600.v1.1 MD11G1050800.v1.1 MD11G1051100.v1.1 MD11G1051600.v1.1 MD11G1051700.v1.1 MD11G1054600.v1.1 MD11G1055600.v1.1 MD11G1055700.v1.1 MD11G1055800.v1.1 MD11G1056000.v1.1 MD12G1126600.v1.1 MD12G1126700.v1.1 MD12G1126800.v1.1 MD12G1127300.v1.1 MD12G1127600.v1.1 MD12G1127900.v1.1 MD12G1128100.v1.1 MD12G1128300.v1.1 MD15G1261500.v1.1
prunus_persica Prupe.1G010700_v2.0.a1 Prupe.1G010800_v2.0.a1 Prupe.1G011000_v2.0.a1 Prupe.1G159600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163800_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G235500_v2.0.a1 Prupe.2G067400_v2.0.a1 Prupe.2G067500_v2.0.a1 Prupe.2G111700_v2.0.a1 Prupe.2G111800_v2.0.a1 Prupe.3G012000_v2.0.a1 Prupe.6G243400_v2.0.a1 Prupe.6G243500_v2.0.a1 Prupe.6G243600_v2.0.a1 Prupe.6G243700_v2.0.a1 Prupe.6G243800_v2.0.a1 Prupe.6G243900_v2.0.a1
pyrus_communis pycom02g04860 pycom02g04880 pycom02g04890 pycom02g05510 pycom02g05520 pycom02g05600 pycom02g05930 pycom02g06000 pycom02g06010 pycom03g03800 pycom03g03860 pycom03g03880 pycom03g03890 pycom03g03910 pycom03g03920 pycom03g04200 pycom03g04290 pycom03g04300 pycom03g04310 pycom03g04320 pycom03g09260 pycom04g10150 pycom04g10160 pycom04g10170 pycom05g16180 pycom05g16190 pycom05g16240 pycom05g21980 pycom05g21990 pycom07g02280 pycom11g03800 pycom11g03810 pycom11g04080 pycom11g04140 pycom11g04150 pycom11g04160 pycom11g04570 pycom11g04580 pycom11g04590 pycom11g04610 pycom12g12470 pycom12g12490 pycom13g22050
rosa_chinensis RchiOBHm_Chr1g0317761 RchiOBHm_Chr1g0317821 RchiOBHm_Chr1g0317831 RchiOBHm_Chr1g0317871 RchiOBHm_Chr1g0350501 RchiOBHm_Chr2g0107631 RchiOBHm_Chr3g0452091 RchiOBHm_Chr3g0464001 RchiOBHm_Chr3g0464281 RchiOBHm_Chr3g0466331 RchiOBHm_Chr3g0467341 RchiOBHm_Chr3g0467381 RchiOBHm_Chr3g0467731 RchiOBHm_Chr3g0468291 RchiOBHm_Chr3g0468321 RchiOBHm_Chr3g0468341 RchiOBHm_Chr3g0468391 RchiOBHm_Chr3g0468411 RchiOBHm_Chr3g0468571 RchiOBHm_Chr3g0468591 RchiOBHm_Chr3g0490721 RchiOBHm_Chr3g0490751 RchiOBHm_Chr3g0490761 RchiOBHm_Chr3g0490771 RchiOBHm_Chr3g0490951 RchiOBHm_Chr3g0491001 RchiOBHm_Chr3g0491011 RchiOBHm_Chr4g0412461 RchiOBHm_Chr4g0414161 RchiOBHm_Chr4g0414181 RchiOBHm_Chr4g0414191 RchiOBHm_Chr4g0414281 RchiOBHm_Chr4g0414441 RchiOBHm_Chr4g0414521 RchiOBHm_Chr4g0414531 RchiOBHm_Chr4g0417011 RchiOBHm_Chr4g0417021 RchiOBHm_Chr4g0417041 RchiOBHm_Chr4g0417071 RchiOBHm_Chr4g0417101 RchiOBHm_Chr4g0417531 RchiOBHm_Chr4g0417641 RchiOBHm_Chr4g0417651 RchiOBHm_Chr4g0417701 RchiOBHm_Chr4g0417731 RchiOBHm_Chr4g0417741 RchiOBHm_Chr4g0417781 RchiOBHm_Chr4g0418751 RchiOBHm_Chr4g0418791 RchiOBHm_Chr4g0418861 RchiOBHm_Chr4g0418881 RchiOBHm_Chr4g0418901 RchiOBHm_Chr4g0422451 RchiOBHm_Chr4g0422461 RchiOBHm_Chr4g0422471 RchiOBHm_Chr4g0422541 RchiOBHm_Chr4g0422561 RchiOBHm_Chr4g0422591 RchiOBHm_Chr4g0422651 RchiOBHm_Chr4g0422661 RchiOBHm_Chr5g0003251 RchiOBHm_Chr5g0003261 RchiOBHm_Chr5g0055871 RchiOBHm_Chr7g0204701 RchiOBHm_Chr7g0204741
rosa_laevigata RLG00000007607 RLG00000007932 RLG00000017606 RLG00000024418 RLG00000025629 RLG00000030586
rosa_multiflora Rmu_co7959167.1_g000001 Rmu_co8021330.1_g000001 Rmu_co8132128.1_g000001 Rmu_co8224744.1_g000001 Rmu_co8281865.1_g000001 Rmu_co8298487.1_g000001 Rmu_co8319035.1_g000001 Rmu_co8380035.1_g000001 Rmu_co8385371.1_g000001 Rmu_co8398173.1_g000001 Rmu_co8423363.1_g000001 Rmu_co8438275.1_g000001 Rmu_co8474729.1_g000001 Rmu_sc0000057.1_g000008 Rmu_sc0000350.1_g000023 Rmu_sc0000480.1_g000005 Rmu_sc0000654.1_g000021 Rmu_sc0000654.1_g000029 Rmu_sc0000654.1_g000032 Rmu_sc0000654.1_g000041 Rmu_sc0000654.1_g000045 Rmu_sc0000772.1_g000002 Rmu_sc0000772.1_g000041 Rmu_sc0000808.1_g000040 Rmu_sc0000830.1_g000062 Rmu_sc0000830.1_g000065 Rmu_sc0000830.1_g000072 Rmu_sc0000830.1_g000073 Rmu_sc0000935.1_g000020 Rmu_sc0000935.1_g000024 Rmu_sc0000935.1_g000026 Rmu_sc0000935.1_g000027 Rmu_sc0000935.1_g000031 Rmu_sc0000935.1_g000033 Rmu_sc0000962.1_g000033 Rmu_sc0000962.1_g000036 Rmu_sc0000962.1_g000063 Rmu_sc0000962.1_g000064 Rmu_sc0000962.1_g000065 Rmu_sc0001029.1_g000007 Rmu_sc0001063.1_g000014 Rmu_sc0001149.1_g000010 Rmu_sc0001149.1_g000011 Rmu_sc0001358.1_g000009 Rmu_sc0001448.1_g000003 Rmu_sc0001448.1_g000004 Rmu_sc0001729.1_g000005 Rmu_sc0001729.1_g000007 Rmu_sc0001729.1_g000020 Rmu_sc0001729.1_g000023 Rmu_sc0001793.1_g000015 Rmu_sc0002494.1_g000018 Rmu_sc0002494.1_g000019 Rmu_sc0002604.1_g000022 Rmu_sc0002922.1_g000011 Rmu_sc0003008.1_g000009 Rmu_sc0003221.1_g000061 Rmu_sc0003221.1_g000062 Rmu_sc0003459.1_g000014 Rmu_sc0003480.1_g000015 Rmu_sc0003541.1_g000016 Rmu_sc0003541.1_g000020 Rmu_sc0004035.1_g000001 Rmu_sc0004035.1_g000005 Rmu_sc0004035.1_g000011 Rmu_sc0004142.1_g000004 Rmu_sc0004142.1_g000010 Rmu_sc0004353.1_g000008 Rmu_sc0004616.1_g000009 Rmu_sc0004616.1_g000010 Rmu_sc0005231.1_g000004 Rmu_sc0006380.1_g000025 Rmu_sc0006492.1_g000010 Rmu_sc0006895.1_g000001 Rmu_sc0006895.1_g000002 Rmu_sc0006895.1_g000005 Rmu_sc0007034.1_g000004 Rmu_sc0007104.1_g000006 Rmu_sc0008990.1_g000003 Rmu_sc0008990.1_g000004 Rmu_sc0009106.1_g000003 Rmu_sc0009516.1_g000002 Rmu_sc0009516.1_g000003 Rmu_sc0009516.1_g000004 Rmu_sc0009516.1_g000005 Rmu_sc0009645.1_g000001 Rmu_sc0010274.1_g000001 Rmu_sc0010274.1_g000002 Rmu_sc0010419.1_g000003 Rmu_sc0010917.1_g000017 Rmu_sc0011213.1_g000001 Rmu_sc0011228.1_g000007 Rmu_sc0011538.1_g000011 Rmu_sc0011538.1_g000014 Rmu_sc0011538.1_g000015 Rmu_sc0012211.1_g000006 Rmu_sc0012351.1_g000003 Rmu_sc0012351.1_g000005 Rmu_sc0012915.1_g000002 Rmu_sc0013088.1_g000001 Rmu_sc0013459.1_g000001 Rmu_sc0013765.1_g000004 Rmu_sc0013765.1_g000005 Rmu_sc0014003.1_g000012 Rmu_sc0014003.1_g000014 Rmu_sc0014698.1_g000001 Rmu_sc0015740.1_g000001 Rmu_sc0016429.1_g000003 Rmu_sc0018885.1_g000001 Rmu_sc0020345.1_g000001 Rmu_sc0027791.1_g000001 Rmu_sc0037325.1_g000001 Rmu_ssc0000010.1_g000024 Rmu_ssc0000010.1_g000025 Rmu_ssc0000083.1_g000021 Rmu_ssc0000340.1_g000002 Rmu_ssc0000386.1_g000002 Rmu_ssc0000386.1_g000024 Rmu_ssc0000386.1_g000025 Rmu_ssc0000386.1_g000034 Rmu_ssc0000386.1_g000037 Rmu_ssc0000477.1_g000001
rosa_roxburghii Rroxscaffold_161G00448010 Rroxscaffold_164G00436080 Rroxscaffold_1G00024500 Rroxscaffold_2G00124290 Rroxscaffold_3G00222940 Rroxscaffold_3G00227440 Rroxscaffold_4G00304810 Rroxscaffold_4G00330180 Rroxscaffold_4G00330200 Rroxscaffold_5G00356620 Rroxscaffold_5G00358170 Rroxscaffold_5G00360880 Rroxscaffold_5G00361220 Rroxscaffold_5G00361950 Rroxscaffold_5G00361960 Rroxscaffold_5G00361990 Rroxscaffold_5G00362370 Rroxscaffold_5G00364540 Rroxscaffold_5G00364550 Rroxscaffold_5G00364580 Rroxscaffold_5G00364600 Rroxscaffold_6G00393290 Rroxscaffold_6G00412680 Rroxscaffold_6G00412790 Rroxscaffold_6G00413470 Rroxscaffold_6G00413720 Rroxscaffold_6G00416070 Rroxscaffold_7G00205400
rosa_rugosa Rorug01G0017300 Rorug01G0017400 Rorug01G0018000 Rorug01G0018100 Rorug01G0211500 Rorug02G0638200 Rorug03G0070000 Rorug03G0071200 Rorug03G0081000 Rorug03G0086500 Rorug03G0089300 Rorug03G0095300 Rorug03G0096000 Rorug03G0096000 Rorug04G0055000 Rorug04G0078300 Rorug04G0104100.1 Rorug04G0113800 Rorug04G0126700 Rorug04G0128000 Rorug04G0145900 Rorug04G0148700 Rorug04G0149100 Rorug04G0149100 Rorug04G0149200 Rorug04G0149300 Rorug04G0154900 Rorug04G0180400 Rorug04G0180500 Rorug04G0180700 Rorug04G0180800 Rorug04G0401500 Rorug04G0402100 Rorug05G0288600 Rorug05G0334100 Rorug07G0176400
rosa_samantha Rh1DG043200 Rh1DG043500 Rh1DG043900 Rh1DG222800 Rh3CG039900 Rh3CG156200 Rh3CG328500 Rh3CG328800 Rh3DG165000 Rh4AG208400 Rh4BG205600 Rh4BG213900 Rh4BG243900 Rh4CG198800 Rh4DG168600 Rh4DG180100 Rh4DG180300 Rh4DG180600 Rh4DG181200 Rh4DG181600 Rh4DG181700 Rh4DG183700 Rh4DG184000 Rh4DG184400 Rh4DG184700 Rh4DG206100 Rh4DG206200 Rh4DG206300 Rh4DG215600 Rh4DG238700 Rh4DG238900 Rh5DG390300
rosa_wichuraiana Rw0G005050 Rw0G009260 Rw0G009280 Rw0G015600 Rw0G023570 Rw1G002140 Rw1G002170 Rw1G002210 Rw1G002240 Rw1G019500 Rw2G015490 Rw3G003020 Rw3G010900 Rw3G012030 Rw3G012790 Rw3G013050 Rw3G013540 Rw3G013640 Rw3G013650 Rw3G026050 Rw3G026070 Rw4G015740 Rw4G015790 Rw4G015910 Rw4G015930 Rw4G015950 Rw4G017900 Rw4G017930 Rw4G018440 Rw4G018450 Rw4G018530 Rw4G020720 Rw4G020760 Rw5G019250 Rw5G034370 Rw7G018700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 1253
AccII CGCG 3 cut(s) 3240, 3747, 4796
AciI CCGC 9 cut(s) 36, 202, 922, 2259, 3442, 3949, 4794, 4796, 4826
AclWI GGATC 9 cut(s) 12, 25, 299, 628, 1351, 1617, 3053, 4667, 4680
AcoI YGGCCR 2 cut(s) 609, 2440
AcuI CTGAAG 8 cut(s) 332, 1838, 2450, 2628, 3125, 3206, 3572, 3713
AcyI GRCGYC 3 cut(s) 1512, 3495, 4002
AfeI AGCGCT 2 cut(s) 2547, 3005
AfiI CCNNNNNNNGG 5 cut(s) 1527, 2438, 2675, 4306, 4796
AflII CTTAAG 3 cut(s) 1756, 1957, 2705
AflIII ACRYGT 4 cut(s) 1200, 1750, 2173, 2494
AhlI ACTAGT 2 cut(s) 1778, 4115
AjnI CCWGG 3 cut(s) 974, 1710, 4305
AleI CACNNNNGTG 1 cut(s) 4667
Alw21I GWGCWC 6 cut(s) 2583, 3248, 3570, 3755, 4616, 4628
Alw26I GTCTC 8 cut(s) 1720, 2381, 2653, 2855, 4092, 4190, 4236, 4319
AlwI GGATC 9 cut(s) 12, 25, 299, 628, 1351, 1617, 3053, 4667, 4680
AlwNI CAGNNNCTG 5 cut(s) 2606, 3229, 3391, 3736, 3898
Ama87I CYCGRG 1 cut(s) 1788
Aor51HI AGCGCT 2 cut(s) 2547, 3005
AoxI GGCC 9 cut(s) 609, 2146, 2440, 3425, 3932, 4073, 4330, 4872, 4906
ApaI GGGCCC 2 cut(s) 3429, 3936
ArsI GACNNNNNNTTYG 2 cut(s) 4735, 4767
AseI ATTAAT 1 cut(s) 4287
Asp700I GAANNNNTTC 2 cut(s) 285, 2925
AspLEI GCGC 4 cut(s) 178, 2548, 3006, 4723
AspS9I GGNCC 9 cut(s) 1047, 2105, 3425, 3426, 3932, 3933, 4331, 4557, 4906
AvaI CYCGRG 1 cut(s) 1788
AvaII GGWCC 3 cut(s) 1047, 2105, 4557
BaeGI GKGCMC 2 cut(s) 3429, 3936
BamHI GGATCC 2 cut(s) 17, 4672
BanII GRGCYC 6 cut(s) 2583, 3123, 3204, 3429, 3711, 3936
BarI GAAGNNNNNNTAC 4 cut(s) 49, 81, 147, 179
BbsI GAAGAC 3 cut(s) 94, 338, 1136
Bbv12I GWGCWC 6 cut(s) 2583, 3248, 3570, 3755, 4616, 4628
BceAI ACGGC 3 cut(s) 215, 596, 2272
BciT130I CCWGG 3 cut(s) 976, 1712, 4307
BciVI GTATCC 4 cut(s) 2859, 3280, 3787, 4128
BclI TGATCA 2 cut(s) 79, 1950
BcoDI GTCTC 8 cut(s) 1720, 2381, 2653, 2855, 4092, 4190, 4236, 4319
BcuI ACTAGT 2 cut(s) 1778, 4115
BfmI CTRYAG 2 cut(s) 249, 464
BfoI RGCGCY 2 cut(s) 2549, 3007
BfrI CTTAAG 3 cut(s) 1756, 1957, 2705
BfuI GTATCC 4 cut(s) 2859, 3280, 3787, 4128
BglI GCCNNNNNGGC 1 cut(s) 4880
BglII AGATCT 1 cut(s) 1837
BmcAI AGTACT 2 cut(s) 3128, 4393
Bme1390I CCNGG 3 cut(s) 976, 1712, 4307
Bme18I GGWCC 3 cut(s) 1047, 2105, 4557
BmeT110I CYCGRG 1 cut(s) 1788
BmgT120I GGNCC 9 cut(s) 1047, 2105, 3425, 3426, 3932, 3933, 4331, 4557, 4906
BmrFI CCNGG 3 cut(s) 976, 1712, 4307
BmrI ACTGGG 1 cut(s) 4589
BmuI ACTGGG 1 cut(s) 4589
BpiI GAAGAC 3 cut(s) 94, 338, 1136
BpmI CTGGAG 6 cut(s) 238, 496, 1632, 3107, 3641, 4289
Bpu10I CCTNAGC 1 cut(s) 4077
BpuEI CTTGAG 9 cut(s) 512, 1359, 1846, 2012, 3017, 3020, 4067, 4211, 4214
Bsa29I ATCGAT 2 cut(s) 3260, 3767
BsaAI YACGTR 5 cut(s) 724, 1751, 2856, 2870, 3071
BsaBI GATNNNNATC 1 cut(s) 3044
BsaHI GRCGYC 3 cut(s) 1512, 3495, 4002
BsaI GGTCTC 1 cut(s) 1720
BsaJI CCNNGG 5 cut(s) 384, 975, 4320, 4736, 4794
BsaWI WCCGGW 3 cut(s) 2821, 3310, 3817
BsaXI ACNNNNNCTCC 2 cut(s) 4396, 4426
Bsc4I CCNNNNNNNGG 5 cut(s) 1527, 2438, 2675, 4306, 4796
Bse118I RCCGGY 1 cut(s) 410
Bse3DI GCAATG 3 cut(s) 485, 1453, 4517
Bse8I GATNNNNATC 1 cut(s) 3044
BseBI CCWGG 3 cut(s) 976, 1712, 4307
BseCI ATCGAT 2 cut(s) 3260, 3767
BseDI CCNNGG 5 cut(s) 384, 975, 4320, 4736, 4794
BseJI GATNNNNATC 1 cut(s) 3044
BseLI CCNNNNNNNGG 5 cut(s) 1527, 2438, 2675, 4306, 4796
BseMI GCAATG 3 cut(s) 485, 1453, 4517
BseMII CTCAG 5 cut(s) 2496, 2559, 2852, 4158, 4590
BseRI GAGGAG 3 cut(s) 60, 2132, 2889
BseSI GKGCMC 2 cut(s) 3429, 3936
BseYI CCCAGC 3 cut(s) 2039, 4424, 4560
BsgI GTGCAG 5 cut(s) 2234, 3115, 3196, 3562, 3703
Bsh1236I CGCG 3 cut(s) 3240, 3747, 4796
BshFI GGCC 9 cut(s) 611, 2148, 2442, 3427, 3934, 4075, 4332, 4874, 4908
BshVI ATCGAT 2 cut(s) 3260, 3767
BsiHKAI GWGCWC 6 cut(s) 2583, 3248, 3570, 3755, 4616, 4628
BsiHKCI CYCGRG 1 cut(s) 1788
BsiSI CCGG 4 cut(s) 411, 2822, 3311, 3818
BslFI GGGAC 5 cut(s) 319, 432, 2652, 2820, 4576
BslI CCNNNNNNNGG 5 cut(s) 1527, 2438, 2675, 4306, 4796
BsmAI GTCTC 8 cut(s) 1720, 2381, 2653, 2855, 4092, 4190, 4236, 4319
BsmFI GGGAC 5 cut(s) 319, 432, 2652, 2820, 4576
BsmI GAATGC 3 cut(s) 1180, 1529, 2206
BsnI GGCC 9 cut(s) 611, 2148, 2442, 3427, 3934, 4075, 4332, 4874, 4908
Bso31I GGTCTC 1 cut(s) 1720
BsoBI CYCGRG 1 cut(s) 1788
Bsp120I GGGCCC 2 cut(s) 3425, 3932
BspACI CCGC 9 cut(s) 36, 202, 922, 2259, 3442, 3949, 4794, 4796, 4826
BspANI GGCC 9 cut(s) 611, 2148, 2442, 3427, 3934, 4075, 4332, 4874, 4908
BspCNI CTCAG 5 cut(s) 2497, 2560, 2853, 4159, 4589
BspDI ATCGAT 2 cut(s) 3260, 3767
BspFNI CGCG 3 cut(s) 3240, 3747, 4796
BspMAI CTGCAG 2 cut(s) 253, 468
BspPI GGATC 9 cut(s) 12, 25, 299, 628, 1351, 1617, 3053, 4667, 4680
BspQI GCTCTTC 2 cut(s) 2571, 4167
BspTI CTTAAG 3 cut(s) 1756, 1957, 2705
BspTNI GGTCTC 1 cut(s) 1720
BsrDI GCAATG 3 cut(s) 485, 1453, 4517
BsrFI RCCGGY 1 cut(s) 410
BssAI RCCGGY 1 cut(s) 410
BssECI CCNNGG 5 cut(s) 384, 975, 4320, 4736, 4794
BssNI GRCGYC 3 cut(s) 1512, 3495, 4002
BssT1I CCWWGG 1 cut(s) 4320
Bst2UI CCWGG 3 cut(s) 976, 1712, 4307
Bst4CI ACNGT 6 cut(s) 238, 952, 2079, 2521, 2951, 4864
BstACI GRCGYC 3 cut(s) 1512, 3495, 4002
BstAFI CTTAAG 3 cut(s) 1756, 1957, 2705
BstAPI GCANNNNNTGC 1 cut(s) 2201
BstBAI YACGTR 5 cut(s) 724, 1751, 2856, 2870, 3071
BstC8I GCNNGC 9 cut(s) 204, 358, 628, 652, 1883, 2206, 4294, 4719, 4731
BstDSI CCRYGG 3 cut(s) 384, 4736, 4794
BstENI CCTNNNNNAGG 1 cut(s) 4304
BstFNI CGCG 3 cut(s) 3240, 3747, 4796
BstH2I RGCGCY 2 cut(s) 2549, 3007
BstHHI GCGC 4 cut(s) 178, 2548, 3006, 4723
BstMAI GTCTC 8 cut(s) 1720, 2381, 2653, 2855, 4092, 4190, 4236, 4319
BstNI CCWGG 3 cut(s) 976, 1712, 4307
BstNSI RCATGY 5 cut(s) 1204, 1631, 1967, 2177, 4296
BstSCI CCNGG 3 cut(s) 974, 1710, 4305
BstSFI CTRYAG 2 cut(s) 249, 464
BstSLI GKGCMC 2 cut(s) 3429, 3936
BstSNI TACGTA 2 cut(s) 724, 2870
BstUI CGCG 3 cut(s) 3240, 3747, 4796
BstV2I GAAGAC 3 cut(s) 94, 338, 1136
BstX2I RGATCY 3 cut(s) 17, 1837, 4672
BstYI RGATCY 3 cut(s) 17, 1837, 4672
Bsu15I ATCGAT 2 cut(s) 3260, 3767
BsuI GTATCC 4 cut(s) 2859, 3280, 3787, 4128
BsuRI GGCC 9 cut(s) 611, 2148, 2442, 3427, 3934, 4075, 4332, 4874, 4908
BsuTUI ATCGAT 2 cut(s) 3260, 3767
BtgI CCRYGG 3 cut(s) 384, 4736, 4794
BtgZI GCGATG 1 cut(s) 3043
BtsI GCAGTG 1 cut(s) 57
BtsIMutI CAGTG 3 cut(s) 57, 948, 2947
Cac8I GCNNGC 9 cut(s) 204, 358, 628, 652, 1883, 2206, 4294, 4719, 4731
CaiI CAGNNNCTG 5 cut(s) 2606, 3229, 3391, 3736, 3898
CfoI GCGC 4 cut(s) 178, 2548, 3006, 4723
Cfr10I RCCGGY 1 cut(s) 410
Cfr13I GGNCC 9 cut(s) 1047, 2105, 3425, 3426, 3932, 3933, 4331, 4557, 4906
Cfr42I CCGCGG 1 cut(s) 4797
ClaI ATCGAT 2 cut(s) 3260, 3767
CseI GACGC 4 cut(s) 438, 1501, 3503, 4010
DraI TTTAAA 2 cut(s) 4122, 4512
EaeI YGGCCR 2 cut(s) 609, 2440
EciI GGCGGA 1 cut(s) 4841
Ecl136II GAGCTC 1 cut(s) 2581
Eco105I TACGTA 2 cut(s) 724, 2870
Eco130I CCWWGG 1 cut(s) 4320
Eco24I GRGCYC 6 cut(s) 2583, 3123, 3204, 3429, 3711, 3936
Eco31I GGTCTC 1 cut(s) 1720
Eco47I GGWCC 3 cut(s) 1047, 2105, 4557
Eco47III AGCGCT 2 cut(s) 2547, 3005
Eco53kI GAGCTC 1 cut(s) 2581
Eco57I CTGAAG 8 cut(s) 332, 1838, 2450, 2628, 3125, 3206, 3572, 3713
Eco88I CYCGRG 1 cut(s) 1788
EcoICRI GAGCTC 1 cut(s) 2581
EcoNI CCTNNNNNAGG 1 cut(s) 4304
EcoO109I RGGNCCY 2 cut(s) 2105, 4906
EcoRI GAATTC 1 cut(s) 503
EcoRII CCWGG 3 cut(s) 974, 1710, 4305
EcoT14I CCWWGG 1 cut(s) 4320
EcoT22I ATGCAT 2 cut(s) 1182, 4294
EcoT38I GRGCYC 6 cut(s) 2583, 3123, 3204, 3429, 3711, 3936
ErhI CCWWGG 1 cut(s) 4320
FalI AAGNNNNNCTT 4 cut(s) 2210, 2242, 4533, 4565
FaqI GGGAC 5 cut(s) 319, 432, 2652, 2820, 4576
FauI CCCGC 4 cut(s) 195, 2252, 4789, 4801
FbaI TGATCA 2 cut(s) 79, 1950
FblI GTMKAC 1 cut(s) 1253
FriOI GRGCYC 6 cut(s) 2583, 3123, 3204, 3429, 3711, 3936
GlaI GCGC 4 cut(s) 177, 2547, 3005, 4722
GsaI CCCAGC 3 cut(s) 2043, 4428, 4564
GsuI CTGGAG 6 cut(s) 238, 496, 1632, 3107, 3641, 4289
HaeII RGCGCY 2 cut(s) 2549, 3007
HaeIII GGCC 9 cut(s) 611, 2148, 2442, 3427, 3934, 4075, 4332, 4874, 4908
HapII CCGG 4 cut(s) 411, 2822, 3311, 3818
HgaI GACGC 4 cut(s) 438, 1501, 3503, 4010
HhaI GCGC 4 cut(s) 178, 2548, 3006, 4723
Hin1I GRCGYC 3 cut(s) 1512, 3495, 4002
Hin6I GCGC 4 cut(s) 176, 2546, 3004, 4721
HinP1I GCGC 4 cut(s) 176, 2546, 3004, 4721
HincII GTYRAC 3 cut(s) 1254, 2765, 2886
HindII GTYRAC 3 cut(s) 1254, 2765, 2886
HindIII AAGCTT 1 cut(s) 1171
HpaII CCGG 4 cut(s) 411, 2822, 3311, 3818
Hpy166II GTNNAC 5 cut(s) 721, 1254, 1694, 2765, 2886
Hpy8I GTNNAC 5 cut(s) 721, 1254, 1694, 2765, 2886
Hpy99I CGWCG 1 cut(s) 787
HpyCH4III ACNGT 6 cut(s) 238, 952, 2079, 2521, 2951, 4864
HpyCH4IV ACGT 8 cut(s) 723, 1750, 2088, 2494, 2711, 2855, 2869, 3070
HpySE526I ACGT 8 cut(s) 723, 1750, 2088, 2494, 2711, 2855, 2869, 3070
Hsp92I GRCGYC 3 cut(s) 1512, 3495, 4002
HspAI GCGC 4 cut(s) 176, 2546, 3004, 4721
Ksp22I TGATCA 2 cut(s) 79, 1950
KspI CCGCGG 1 cut(s) 4797
LguI GCTCTTC 2 cut(s) 2571, 4167
MaeII ACGT 8 cut(s) 723, 1750, 2088, 2494, 2711, 2855, 2869, 3070
MaeIII GTNAC 9 cut(s) 706, 958, 1196, 1783, 2222, 2521, 2740, 3549, 4056
MfeI CAATTG 5 cut(s) 83, 2112, 2138, 2416, 3155
MflI RGATCY 3 cut(s) 17, 1837, 4672
MmeI TCCRAC 2 cut(s) 819, 1384
Mph1103I ATGCAT 2 cut(s) 1182, 4294
MroXI GAANNNNTTC 2 cut(s) 285, 2925
MslI CAYNNNNRTG 8 cut(s) 1247, 1968, 2229, 2245, 3231, 3738, 4619, 4667
MspA1I CMGCKG 3 cut(s) 38, 2606, 4796
MspCI CTTAAG 3 cut(s) 1756, 1957, 2705
MspI CCGG 4 cut(s) 411, 2822, 3311, 3818
MspR9I CCNGG 3 cut(s) 976, 1712, 4307
MunI CAATTG 5 cut(s) 83, 2112, 2138, 2416, 3155
Mva1269I GAATGC 3 cut(s) 1180, 1529, 2206
MvaI CCWGG 3 cut(s) 976, 1712, 4307
MvnI CGCG 3 cut(s) 3240, 3747, 4796
NmeAIII GCCGAG 1 cut(s) 2418
NmuCI GTSAC 5 cut(s) 958, 1196, 1783, 2222, 2740
NsiI ATGCAT 2 cut(s) 1182, 4294
NspI RCATGY 5 cut(s) 1204, 1631, 1967, 2177, 4296
OliI CACNNNNGTG 1 cut(s) 4667
PacI TTAATTAA 1 cut(s) 1341
PaeI GCATGC 1 cut(s) 4296
PaeR7I CTCGAG 1 cut(s) 1788
PciI ACATGT 2 cut(s) 1200, 2173
PciSI GCTCTTC 2 cut(s) 2571, 4167
PctI GAATGC 3 cut(s) 1180, 1529, 2206
PdmI GAANNNNTTC 2 cut(s) 285, 2925
PflFI GACNNNGTC 2 cut(s) 2664, 2961
PfoI TCCNGGA 1 cut(s) 4305
Ppu21I YACGTR 5 cut(s) 724, 1751, 2856, 2870, 3071
PpuMI RGGWCCY 1 cut(s) 2105
PscI ACATGT 2 cut(s) 1200, 2173
PshBI ATTAAT 1 cut(s) 4287
Psp124BI GAGCTC 1 cut(s) 2583
Psp5II RGGWCCY 1 cut(s) 2105
Psp6I CCWGG 3 cut(s) 974, 1710, 4305
PspFI CCCAGC 3 cut(s) 2039, 4424, 4560
PspGI CCWGG 3 cut(s) 974, 1710, 4305
PspOMI GGGCCC 2 cut(s) 3425, 3932
PspPI GGNCC 9 cut(s) 1047, 2105, 3425, 3426, 3932, 3933, 4331, 4557, 4906
PspPPI RGGWCCY 1 cut(s) 2105
PstI CTGCAG 2 cut(s) 253, 468
PstNI CAGNNNCTG 5 cut(s) 2606, 3229, 3391, 3736, 3898
PsuI RGATCY 3 cut(s) 17, 1837, 4672
PsyI GACNNNGTC 2 cut(s) 2664, 2961
PvuII CAGCTG 1 cut(s) 2606
RseI CAYNNNNRTG 8 cut(s) 1247, 1968, 2229, 2245, 3231, 3738, 4619, 4667
SacI GAGCTC 1 cut(s) 2583
SacII CCGCGG 1 cut(s) 4797
SalI GTCGAC 1 cut(s) 1252
SapI GCTCTTC 2 cut(s) 2571, 4167
Sau96I GGNCC 9 cut(s) 1047, 2105, 3425, 3426, 3932, 3933, 4331, 4557, 4906
ScaI AGTACT 2 cut(s) 3128, 4393
ScrFI CCNGG 3 cut(s) 976, 1712, 4307
SfcI CTRYAG 2 cut(s) 249, 464
Sfr274I CTCGAG 1 cut(s) 1788
Sfr303I CCGCGG 1 cut(s) 4797
SgrBI CCGCGG 1 cut(s) 4797
SinI GGWCC 3 cut(s) 1047, 2105, 4557
SlaI CTCGAG 1 cut(s) 1788
SmiMI CAYNNNNRTG 8 cut(s) 1247, 1968, 2229, 2245, 3231, 3738, 4619, 4667
SnaBI TACGTA 2 cut(s) 724, 2870
SpeI ACTAGT 2 cut(s) 1778, 4115
SphI GCATGC 1 cut(s) 4296
SsiI CCGC 9 cut(s) 36, 202, 922, 2259, 3442, 3949, 4794, 4796, 4826
SspI AATATT 5 cut(s) 1075, 1723, 2339, 3341, 3848
SstI GAGCTC 1 cut(s) 2583
StyD4I CCNGG 3 cut(s) 974, 1710, 4305
StyI CCWWGG 1 cut(s) 4320
TaaI ACNGT 6 cut(s) 238, 952, 2079, 2521, 2951, 4864
TaiI ACGT 8 cut(s) 726, 1753, 2091, 2497, 2714, 2858, 2872, 3073
TatI WGTACW 4 cut(s) 862, 2287, 3126, 4391
TauI GCSGC 1 cut(s) 925
TscAI CASTG 3 cut(s) 57, 955, 2954
TseFI GTSAC 5 cut(s) 958, 1196, 1783, 2222, 2740
Tsp45I GTSAC 5 cut(s) 958, 1196, 1783, 2222, 2740
TspGWI ACGGA 6 cut(s) 373, 818, 2349, 3371, 3878, 4709
TspRI CASTG 3 cut(s) 57, 955, 2954
Tth111I GACNNNGTC 2 cut(s) 2664, 2961
Vha464I CTTAAG 3 cut(s) 1756, 1957, 2705
VpaK11BI GGWCC 3 cut(s) 1047, 2105, 4557
VspI ATTAAT 1 cut(s) 4287
XagI CCTNNNNNAGG 1 cut(s) 4304
XbaI TCTAGA 1 cut(s) 1834
XceI RCATGY 5 cut(s) 1204, 1631, 1967, 2177, 4296
XcmI CCANNNNNNNNNTGG 1 cut(s) 49
XhoI CTCGAG 1 cut(s) 1788
XmiI GTMKAC 1 cut(s) 1253
XmnI GAANNNNTTC 2 cut(s) 285, 2925
ZrmI AGTACT 2 cut(s) 3128, 4393
Zsp2I ATGCAT 2 cut(s) 1182, 4294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.