Rmu_sc0001729.1_g000005

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001729.1
Physical Location & Seq
Reverse (-)
20129 .. 24124
3996 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001729.1_g000005.1.cds

Sequence Viewer

Length: 3801 bp
atggctattgaagcgatatcattgaagattggatcctctctccttctatccgctgccggaggagcggtgggtaatgtggcttcactcggtactgatcaattgagcctcaaaatcgtcttctgtttcagcaaagcagtagatgagctcaaacgatcctcaagtcagattggaaatttgatacatgatgctgcgctagaacccaaagatggagaactgctggctatggctgactggatgaagaggctgatgaccgtagcttatgctgcagcagatgtcgtggatgaagttcaatatgaatttgttcggatcgatctggaggggacaattctctataaggacatacgcagaatcttcgttcgtcttcagatggcatgcaagattgacaaaatcaatcgatccttgcagaatctctacaacgaagcacccgctgtgggactcttcatgagaaggagatcaaatggaggtgcatcatccagtcaaggtatgcagggtagggaaacaatctcattgcttgagaaacatgaatccgcctccagagatgcacagattgttggaagggaaaagtttgtgaaagatataactgaaaccttgaacgaccccaacaatcaagaaaagatgcttttggtgatggccgttgtaggattgccaggcgtgggtaaaacaactttggctcgcttacttaccgagcaactgatgaaaaaaggtgaaatgacaaagccctttgatataactctctgggtgtacgtatctccaacttttgatgtcacatcaattttacgtcgaatgctgaaattatgtgaggagacgacaacaaatcctgaaactctggaagaattgattccaagcctccgcaagaagttggaagggaaaaggttttttcttgtacttgatgatgtttggaatgaggatgctgatctttggaaggatttgaagagttatctgcggcaactaaactctgccaaaggaagcactgtgattgtcactacccgtagttccagggttgcagaaatcatgcgaacacttcctaataattgcgatctagagattctttcggatgatcagagttggtccataataaaggatagagcatttgatgatcctaatcattcgatagatccagaccaagagcaaatcggaagagagattgccggaaagtgtgctggtcttccattggcggcaaagattttgggaagcttgatgcattctaagaatagcagcaacgaatggaggtcaattctgcaaagtcttacatggcagaatagcatcatgtcggctctgatgttgagttttgacaatttaaagtcaccattaaaaccatgttttgcatattgctcaatgctcgatagaggttccctaataaaaagagatcagttgatccaactatggatggctcaaggttttctcaatccttgtcctcaccaaagaatgcaaaagagggagatggagatggaggatataggcaatgagtattttgatactctactggagaagtccttgtttcaagatgctagaaaggatgaggatgacatcatcaccgaatgcaagatgcacgatcttgtgcatgaatttgcaataaaagtatccaggtgtgagagctggacacaagacttcagtcatgagatggatgatagtgagattcgacatgatgcacggattcctactccagaagaaagtatgccaaacttcaatcatgagatgggtgatagtgagattcgacatgttgcacggatttctactccaaaactagaaagtatgtcagaaacaagtattgcaagactgcgttcactcttttcaatccatgtctctaatatcatttttccaaagttaagagctttacgtgtcttaagtttctatgaggctgagactcaagaattgccaaattcacttgacaagctgaaacacttgaggtatctagatctttcccatacagcaatcagaacactcccagagtttattggcaagctctacaacctccaaacattgagattaccatatctcgaaaagtgtccaaaggagattcaaaatttgatcaacttgaggcatctttatgttgatgagagagagaaatttgaggctggtgtttatgttactaagagaatgaaatttgaggctgggattttggggcgattaactgatctccgaacattacgttacttcaacgtgggtcctgcaattgaggagttgggtgggttgaaccaattgagaggccacttaattattgatgggctagaacatgtaagggatggagaagaagcaaagaatgctcgcttagtgcagaagagtcacttacatgagctgacatttaaatggacagacggcggggcagctaatgaaaatcaaactgatgtactagatggcttggaacctcatggtgagctgcaaaggttaaacattgtaaatttcatgggtgctggatttccgtcatggataatgagactccaaaatttgaaggagattcgattagttggctgcaacaattgtgaaggagtgccgacactcggccatctacctaaactaagatctcttgagattagtgagatgcacaagctgaaacgtgtgggagctgagttttatggtactggtacaactttatttccagaactgaaaatattagacatctctgactgcaaagagctcattgaatggatggaagcaccagctgaaggagaagtcgtggtatttccttgcctcgaagagttaaatatcagcgtttgtaaaaaactaagtcatttacctgatgggctagacaaactccctcttcttgagcggttgagaataggtggttgtcccagcctcaagtcgattcggatcacacggggcatcgcatctctccgtgaattgaacatccagagttgtgagggattatcaagcctagaggttgggctccagtactgcacctcccttcagcaattggtgatcgaggattgtgataatctaacatcaattccaatcacagagggcatcacatctctccagaggttggagattgttggttgtcagagattattaggcctaccgagtgggctccaattctgcacctctcttcagtatctggaaataattcgttgctctagtctagtatcatatcatgtgtgcgaccaccaagactcaacgaatcaacgggaggaagtctttacaggtcttgttcagtatttgtctatacaggaggactgccgtagtccagaatctattccagctcatctccgtcactcgttgatatgtaattgtgggaaattgaaatatgagcccacaggattatttcacagcctcactcgtttgaagaagctgacaattggtcggttctggagggagctggacgccttccctgattttcagcttccaccaccacatgattcacaacttgaagagttacatttgtggggttggcctaagctcaagtctctgccccaacaaattcagcactacacttgtttaaaaactctcgggatatatgattttgggggaatagaggctcttcctgagtggttgggaaatcttacatctcttgagtctctgactctctggttcggtgaaaatctcaagtctctgcctacacaagatgctatgaaaagccttaccaaattgaagaagctctccatttataaatgccccctgctcgaggaaagatgcaccaaggagaccggccccgaatggcccaagatttctcacatcccagaactcaagtgttcgggaaggaacatgcatgctgcgaatttaccatcttctacaagaaatgctgagaatttaacatcttctcgaagaaatgctgtgttggattgttttccatgttgcattctttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

1266

Amino Acids

143.47

Weight (kDa)

5.98

Isoelectric Point (pI)

48.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000029)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g13530 FvH4_4g18270 FvH4_6g12200 FvH4_6g12460 FvH4_6g12461 FvH4_6g13450 FvH4_6g15090 FvH4_6g15220 FvH4_6g15230 FvH4_6g15250 FvH4_6g15251 FvH4_6g15340 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47980 FvH4_6g47980 FvH4_6g47980 FvH4_6g48170 FvH4_6g48310 FvH4_6g48310 FvH4_6g48850 FvH4_6g48881 FvH4_7g11830
malus_domestica MD02G1059900.v1.1 MD02G1069600.v1.1 MD02G1069700.v1.1 MD02G1070100.v1.1 MD02G1070200.v1.1 MD02G1070300.v1.1 MD02G1070800.v1.1 MD02G1070900.v1.1 MD02G1071200.v1.1 MD02G1071400.v1.1 MD02G1071900.v1.1 MD02G1075200.v1.1 MD03G1048000.v1.1 MD03G1049100.v1.1 MD03G1049200.v1.1 MD03G1052500.v1.1 MD03G1054100.v1.1 MD03G1054300.v1.1 MD03G1054400.v1.1 MD04G1113400.v1.1 MD04G1211100.v1.1 MD04G1211200.v1.1 MD05G1174900.v1.1 MD05G1175000.v1.1 MD05G1175900.v1.1 MD05G1243400.v1.1 MD07G1031500.v1.1 MD07G1031600.v1.1 MD07G1032500.v1.1 MD11G1046800.v1.1 MD11G1046900.v1.1 MD11G1047000.v1.1 MD11G1050400.v1.1 MD11G1050600.v1.1 MD11G1050800.v1.1 MD11G1051100.v1.1 MD11G1051600.v1.1 MD11G1051700.v1.1 MD11G1054600.v1.1 MD11G1055600.v1.1 MD11G1055700.v1.1 MD11G1055800.v1.1 MD11G1056000.v1.1 MD12G1126600.v1.1 MD12G1126700.v1.1 MD12G1126800.v1.1 MD12G1127300.v1.1 MD12G1127600.v1.1 MD12G1127900.v1.1 MD12G1128100.v1.1 MD12G1128300.v1.1 MD15G1261500.v1.1
prunus_persica Prupe.1G010700_v2.0.a1 Prupe.1G010800_v2.0.a1 Prupe.1G011000_v2.0.a1 Prupe.1G159600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163800_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G235500_v2.0.a1 Prupe.2G067400_v2.0.a1 Prupe.2G067500_v2.0.a1 Prupe.2G111700_v2.0.a1 Prupe.2G111800_v2.0.a1 Prupe.3G012000_v2.0.a1 Prupe.6G243400_v2.0.a1 Prupe.6G243500_v2.0.a1 Prupe.6G243600_v2.0.a1 Prupe.6G243700_v2.0.a1 Prupe.6G243800_v2.0.a1 Prupe.6G243900_v2.0.a1
pyrus_communis pycom02g04860 pycom02g04880 pycom02g04890 pycom02g05510 pycom02g05520 pycom02g05600 pycom02g05930 pycom02g06000 pycom02g06010 pycom03g03800 pycom03g03860 pycom03g03880 pycom03g03890 pycom03g03910 pycom03g03920 pycom03g04200 pycom03g04290 pycom03g04300 pycom03g04310 pycom03g04320 pycom03g09260 pycom04g10150 pycom04g10160 pycom04g10170 pycom05g16180 pycom05g16190 pycom05g16240 pycom05g21980 pycom05g21990 pycom07g02280 pycom11g03800 pycom11g03810 pycom11g04080 pycom11g04140 pycom11g04150 pycom11g04160 pycom11g04570 pycom11g04580 pycom11g04590 pycom11g04610 pycom12g12470 pycom12g12490 pycom13g22050
rosa_chinensis RchiOBHm_Chr1g0317761 RchiOBHm_Chr1g0317821 RchiOBHm_Chr1g0317831 RchiOBHm_Chr1g0317871 RchiOBHm_Chr1g0350501 RchiOBHm_Chr2g0107631 RchiOBHm_Chr3g0452091 RchiOBHm_Chr3g0464001 RchiOBHm_Chr3g0464281 RchiOBHm_Chr3g0466331 RchiOBHm_Chr3g0467341 RchiOBHm_Chr3g0467381 RchiOBHm_Chr3g0467731 RchiOBHm_Chr3g0468291 RchiOBHm_Chr3g0468321 RchiOBHm_Chr3g0468341 RchiOBHm_Chr3g0468391 RchiOBHm_Chr3g0468411 RchiOBHm_Chr3g0468571 RchiOBHm_Chr3g0468591 RchiOBHm_Chr3g0490721 RchiOBHm_Chr3g0490751 RchiOBHm_Chr3g0490761 RchiOBHm_Chr3g0490771 RchiOBHm_Chr3g0490951 RchiOBHm_Chr3g0491001 RchiOBHm_Chr3g0491011 RchiOBHm_Chr4g0412461 RchiOBHm_Chr4g0414161 RchiOBHm_Chr4g0414181 RchiOBHm_Chr4g0414191 RchiOBHm_Chr4g0414281 RchiOBHm_Chr4g0414441 RchiOBHm_Chr4g0414521 RchiOBHm_Chr4g0414531 RchiOBHm_Chr4g0417011 RchiOBHm_Chr4g0417021 RchiOBHm_Chr4g0417041 RchiOBHm_Chr4g0417071 RchiOBHm_Chr4g0417101 RchiOBHm_Chr4g0417531 RchiOBHm_Chr4g0417641 RchiOBHm_Chr4g0417651 RchiOBHm_Chr4g0417701 RchiOBHm_Chr4g0417731 RchiOBHm_Chr4g0417741 RchiOBHm_Chr4g0417781 RchiOBHm_Chr4g0418751 RchiOBHm_Chr4g0418791 RchiOBHm_Chr4g0418861 RchiOBHm_Chr4g0418881 RchiOBHm_Chr4g0418901 RchiOBHm_Chr4g0422451 RchiOBHm_Chr4g0422461 RchiOBHm_Chr4g0422471 RchiOBHm_Chr4g0422541 RchiOBHm_Chr4g0422561 RchiOBHm_Chr4g0422591 RchiOBHm_Chr4g0422651 RchiOBHm_Chr4g0422661 RchiOBHm_Chr5g0003251 RchiOBHm_Chr5g0003261 RchiOBHm_Chr5g0055871 RchiOBHm_Chr7g0204701 RchiOBHm_Chr7g0204741
rosa_laevigata RLG00000007607 RLG00000007932 RLG00000017606 RLG00000024418 RLG00000025629 RLG00000030586
rosa_multiflora Rmu_co7959167.1_g000001 Rmu_co8021330.1_g000001 Rmu_co8132128.1_g000001 Rmu_co8224744.1_g000001 Rmu_co8281865.1_g000001 Rmu_co8298487.1_g000001 Rmu_co8319035.1_g000001 Rmu_co8380035.1_g000001 Rmu_co8385371.1_g000001 Rmu_co8398173.1_g000001 Rmu_co8423363.1_g000001 Rmu_co8438275.1_g000001 Rmu_co8474729.1_g000001 Rmu_sc0000057.1_g000008 Rmu_sc0000350.1_g000023 Rmu_sc0000480.1_g000005 Rmu_sc0000654.1_g000021 Rmu_sc0000654.1_g000029 Rmu_sc0000654.1_g000032 Rmu_sc0000654.1_g000041 Rmu_sc0000654.1_g000045 Rmu_sc0000772.1_g000002 Rmu_sc0000772.1_g000041 Rmu_sc0000808.1_g000040 Rmu_sc0000830.1_g000062 Rmu_sc0000830.1_g000065 Rmu_sc0000830.1_g000072 Rmu_sc0000830.1_g000073 Rmu_sc0000935.1_g000020 Rmu_sc0000935.1_g000024 Rmu_sc0000935.1_g000026 Rmu_sc0000935.1_g000027 Rmu_sc0000935.1_g000031 Rmu_sc0000935.1_g000033 Rmu_sc0000962.1_g000033 Rmu_sc0000962.1_g000036 Rmu_sc0000962.1_g000063 Rmu_sc0000962.1_g000064 Rmu_sc0000962.1_g000065 Rmu_sc0001029.1_g000007 Rmu_sc0001063.1_g000014 Rmu_sc0001149.1_g000010 Rmu_sc0001149.1_g000011 Rmu_sc0001358.1_g000009 Rmu_sc0001448.1_g000003 Rmu_sc0001448.1_g000004 Rmu_sc0001729.1_g000005 Rmu_sc0001729.1_g000007 Rmu_sc0001729.1_g000020 Rmu_sc0001729.1_g000023 Rmu_sc0001793.1_g000015 Rmu_sc0002494.1_g000018 Rmu_sc0002494.1_g000019 Rmu_sc0002604.1_g000022 Rmu_sc0002922.1_g000011 Rmu_sc0003008.1_g000009 Rmu_sc0003221.1_g000061 Rmu_sc0003221.1_g000062 Rmu_sc0003459.1_g000014 Rmu_sc0003480.1_g000015 Rmu_sc0003541.1_g000016 Rmu_sc0003541.1_g000020 Rmu_sc0004035.1_g000001 Rmu_sc0004035.1_g000005 Rmu_sc0004035.1_g000011 Rmu_sc0004142.1_g000004 Rmu_sc0004142.1_g000010 Rmu_sc0004353.1_g000008 Rmu_sc0004616.1_g000009 Rmu_sc0004616.1_g000010 Rmu_sc0005231.1_g000004 Rmu_sc0006380.1_g000025 Rmu_sc0006492.1_g000010 Rmu_sc0006895.1_g000001 Rmu_sc0006895.1_g000002 Rmu_sc0006895.1_g000005 Rmu_sc0007034.1_g000004 Rmu_sc0007104.1_g000006 Rmu_sc0008990.1_g000003 Rmu_sc0008990.1_g000004 Rmu_sc0009106.1_g000003 Rmu_sc0009516.1_g000002 Rmu_sc0009516.1_g000003 Rmu_sc0009516.1_g000004 Rmu_sc0009516.1_g000005 Rmu_sc0009645.1_g000001 Rmu_sc0010274.1_g000001 Rmu_sc0010274.1_g000002 Rmu_sc0010419.1_g000003 Rmu_sc0010917.1_g000017 Rmu_sc0011213.1_g000001 Rmu_sc0011228.1_g000007 Rmu_sc0011538.1_g000011 Rmu_sc0011538.1_g000014 Rmu_sc0011538.1_g000015 Rmu_sc0012211.1_g000006 Rmu_sc0012351.1_g000003 Rmu_sc0012351.1_g000005 Rmu_sc0012915.1_g000002 Rmu_sc0013088.1_g000001 Rmu_sc0013459.1_g000001 Rmu_sc0013765.1_g000004 Rmu_sc0013765.1_g000005 Rmu_sc0014003.1_g000012 Rmu_sc0014003.1_g000014 Rmu_sc0014698.1_g000001 Rmu_sc0015740.1_g000001 Rmu_sc0016429.1_g000003 Rmu_sc0018885.1_g000001 Rmu_sc0020345.1_g000001 Rmu_sc0027791.1_g000001 Rmu_sc0037325.1_g000001 Rmu_ssc0000010.1_g000024 Rmu_ssc0000010.1_g000025 Rmu_ssc0000083.1_g000021 Rmu_ssc0000340.1_g000002 Rmu_ssc0000386.1_g000002 Rmu_ssc0000386.1_g000024 Rmu_ssc0000386.1_g000025 Rmu_ssc0000386.1_g000034 Rmu_ssc0000386.1_g000037 Rmu_ssc0000477.1_g000001
rosa_roxburghii Rroxscaffold_161G00448010 Rroxscaffold_164G00436080 Rroxscaffold_1G00024500 Rroxscaffold_2G00124290 Rroxscaffold_3G00222940 Rroxscaffold_3G00227440 Rroxscaffold_4G00304810 Rroxscaffold_4G00330180 Rroxscaffold_4G00330200 Rroxscaffold_5G00356620 Rroxscaffold_5G00358170 Rroxscaffold_5G00360880 Rroxscaffold_5G00361220 Rroxscaffold_5G00361950 Rroxscaffold_5G00361960 Rroxscaffold_5G00361990 Rroxscaffold_5G00362370 Rroxscaffold_5G00364540 Rroxscaffold_5G00364550 Rroxscaffold_5G00364580 Rroxscaffold_5G00364600 Rroxscaffold_6G00393290 Rroxscaffold_6G00412680 Rroxscaffold_6G00412790 Rroxscaffold_6G00413470 Rroxscaffold_6G00413720 Rroxscaffold_6G00416070 Rroxscaffold_7G00205400
rosa_rugosa Rorug01G0017300 Rorug01G0017400 Rorug01G0018000 Rorug01G0018100 Rorug01G0211500 Rorug02G0638200 Rorug03G0070000 Rorug03G0071200 Rorug03G0081000 Rorug03G0086500 Rorug03G0089300 Rorug03G0095300 Rorug03G0096000 Rorug03G0096000 Rorug04G0055000 Rorug04G0078300 Rorug04G0104100.1 Rorug04G0113800 Rorug04G0126700 Rorug04G0128000 Rorug04G0145900 Rorug04G0148700 Rorug04G0149100 Rorug04G0149100 Rorug04G0149200 Rorug04G0149300 Rorug04G0154900 Rorug04G0180400 Rorug04G0180500 Rorug04G0180700 Rorug04G0180800 Rorug04G0401500 Rorug04G0402100 Rorug05G0288600 Rorug05G0334100 Rorug07G0176400
rosa_samantha Rh1DG043200 Rh1DG043500 Rh1DG043900 Rh1DG222800 Rh3CG039900 Rh3CG156200 Rh3CG328500 Rh3CG328800 Rh3DG165000 Rh4AG208400 Rh4BG205600 Rh4BG213900 Rh4BG243900 Rh4CG198800 Rh4DG168600 Rh4DG180100 Rh4DG180300 Rh4DG180600 Rh4DG181200 Rh4DG181600 Rh4DG181700 Rh4DG183700 Rh4DG184000 Rh4DG184400 Rh4DG184700 Rh4DG206100 Rh4DG206200 Rh4DG206300 Rh4DG215600 Rh4DG238700 Rh4DG238900 Rh5DG390300
rosa_wichuraiana Rw0G005050 Rw0G009260 Rw0G009280 Rw0G015600 Rw0G023570 Rw1G002140 Rw1G002170 Rw1G002210 Rw1G002240 Rw1G019500 Rw2G015490 Rw3G003020 Rw3G010900 Rw3G012030 Rw3G012790 Rw3G013050 Rw3G013540 Rw3G013640 Rw3G013650 Rw3G026050 Rw3G026070 Rw4G015740 Rw4G015790 Rw4G015910 Rw4G015930 Rw4G015950 Rw4G017900 Rw4G017930 Rw4G018440 Rw4G018450 Rw4G018530 Rw4G020720 Rw4G020760 Rw5G019250 Rw5G034370 Rw7G018700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 3603
AccB7I CCANNNNNTGG 1 cut(s) 2980
AccBSI CCGCTC 2 cut(s) 65, 2767
AciI CCGC 9 cut(s) 51, 65, 426, 528, 850, 943, 1175, 2319, 2767
AclWI GGATC 9 cut(s) 27, 40, 147, 314, 390, 1091, 1109, 1369, 2816
AcoI YGGCCR 2 cut(s) 630, 2500
AcuI CTGAAG 5 cut(s) 347, 1594, 2682, 2888, 3029
AcyI GRCGYC 1 cut(s) 3318
AfaI GTAC 7 cut(s) 91, 743, 885, 2349, 2578, 2584, 2891
AfiI CCNNNNNNNGG 7 cut(s) 206, 431, 653, 2498, 2663, 2980, 3619
AflII CTTAAG 1 cut(s) 1843
AflIII ACRYGT 4 cut(s) 1717, 1837, 2233, 2554
AhdI GACNNNNNGTC 1 cut(s) 3294
AjnI CCWGG 3 cut(s) 646, 995, 1583
Alw21I GWGCWC 2 cut(s) 147, 2637
Alw26I GTCTC 8 cut(s) 797, 1807, 1856, 2428, 3405, 3516, 3549, 3632
AlwI GGATC 9 cut(s) 27, 40, 147, 314, 390, 1091, 1109, 1369, 2816
AlwNI CAGNNNCTG 1 cut(s) 3052
Ama87I CYCGRG 2 cut(s) 3443, 3617
AoxI GGCC 7 cut(s) 630, 2206, 2500, 3010, 3386, 3643, 3653
ApeKI GCWGC 9 cut(s) 53, 188, 263, 266, 1215, 2324, 2377, 2469, 3707
Asp700I GAANNNNTTC 4 cut(s) 300, 837, 3060, 3189
AspLEI GCGC 1 cut(s) 193
AspS9I GGNCC 4 cut(s) 1068, 2165, 3644, 3654
AsuHPI GGTGA 9 cut(s) 637, 716, 1296, 1409, 1525, 1712, 2384, 2926, 3542
AvaI CYCGRG 2 cut(s) 3443, 3617
AvaII GGWCC 2 cut(s) 1068, 2165
BamHI GGATCC 1 cut(s) 32
BanII GRGCYC 5 cut(s) 147, 2637, 2886, 3027, 3249
BarI GAAGNNNNNNTAC 2 cut(s) 64, 96
BbsI GAAGAC 3 cut(s) 109, 353, 1157
Bbv12I GWGCWC 2 cut(s) 147, 2637
BbvI GCAGC 9 cut(s) 40, 175, 250, 278, 1227, 2336, 2364, 2456, 3694
BceAI ACGGC 3 cut(s) 617, 2332, 3159
BcgI CGANNNNNNTGC 2 cut(s) 334, 368
BciT130I CCWGG 3 cut(s) 648, 997, 1585
BciVI GTATCC 1 cut(s) 1591
BclI TGATCA 3 cut(s) 94, 1057, 2028
BcoDI GTCTC 8 cut(s) 797, 1807, 1856, 2428, 3405, 3516, 3549, 3632
BfmI CTRYAG 1 cut(s) 264
BfrI CTTAAG 1 cut(s) 1843
BfuI GTATCC 1 cut(s) 1591
BglII AGATCT 2 cut(s) 1915, 2519
BmcAI AGTACT 1 cut(s) 2891
Bme1390I CCNGG 3 cut(s) 648, 997, 1585
Bme18I GGWCC 2 cut(s) 1068, 2165
BmeRI GACNNNNNGTC 1 cut(s) 3294
BmeT110I CYCGRG 2 cut(s) 3443, 3617
BmgT120I GGNCC 4 cut(s) 1068, 2165, 3644, 3654
BmiI GGNNCC 7 cut(s) 34, 1351, 2166, 2364, 2885, 3026, 3646
BmrFI CCNGG 3 cut(s) 648, 997, 1585
BoxI GACNNNNGTC 1 cut(s) 1611
BpiI GAAGAC 3 cut(s) 109, 353, 1157
BpmI CTGGAG 7 cut(s) 335, 517, 1505, 1647, 2870, 2957, 3325
Bpu10I CCTNAGC 1 cut(s) 3390
Bsa29I ATCGAT 2 cut(s) 309, 394
BsaAI YACGTR 2 cut(s) 745, 1838
BsaBI GATNNNNATC 3 cut(s) 912, 1101, 2807
BsaHI GRCGYC 1 cut(s) 3318
BsaI GGTCTC 1 cut(s) 3632
BsaJI CCNNGG 2 cut(s) 996, 3633
BsaXI ACNNNNNCTCC 6 cut(s) 51, 81, 2658, 2688, 2882, 2912
Bsc4I CCNNNNNNNGG 7 cut(s) 206, 431, 653, 2498, 2663, 2980, 3619
Bse118I RCCGGY 1 cut(s) 3641
Bse1I ACTGG 5 cut(s) 236, 474, 1488, 2584, 2887
Bse3DI GCAATG 2 cut(s) 506, 1468
Bse8I GATNNNNATC 3 cut(s) 912, 1101, 2807
BseBI CCWGG 3 cut(s) 648, 997, 1585
BseCI ATCGAT 2 cut(s) 309, 394
BseDI CCNNGG 2 cut(s) 996, 3633
BseJI GATNNNNATC 3 cut(s) 912, 1101, 2807
BseLI CCNNNNNNNGG 7 cut(s) 206, 431, 653, 2498, 2663, 2980, 3619
BseMI GCAATG 2 cut(s) 506, 1468
BseMII CTCAG 4 cut(s) 1851, 2556, 3471, 3729
BseNI ACTGG 5 cut(s) 236, 474, 1488, 2584, 2887
BseRI GAGGAG 3 cut(s) 75, 815, 2192
BseXI GCAGC 9 cut(s) 40, 175, 250, 278, 1227, 2336, 2364, 2456, 3694
BseYI CCCAGC 2 cut(s) 2111, 2789
BsgI GTGCAG 3 cut(s) 2294, 2878, 3019
BshFI GGCC 7 cut(s) 632, 2208, 2502, 3012, 3388, 3645, 3655
BshVI ATCGAT 2 cut(s) 309, 394
BsiHKAI GWGCWC 2 cut(s) 147, 2637
BsiHKCI CYCGRG 2 cut(s) 3443, 3617
BsiSI CCGG 3 cut(s) 57, 1149, 3642
BslFI GGGAC 3 cut(s) 334, 447, 2772
BslI CCNNNNNNNGG 7 cut(s) 206, 431, 653, 2498, 2663, 2980, 3619
BsmAI GTCTC 8 cut(s) 797, 1807, 1856, 2428, 3405, 3516, 3549, 3632
BsmBI CGTCTC 1 cut(s) 797
BsmFI GGGAC 3 cut(s) 334, 447, 2772
BsmI GAATGC 6 cut(s) 789, 1201, 1431, 1544, 2266, 3792
BsnI GGCC 7 cut(s) 632, 2208, 2502, 3012, 3388, 3645, 3655
Bso31I GGTCTC 1 cut(s) 3632
BsoBI CYCGRG 2 cut(s) 3443, 3617
Bsp1286I GDGCHC 5 cut(s) 147, 2637, 2886, 3027, 3249
BspACI CCGC 9 cut(s) 51, 65, 426, 528, 850, 943, 1175, 2319, 2767
BspANI GGCC 7 cut(s) 632, 2208, 2502, 3012, 3388, 3645, 3655
BspCNI CTCAG 4 cut(s) 1852, 2557, 3472, 3730
BspDI ATCGAT 2 cut(s) 309, 394
BspHI TCATGA 3 cut(s) 441, 1615, 1690
BspLI GGNNCC 7 cut(s) 34, 1351, 2166, 2364, 2885, 3026, 3646
BspMAI CTGCAG 1 cut(s) 268
BspPI GGATC 9 cut(s) 27, 40, 147, 314, 390, 1091, 1109, 1369, 2816
BspQI GCTCTTC 1 cut(s) 3480
BspTI CTTAAG 1 cut(s) 1843
BspTNI GGTCTC 1 cut(s) 3632
BsrBI CCGCTC 2 cut(s) 65, 2767
BsrDI GCAATG 2 cut(s) 506, 1468
BsrFI RCCGGY 1 cut(s) 3641
BsrI ACTGG 5 cut(s) 236, 474, 1488, 2584, 2887
BssAI RCCGGY 1 cut(s) 3641
BssECI CCNNGG 2 cut(s) 996, 3633
BssNI GRCGYC 1 cut(s) 3318
BssT1I CCWWGG 1 cut(s) 3633
Bst2UI CCWGG 3 cut(s) 648, 997, 1585
Bst4CI ACNGT 2 cut(s) 253, 973
BstACI GRCGYC 1 cut(s) 3318
BstAFI CTTAAG 1 cut(s) 1843
BstAPI GCANNNNNTGC 1 cut(s) 2261
BstBAI YACGTR 2 cut(s) 745, 1838
BstC8I GCNNGC 6 cut(s) 219, 373, 673, 1961, 2266, 3705
BstENI CCTNNNNNAGG 1 cut(s) 3617
BstHHI GCGC 1 cut(s) 193
BstMAI GTCTC 8 cut(s) 797, 1807, 1856, 2428, 3405, 3516, 3549, 3632
BstMWI GCNNNNNNNGC 4 cut(s) 11, 62, 263, 2261
BstNI CCWGG 3 cut(s) 648, 997, 1585
BstNSI RCATGY 5 cut(s) 375, 1721, 2237, 3703, 3707
BstPAI GACNNNNGTC 1 cut(s) 1611
BstSCI CCNGG 3 cut(s) 646, 995, 1583
BstSFI CTRYAG 1 cut(s) 264
BstSNI TACGTA 1 cut(s) 745
BstV1I GCAGC 9 cut(s) 40, 175, 250, 278, 1227, 2336, 2364, 2456, 3694
BstV2I GAAGAC 3 cut(s) 109, 353, 1157
BstX2I RGATCY 4 cut(s) 32, 1114, 1915, 2519
BstYI RGATCY 4 cut(s) 32, 1114, 1915, 2519
Bsu15I ATCGAT 2 cut(s) 309, 394
BsuI GTATCC 1 cut(s) 1591
BsuRI GGCC 7 cut(s) 632, 2208, 2502, 3012, 3388, 3645, 3655
BsuTUI ATCGAT 2 cut(s) 309, 394
BtgZI GCGATG 1 cut(s) 2806
BtsIMutI CAGTG 1 cut(s) 969
Cac8I GCNNGC 6 cut(s) 219, 373, 673, 1961, 2266, 3705
CaiI CAGNNNCTG 1 cut(s) 3052
CciI TCATGA 3 cut(s) 441, 1615, 1690
CfoI GCGC 1 cut(s) 193
Cfr10I RCCGGY 1 cut(s) 3641
Cfr13I GGNCC 4 cut(s) 1068, 2165, 3644, 3654
ClaI ATCGAT 2 cut(s) 309, 394
CseI GACGC 1 cut(s) 3326
Csp6I GTAC 7 cut(s) 90, 742, 884, 2348, 2577, 2583, 2890
CviQI GTAC 7 cut(s) 90, 742, 884, 2348, 2577, 2583, 2890
DraI TTTAAA 3 cut(s) 1299, 2305, 3435
DriI GACNNNNNGTC 1 cut(s) 3294
EaeI YGGCCR 2 cut(s) 630, 2500
Eam1105I GACNNNNNGTC 1 cut(s) 3294
EciI GGCGGA 1 cut(s) 517
Ecl136II GAGCTC 2 cut(s) 145, 2635
Eco105I TACGTA 1 cut(s) 745
Eco130I CCWWGG 1 cut(s) 3633
Eco147I AGGCCT 1 cut(s) 3012
Eco24I GRGCYC 5 cut(s) 147, 2637, 2886, 3027, 3249
Eco31I GGTCTC 1 cut(s) 3632
Eco32I GATATC 1 cut(s) 18
Eco47I GGWCC 2 cut(s) 1068, 2165
Eco53kI GAGCTC 2 cut(s) 145, 2635
Eco57I CTGAAG 5 cut(s) 347, 1594, 2682, 2888, 3029
Eco88I CYCGRG 2 cut(s) 3443, 3617
EcoICRI GAGCTC 2 cut(s) 145, 2635
EcoNI CCTNNNNNAGG 1 cut(s) 3617
EcoO109I RGGNCCY 1 cut(s) 2165
EcoRII CCWGG 3 cut(s) 646, 995, 1583
EcoRV GATATC 1 cut(s) 18
EcoT14I CCWWGG 1 cut(s) 3633
EcoT22I ATGCAT 2 cut(s) 1203, 3705
EcoT38I GRGCYC 5 cut(s) 147, 2637, 2886, 3027, 3249
ErhI CCWWGG 1 cut(s) 3633
Esp3I CGTCTC 1 cut(s) 797
FalI AAGNNNNNCTT 2 cut(s) 2270, 2302
FaqI GGGAC 3 cut(s) 334, 447, 2772
FauI CCCGC 2 cut(s) 433, 2312
FbaI TGATCA 3 cut(s) 94, 1057, 2028
FriOI GRGCYC 5 cut(s) 147, 2637, 2886, 3027, 3249
GlaI GCGC 1 cut(s) 192
GsaI CCCAGC 2 cut(s) 2115, 2793
GsuI CTGGAG 7 cut(s) 335, 517, 1505, 1647, 2870, 2957, 3325
HaeIII GGCC 7 cut(s) 632, 2208, 2502, 3012, 3388, 3645, 3655
HapII CCGG 3 cut(s) 57, 1149, 3642
HgaI GACGC 1 cut(s) 3326
HhaI GCGC 1 cut(s) 193
Hin1I GRCGYC 1 cut(s) 3318
Hin6I GCGC 1 cut(s) 191
HinP1I GCGC 1 cut(s) 191
HindIII AAGCTT 1 cut(s) 1192
HpaII CCGG 3 cut(s) 57, 1149, 3642
HphI GGTGA 9 cut(s) 637, 716, 1296, 1409, 1525, 1712, 2384, 2926, 3542
Hpy166II GTNNAC 2 cut(s) 742, 1784
Hpy8I GTNNAC 2 cut(s) 742, 1784
Hpy99I CGWCG 1 cut(s) 783
HpyCH4III ACNGT 2 cut(s) 253, 973
HpyCH4IV ACGT 6 cut(s) 744, 778, 1837, 2149, 2160, 2554
HpyF10VI GCNNNNNNNGC 4 cut(s) 11, 62, 263, 2261
HpySE526I ACGT 6 cut(s) 744, 778, 1837, 2149, 2160, 2554
Hsp92I GRCGYC 1 cut(s) 3318
HspAI GCGC 1 cut(s) 191
Ksp22I TGATCA 3 cut(s) 94, 1057, 2028
LguI GCTCTTC 1 cut(s) 3480
LmnI GCTCC 5 cut(s) 62, 2561, 2889, 3030, 3310
Lsp1109I GCAGC 9 cut(s) 40, 175, 250, 278, 1227, 2336, 2364, 2456, 3694
MaeII ACGT 6 cut(s) 744, 778, 1837, 2149, 2160, 2554
MaeIII GTNAC 8 cut(s) 763, 979, 1302, 2086, 2150, 2282, 3206, 3369
MbiI CCGCTC 2 cut(s) 65, 2767
MfeI CAATTG 6 cut(s) 98, 2172, 2198, 2476, 2909, 3291
MflI RGATCY 4 cut(s) 32, 1114, 1915, 2519
MhlI GDGCHC 5 cut(s) 147, 2637, 2886, 3027, 3249
MlyI GAGTC 7 cut(s) 429, 1858, 2290, 2430, 3101, 3511, 3518
MmeI TCCRAC 6 cut(s) 532, 776, 840, 1402, 2961, 3753
Mph1103I ATGCAT 2 cut(s) 1203, 3705
MroXI GAANNNNTTC 4 cut(s) 300, 837, 3060, 3189
MslI CAYNNNNRTG 3 cut(s) 2046, 2289, 2305
MspA1I CMGCKG 3 cut(s) 53, 428, 2660
MspCI CTTAAG 1 cut(s) 1843
MspI CCGG 3 cut(s) 57, 1149, 3642
MspR9I CCNGG 3 cut(s) 648, 997, 1585
MunI CAATTG 6 cut(s) 98, 2172, 2198, 2476, 2909, 3291
Mva1269I GAATGC 6 cut(s) 789, 1201, 1431, 1544, 2266, 3792
MvaI CCWGG 3 cut(s) 648, 997, 1585
MwoI GCNNNNNNNGC 4 cut(s) 11, 62, 263, 2261
NlaIV GGNNCC 7 cut(s) 34, 1351, 2166, 2364, 2885, 3026, 3646
NmeAIII GCCGAG 1 cut(s) 2478
NmuCI GTSAC 5 cut(s) 763, 979, 1302, 2282, 3206
NsiI ATGCAT 2 cut(s) 1203, 3705
NspI RCATGY 5 cut(s) 375, 1721, 2237, 3703, 3707
PaeI GCATGC 2 cut(s) 375, 3707
PaeR7I CTCGAG 1 cut(s) 3617
PagI TCATGA 3 cut(s) 441, 1615, 1690
PceI AGGCCT 1 cut(s) 3012
PciI ACATGT 2 cut(s) 1717, 2233
PciSI GCTCTTC 1 cut(s) 3480
PctI GAATGC 6 cut(s) 789, 1201, 1431, 1544, 2266, 3792
PdmI GAANNNNTTC 4 cut(s) 300, 837, 3060, 3189
PflMI CCANNNNNTGG 1 cut(s) 2980
PleI GAGTC 7 cut(s) 429, 1858, 2289, 2430, 3101, 3511, 3517
PpsI GAGTC 7 cut(s) 429, 1858, 2289, 2430, 3101, 3511, 3517
Ppu21I YACGTR 2 cut(s) 745, 1838
PpuMI RGGWCCY 1 cut(s) 2165
PscI ACATGT 2 cut(s) 1717, 2233
PshAI GACNNNNGTC 1 cut(s) 1611
PsiI TTATAA 1 cut(s) 3603
Psp124BI GAGCTC 2 cut(s) 147, 2637
Psp5II RGGWCCY 1 cut(s) 2165
Psp6I CCWGG 3 cut(s) 646, 995, 1583
PspFI CCCAGC 2 cut(s) 2111, 2789
PspGI CCWGG 3 cut(s) 646, 995, 1583
PspN4I GGNNCC 7 cut(s) 34, 1351, 2166, 2364, 2885, 3026, 3646
PspPI GGNCC 4 cut(s) 1068, 2165, 3644, 3654
PspPPI RGGWCCY 1 cut(s) 2165
PspXI VCTCGAGB 1 cut(s) 3617
PstI CTGCAG 1 cut(s) 268
PstNI CAGNNNCTG 1 cut(s) 3052
PsuI RGATCY 4 cut(s) 32, 1114, 1915, 2519
PvuII CAGCTG 1 cut(s) 2660
RsaI GTAC 7 cut(s) 91, 743, 885, 2349, 2578, 2584, 2891
RsaNI GTAC 7 cut(s) 90, 742, 884, 2348, 2577, 2583, 2890
RseI CAYNNNNRTG 3 cut(s) 2046, 2289, 2305
SacI GAGCTC 2 cut(s) 147, 2637
SapI GCTCTTC 1 cut(s) 3480
Sau96I GGNCC 4 cut(s) 1068, 2165, 3644, 3654
ScaI AGTACT 1 cut(s) 2891
SchI GAGTC 7 cut(s) 429, 1858, 2290, 2430, 3101, 3511, 3518
ScrFI CCNGG 3 cut(s) 648, 997, 1585
SduI GDGCHC 5 cut(s) 147, 2637, 2886, 3027, 3249
SfcI CTRYAG 1 cut(s) 264
Sfr274I CTCGAG 1 cut(s) 3617
SinI GGWCC 2 cut(s) 1068, 2165
SlaI CTCGAG 1 cut(s) 3617
SmiI ATTTAAAT 1 cut(s) 2305
SmiMI CAYNNNNRTG 3 cut(s) 2046, 2289, 2305
SnaBI TACGTA 1 cut(s) 745
SphI GCATGC 2 cut(s) 375, 3707
SseBI AGGCCT 1 cut(s) 3012
SsiI CCGC 9 cut(s) 51, 65, 426, 528, 850, 943, 1175, 2319, 2767
SspI AATATT 1 cut(s) 2610
SstI GAGCTC 2 cut(s) 147, 2637
StuI AGGCCT 1 cut(s) 3012
StyD4I CCNGG 3 cut(s) 646, 995, 1583
StyI CCWWGG 1 cut(s) 3633
SwaI ATTTAAAT 1 cut(s) 2305
TaaI ACNGT 2 cut(s) 253, 973
TaiI ACGT 6 cut(s) 747, 781, 1840, 2152, 2163, 2557
TatI WGTACW 3 cut(s) 883, 2347, 2889
TauI GCSGC 2 cut(s) 946, 1178
TscAI CASTG 1 cut(s) 976
TseFI GTSAC 5 cut(s) 763, 979, 1302, 2282, 3206
TseI GCWGC 9 cut(s) 53, 188, 263, 266, 1215, 2324, 2377, 2469, 3707
Tsp45I GTSAC 5 cut(s) 763, 979, 1302, 2282, 3206
TspGWI ACGGA 5 cut(s) 1666, 1741, 2409, 2822, 3194
TspRI CASTG 1 cut(s) 976
Van91I CCANNNNNTGG 1 cut(s) 2980
Vha464I CTTAAG 1 cut(s) 1843
VpaK11BI GGWCC 2 cut(s) 1068, 2165
XagI CCTNNNNNAGG 1 cut(s) 3617
XbaI TCTAGA 2 cut(s) 1039, 1912
XceI RCATGY 5 cut(s) 375, 1721, 2237, 3703, 3707
XhoI CTCGAG 1 cut(s) 3617
XmnI GAANNNNTTC 4 cut(s) 300, 837, 3060, 3189
ZrmI AGTACT 1 cut(s) 2891
Zsp2I ATGCAT 2 cut(s) 1203, 3705
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.