Rmu_sc0018885.1_g000001

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018885.1
OG0000029
Physical Location & Seq
Reverse (-)
3070 .. 11770
8701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018885.1_g000001.1.cds

Sequence Viewer

Length: 4557 bp
atggttgtgctctctctccttacttctgctgccggaggagcgctgagtaaggtggcttcacttgctactgatcaattgggactcgatatcgtctgctgtttccgcaaagagctttataagctccaagtatcctcagatcagattggggatatgatccatgatgctgcgcacgaacccgaagatcggaaactgcgggcaagggccaggtggatgcagaggcttataggcgtagctcatgatgcagaagatatcttggatgaagttcaatatgaagtagatcggatcgttatagaggagacaagcctggataagaagatactcggcttcttctgcaacaatcctcttgtatttcgtcttcaaatggcacgcaagattaacaacatcaacacatccttggagaatctcaaaacggatgcagccagtgtgggactcgtcagtggaggtgcagcaagcagtcgaagtaagctggatcgggaaacattcccataccttgagaaaaatgaacgcaccgggaaagatgcaaacatggttggaagggataaggttgtgaaagagataattgatagaatgaccgaccccaacaagcaagaaaagattctctcggtgatggccattgtgggattgggaggcctaggtaaaacaactttggcccaattagttaccaagcaactggaagaaggtgaaaggaaagaatacttttatacaaaattatgggtgtctgtatctaaaactctcgatgatgtcaataaaattttacaacatatggtgcaatcatgtgaccggacgtcagcacacctttcaaatcggggcgcattgattgaaagcctccgctacaagttgacagagaaaagggttttcctggtacttgatgatgtttgggatgatagaaaagaaaaatgggatcttttgaagggttgtctgctgcaactaaattttgccagaggaagcactgtgattgtcaccacccgtagcaccagggtagcatcaaatatggaaacacttcctaggtggaatttagaccctttatcggttgatgaatgttggtccatattgaaggacagagcatttgcagatcctgatgcttcgataccttcagaactaaagaaaatcggatgggagattgccaaaaagtgtgccggtcttccattggctgcaaaggttttgggaagtttgatgcgtactaacaacgattggtcgtcaattctgaaaagtccaatatggcaaatatcatccaatgaagaggatagcagcatcatgtcgattttgaggttgagttttgataatatgaaatcaccactgaaacaatgttttgcatattgctccatgctcgagagaggttcctcaattaaaagagataaattgatccaactatggatggctcaaggtttgctcaatcattctcaaaatcacaacagcaaccaaccgattgaaatggaggatataggcaagaagtattttgataatctactggagaactccttgtttcaagatgctacagaagaggatgaggatggcgttatcatcaaatgcaagatgcacgatcttgtgcatgatcttgcaaacgaagtatccaagtgtgagagcttgacaccggacttcaacgatgagatggatgattttgagattcgacatgttgcatggtttcctactccaaaactagaaagaatgccagaaacaagtatttcaaaactgcgctcgctcttgtcaaatgtccaggtctttgatatcatttttccaaagttaagagctttacgtgtcttaagtttgaagcacttgagtaatctagatctttcctatatggaaactgaagcacttggtaagctgaagcacttgaggtatctagatctttccgatacaaaaatcaaagcactcccggagtctattggcaagctctataacctccaaacattgaggttaccgtggaatctcagagagtgtccaaaggagattcaaaatttgatcaacttgaggcatctttattatggtgcgaaaatgaaatttgaggctgggattttggggcgattaactaatctccgaacattgcctttctttaatgtgggtgaggagagaggtcatgcaattaaggagttgggtgggctgaaccaactgagaggccacttaattatttctaagctaaaacatgtaagggatggagaagaagcaaagaaggctcgcttagtgcagaagagtcacttaagtgggttaacatttagatggacaggtaatgaaaatgagactgatgtactagatggcttagaacctcatggtaacttgcaaagcttgaacattgaatatttcatgggtgctagatttccgtcatggataacgaatctccaaaatttgaagcagattcgattatacggatgtgacagttgtgaaggagtcccaacacttggccatctacctaatctaagatatcttgagattgatgggataggcaagctgaaacgtgtgggagctgagttttatggtactggtacaacttcatttccagctctgaaaacactatctatctatgagtgcgaagagctcattgaatggatggaagcaccgaggatatcagctgaaggagaagttgtggtatttccttgcctcgatgagttgtatctcagttactgtcgtaaattgagaaatgctccgagtcgttttccacgtctcaagaggttggagatgtatggaatgggtaacagcatgccaatagaaaatataagcactaaacttaccactctcacttacctcaaaataagtgatgtagagggactcacttgtctaccggacgggatgctgaacaataacaataatctcacacatttagaggtaagtgattgtgatgagttgacgtgtattgcttttgatgtatctgacacgcttcctcttcttgaggagttgaggatacatggttgtgacagcctagagtcgattcggatcacacagggcatcgcatctctccgtcaattgaacatctggagctgtaagggattatcaagcttagaggttgggctcgactactgcacctctcttcaggagttgagtatactgggttgccctattctggtttcaattccaatcgcacagttcatgccgtctctccggaaattgacggttaaacattgtgacggattgtcaagcctaggaagtgggctcaactactgcacctctcttcaggaattggagattaggtattgtcaaaatctaacatcaattccaatcacacagggcatcacatctctccgagaattgaagattgatagttgttggagtttattaagcctaccgagtgggctccaattctgcacttctcttcagcgtctggaaataaggcattgctatagtctagtatccatttcagtatcatatgtgtgcgaccacccagactcaacgaaacaaccggaggaaatttctcaaggtgttgatgcgtatttgtctttaccggaggattgccgtactgtagaatctattccacctaatctccgtcagttgttgatatgttactgtgggaaattaaaatatgtgcccacaggatttcaccacctcactcgtttgaagacgctccaaattggtgcgttctggaaagagctggacgccttccctgattttcagcttccacctaattcacaacttgaagagttatgcttgtttgggtggcctaagctcaagtctctgccccaacaagttcagcacttgacttgtctaaggtttcttgagatgtatacatttatgggactagaggctcttcctgagtggttgggaactcttacatctcttgaggatctaagaatcttcgattgtgagaatctaaagtatctacctgcacaaaatgccatgaaaaacctcaccaaattggagcacctcgttggtggaggatgttccctgctcaaagaaagatgcaccaagggaactggcccagaatggcccaagatttctcacattccaaccgtttacagttatgatccagtcccagtagttcattcacctctcccatgtacagcttgtctgctgtgtttcattgaagataaggtgttaatcagcatcagctatgagagtgagaaattgagaagtatccacctaaagtggaaggaggattgccctagtctaaaatctattccacctaatctctgtcagttgttgatatgtgattgtgggaatttaaaatatgttcccagaggatttcaccgcctcactcgtctcaaggagctgaaaattggtgcgttctgggaggagctggacgccttccctgattttcagcttccaccactacttgaacacttggagttggagagctatgcagacaaaagatgcattgtggacagccaacgtgagtggctgacttcttattttccagaggtctgcattgaagctatgagacacctccttaaactagcacagttggatattcatggggttcaagttccaggggaaacatgtgcgttgagtgtttcaaaatttcagttgtgcatgattgcttccattcatgttctaagtgcaaccagttcccaaaatcatggctctgtcctgctcaaatggaagaacaacttaactggacctggtgtgaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03460 ko04014 map03460 map04014
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

1518

Amino Acids

171.72

Weight (kDa)

6.17

Isoelectric Point (pI)

44.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000029)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g13530 FvH4_4g18270 FvH4_6g12200 FvH4_6g12460 FvH4_6g12461 FvH4_6g13450 FvH4_6g15090 FvH4_6g15220 FvH4_6g15230 FvH4_6g15250 FvH4_6g15251 FvH4_6g15340 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47050 FvH4_6g47980 FvH4_6g47980 FvH4_6g47980 FvH4_6g48170 FvH4_6g48310 FvH4_6g48310 FvH4_6g48850 FvH4_6g48881 FvH4_7g11830
malus_domestica MD02G1059900.v1.1 MD02G1069600.v1.1 MD02G1069700.v1.1 MD02G1070100.v1.1 MD02G1070200.v1.1 MD02G1070300.v1.1 MD02G1070800.v1.1 MD02G1070900.v1.1 MD02G1071200.v1.1 MD02G1071400.v1.1 MD02G1071900.v1.1 MD02G1075200.v1.1 MD03G1048000.v1.1 MD03G1049100.v1.1 MD03G1049200.v1.1 MD03G1052500.v1.1 MD03G1054100.v1.1 MD03G1054300.v1.1 MD03G1054400.v1.1 MD04G1113400.v1.1 MD04G1211100.v1.1 MD04G1211200.v1.1 MD05G1174900.v1.1 MD05G1175000.v1.1 MD05G1175900.v1.1 MD05G1243400.v1.1 MD07G1031500.v1.1 MD07G1031600.v1.1 MD07G1032500.v1.1 MD11G1046800.v1.1 MD11G1046900.v1.1 MD11G1047000.v1.1 MD11G1050400.v1.1 MD11G1050600.v1.1 MD11G1050800.v1.1 MD11G1051100.v1.1 MD11G1051600.v1.1 MD11G1051700.v1.1 MD11G1054600.v1.1 MD11G1055600.v1.1 MD11G1055700.v1.1 MD11G1055800.v1.1 MD11G1056000.v1.1 MD12G1126600.v1.1 MD12G1126700.v1.1 MD12G1126800.v1.1 MD12G1127300.v1.1 MD12G1127600.v1.1 MD12G1127900.v1.1 MD12G1128100.v1.1 MD12G1128300.v1.1 MD15G1261500.v1.1
prunus_persica Prupe.1G010700_v2.0.a1 Prupe.1G010800_v2.0.a1 Prupe.1G011000_v2.0.a1 Prupe.1G159600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163600_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163700_v2.0.a1 Prupe.1G163800_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G164000_v2.0.a1 Prupe.1G235500_v2.0.a1 Prupe.2G067400_v2.0.a1 Prupe.2G067500_v2.0.a1 Prupe.2G111700_v2.0.a1 Prupe.2G111800_v2.0.a1 Prupe.3G012000_v2.0.a1 Prupe.6G243400_v2.0.a1 Prupe.6G243500_v2.0.a1 Prupe.6G243600_v2.0.a1 Prupe.6G243700_v2.0.a1 Prupe.6G243800_v2.0.a1 Prupe.6G243900_v2.0.a1
pyrus_communis pycom02g04860 pycom02g04880 pycom02g04890 pycom02g05510 pycom02g05520 pycom02g05600 pycom02g05930 pycom02g06000 pycom02g06010 pycom03g03800 pycom03g03860 pycom03g03880 pycom03g03890 pycom03g03910 pycom03g03920 pycom03g04200 pycom03g04290 pycom03g04300 pycom03g04310 pycom03g04320 pycom03g09260 pycom04g10150 pycom04g10160 pycom04g10170 pycom05g16180 pycom05g16190 pycom05g16240 pycom05g21980 pycom05g21990 pycom07g02280 pycom11g03800 pycom11g03810 pycom11g04080 pycom11g04140 pycom11g04150 pycom11g04160 pycom11g04570 pycom11g04580 pycom11g04590 pycom11g04610 pycom12g12470 pycom12g12490 pycom13g22050
rosa_chinensis RchiOBHm_Chr1g0317761 RchiOBHm_Chr1g0317821 RchiOBHm_Chr1g0317831 RchiOBHm_Chr1g0317871 RchiOBHm_Chr1g0350501 RchiOBHm_Chr2g0107631 RchiOBHm_Chr3g0452091 RchiOBHm_Chr3g0464001 RchiOBHm_Chr3g0464281 RchiOBHm_Chr3g0466331 RchiOBHm_Chr3g0467341 RchiOBHm_Chr3g0467381 RchiOBHm_Chr3g0467731 RchiOBHm_Chr3g0468291 RchiOBHm_Chr3g0468321 RchiOBHm_Chr3g0468341 RchiOBHm_Chr3g0468391 RchiOBHm_Chr3g0468411 RchiOBHm_Chr3g0468571 RchiOBHm_Chr3g0468591 RchiOBHm_Chr3g0490721 RchiOBHm_Chr3g0490751 RchiOBHm_Chr3g0490761 RchiOBHm_Chr3g0490771 RchiOBHm_Chr3g0490951 RchiOBHm_Chr3g0491001 RchiOBHm_Chr3g0491011 RchiOBHm_Chr4g0412461 RchiOBHm_Chr4g0414161 RchiOBHm_Chr4g0414181 RchiOBHm_Chr4g0414191 RchiOBHm_Chr4g0414281 RchiOBHm_Chr4g0414441 RchiOBHm_Chr4g0414521 RchiOBHm_Chr4g0414531 RchiOBHm_Chr4g0417011 RchiOBHm_Chr4g0417021 RchiOBHm_Chr4g0417041 RchiOBHm_Chr4g0417071 RchiOBHm_Chr4g0417101 RchiOBHm_Chr4g0417531 RchiOBHm_Chr4g0417641 RchiOBHm_Chr4g0417651 RchiOBHm_Chr4g0417701 RchiOBHm_Chr4g0417731 RchiOBHm_Chr4g0417741 RchiOBHm_Chr4g0417781 RchiOBHm_Chr4g0418751 RchiOBHm_Chr4g0418791 RchiOBHm_Chr4g0418861 RchiOBHm_Chr4g0418881 RchiOBHm_Chr4g0418901 RchiOBHm_Chr4g0422451 RchiOBHm_Chr4g0422461 RchiOBHm_Chr4g0422471 RchiOBHm_Chr4g0422541 RchiOBHm_Chr4g0422561 RchiOBHm_Chr4g0422591 RchiOBHm_Chr4g0422651 RchiOBHm_Chr4g0422661 RchiOBHm_Chr5g0003251 RchiOBHm_Chr5g0003261 RchiOBHm_Chr5g0055871 RchiOBHm_Chr7g0204701 RchiOBHm_Chr7g0204741
rosa_laevigata RLG00000007607 RLG00000007932 RLG00000017606 RLG00000024418 RLG00000025629 RLG00000030586
rosa_multiflora Rmu_co7959167.1_g000001 Rmu_co8021330.1_g000001 Rmu_co8132128.1_g000001 Rmu_co8224744.1_g000001 Rmu_co8281865.1_g000001 Rmu_co8298487.1_g000001 Rmu_co8319035.1_g000001 Rmu_co8380035.1_g000001 Rmu_co8385371.1_g000001 Rmu_co8398173.1_g000001 Rmu_co8423363.1_g000001 Rmu_co8438275.1_g000001 Rmu_co8474729.1_g000001 Rmu_sc0000057.1_g000008 Rmu_sc0000350.1_g000023 Rmu_sc0000480.1_g000005 Rmu_sc0000654.1_g000021 Rmu_sc0000654.1_g000029 Rmu_sc0000654.1_g000032 Rmu_sc0000654.1_g000041 Rmu_sc0000654.1_g000045 Rmu_sc0000772.1_g000002 Rmu_sc0000772.1_g000041 Rmu_sc0000808.1_g000040 Rmu_sc0000830.1_g000062 Rmu_sc0000830.1_g000065 Rmu_sc0000830.1_g000072 Rmu_sc0000830.1_g000073 Rmu_sc0000935.1_g000020 Rmu_sc0000935.1_g000024 Rmu_sc0000935.1_g000026 Rmu_sc0000935.1_g000027 Rmu_sc0000935.1_g000031 Rmu_sc0000935.1_g000033 Rmu_sc0000962.1_g000033 Rmu_sc0000962.1_g000036 Rmu_sc0000962.1_g000063 Rmu_sc0000962.1_g000064 Rmu_sc0000962.1_g000065 Rmu_sc0001029.1_g000007 Rmu_sc0001063.1_g000014 Rmu_sc0001149.1_g000010 Rmu_sc0001149.1_g000011 Rmu_sc0001358.1_g000009 Rmu_sc0001448.1_g000003 Rmu_sc0001448.1_g000004 Rmu_sc0001729.1_g000005 Rmu_sc0001729.1_g000007 Rmu_sc0001729.1_g000020 Rmu_sc0001729.1_g000023 Rmu_sc0001793.1_g000015 Rmu_sc0002494.1_g000018 Rmu_sc0002494.1_g000019 Rmu_sc0002604.1_g000022 Rmu_sc0002922.1_g000011 Rmu_sc0003008.1_g000009 Rmu_sc0003221.1_g000061 Rmu_sc0003221.1_g000062 Rmu_sc0003459.1_g000014 Rmu_sc0003480.1_g000015 Rmu_sc0003541.1_g000016 Rmu_sc0003541.1_g000020 Rmu_sc0004035.1_g000001 Rmu_sc0004035.1_g000005 Rmu_sc0004035.1_g000011 Rmu_sc0004142.1_g000004 Rmu_sc0004142.1_g000010 Rmu_sc0004353.1_g000008 Rmu_sc0004616.1_g000009 Rmu_sc0004616.1_g000010 Rmu_sc0005231.1_g000004 Rmu_sc0006380.1_g000025 Rmu_sc0006492.1_g000010 Rmu_sc0006895.1_g000001 Rmu_sc0006895.1_g000002 Rmu_sc0006895.1_g000005 Rmu_sc0007034.1_g000004 Rmu_sc0007104.1_g000006 Rmu_sc0008990.1_g000003 Rmu_sc0008990.1_g000004 Rmu_sc0009106.1_g000003 Rmu_sc0009516.1_g000002 Rmu_sc0009516.1_g000003 Rmu_sc0009516.1_g000004 Rmu_sc0009516.1_g000005 Rmu_sc0009645.1_g000001 Rmu_sc0010274.1_g000001 Rmu_sc0010274.1_g000002 Rmu_sc0010419.1_g000003 Rmu_sc0010917.1_g000017 Rmu_sc0011213.1_g000001 Rmu_sc0011228.1_g000007 Rmu_sc0011538.1_g000011 Rmu_sc0011538.1_g000014 Rmu_sc0011538.1_g000015 Rmu_sc0012211.1_g000006 Rmu_sc0012351.1_g000003 Rmu_sc0012351.1_g000005 Rmu_sc0012915.1_g000002 Rmu_sc0013088.1_g000001 Rmu_sc0013459.1_g000001 Rmu_sc0013765.1_g000004 Rmu_sc0013765.1_g000005 Rmu_sc0014003.1_g000012 Rmu_sc0014003.1_g000014 Rmu_sc0014698.1_g000001 Rmu_sc0015740.1_g000001 Rmu_sc0016429.1_g000003 Rmu_sc0018885.1_g000001 Rmu_sc0020345.1_g000001 Rmu_sc0027791.1_g000001 Rmu_sc0037325.1_g000001 Rmu_ssc0000010.1_g000024 Rmu_ssc0000010.1_g000025 Rmu_ssc0000083.1_g000021 Rmu_ssc0000340.1_g000002 Rmu_ssc0000386.1_g000002 Rmu_ssc0000386.1_g000024 Rmu_ssc0000386.1_g000025 Rmu_ssc0000386.1_g000034 Rmu_ssc0000386.1_g000037 Rmu_ssc0000477.1_g000001
rosa_roxburghii Rroxscaffold_161G00448010 Rroxscaffold_164G00436080 Rroxscaffold_1G00024500 Rroxscaffold_2G00124290 Rroxscaffold_3G00222940 Rroxscaffold_3G00227440 Rroxscaffold_4G00304810 Rroxscaffold_4G00330180 Rroxscaffold_4G00330200 Rroxscaffold_5G00356620 Rroxscaffold_5G00358170 Rroxscaffold_5G00360880 Rroxscaffold_5G00361220 Rroxscaffold_5G00361950 Rroxscaffold_5G00361960 Rroxscaffold_5G00361990 Rroxscaffold_5G00362370 Rroxscaffold_5G00364540 Rroxscaffold_5G00364550 Rroxscaffold_5G00364580 Rroxscaffold_5G00364600 Rroxscaffold_6G00393290 Rroxscaffold_6G00412680 Rroxscaffold_6G00412790 Rroxscaffold_6G00413470 Rroxscaffold_6G00413720 Rroxscaffold_6G00416070 Rroxscaffold_7G00205400
rosa_rugosa Rorug01G0017300 Rorug01G0017400 Rorug01G0018000 Rorug01G0018100 Rorug01G0211500 Rorug02G0638200 Rorug03G0070000 Rorug03G0071200 Rorug03G0081000 Rorug03G0086500 Rorug03G0089300 Rorug03G0095300 Rorug03G0096000 Rorug03G0096000 Rorug04G0055000 Rorug04G0078300 Rorug04G0104100.1 Rorug04G0113800 Rorug04G0126700 Rorug04G0128000 Rorug04G0145900 Rorug04G0148700 Rorug04G0149100 Rorug04G0149100 Rorug04G0149200 Rorug04G0149300 Rorug04G0154900 Rorug04G0180400 Rorug04G0180500 Rorug04G0180700 Rorug04G0180800 Rorug04G0401500 Rorug04G0402100 Rorug05G0288600 Rorug05G0334100 Rorug07G0176400
rosa_samantha Rh1DG043200 Rh1DG043500 Rh1DG043900 Rh1DG222800 Rh3CG039900 Rh3CG156200 Rh3CG328500 Rh3CG328800 Rh3DG165000 Rh4AG208400 Rh4BG205600 Rh4BG213900 Rh4BG243900 Rh4CG198800 Rh4DG168600 Rh4DG180100 Rh4DG180300 Rh4DG180600 Rh4DG181200 Rh4DG181600 Rh4DG181700 Rh4DG183700 Rh4DG184000 Rh4DG184400 Rh4DG184700 Rh4DG206100 Rh4DG206200 Rh4DG206300 Rh4DG215600 Rh4DG238700 Rh4DG238900 Rh5DG390300
rosa_wichuraiana Rw0G005050 Rw0G009260 Rw0G009280 Rw0G015600 Rw0G023570 Rw1G002140 Rw1G002170 Rw1G002210 Rw1G002240 Rw1G019500 Rw2G015490 Rw3G003020 Rw3G010900 Rw3G012030 Rw3G012790 Rw3G013050 Rw3G013540 Rw3G013640 Rw3G013650 Rw3G026050 Rw3G026070 Rw4G015740 Rw4G015790 Rw4G015910 Rw4G015930 Rw4G015950 Rw4G017900 Rw4G017930 Rw4G018440 Rw4G018450 Rw4G018530 Rw4G020720 Rw4G020760 Rw5G019250 Rw5G034370 Rw7G018700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 117
AasI GACNNNNNNGTC 1 cut(s) 2766
AatII GACGTC 1 cut(s) 788
Acc16I TGCGCA 1 cut(s) 168
Acc36I ACCTGC 1 cut(s) 3817
AccB7I CCANNNNNTGG 1 cut(s) 2393
AccI GTMKAC 3 cut(s) 2770, 3034, 3710
AccIII TCCGGA 1 cut(s) 3090
AciI CCGC 4 cut(s) 103, 193, 829, 4174
AclWI GGATC 9 cut(s) 148, 290, 477, 909, 1067, 1357, 2933, 3777, 3944
AcoI YGGCCR 2 cut(s) 609, 2395
AcsI RAATTY 9 cut(s) 750, 931, 1012, 1954, 1997, 2338, 3396, 4144, 4442
AcuI CTGAAG 7 cut(s) 1077, 1827, 1844, 2586, 3005, 3146, 3287
AcyI GRCGYC 3 cut(s) 785, 3582, 4227
AfaI GTAC 7 cut(s) 864, 1180, 2244, 2473, 2479, 3445, 3985
AfeI AGCGCT 1 cut(s) 42
AfiI CCNNNNNNNGG 4 cut(s) 183, 1027, 2393, 3052
AflII CTTAAG 2 cut(s) 1759, 2194
AflIII ACRYGT 6 cut(s) 1630, 1753, 2140, 2449, 2840, 4421
AhdI GACNNNNNGTC 2 cut(s) 784, 3121
AjiI CACGTC 2 cut(s) 2654, 2841
AjnI CCWGG 7 cut(s) 203, 303, 858, 974, 1713, 4411, 4543
AleI CACNNNNGTG 1 cut(s) 2196
Alw21I GWGCWC 3 cut(s) 12, 2532, 3849
Alw26I GTCTC 7 cut(s) 290, 2228, 2660, 3090, 3663, 4190, 4357
AlwI GGATC 9 cut(s) 148, 290, 477, 909, 1067, 1357, 2933, 3777, 3944
AlwNI CAGNNNCTG 3 cut(s) 1076, 2616, 3310
Ama87I CYCGRG 1 cut(s) 1328
Aor13HI TCCGGA 1 cut(s) 3090
Aor51HI AGCGCT 1 cut(s) 42
AoxI GGCC 9 cut(s) 201, 609, 628, 648, 2113, 2395, 3644, 3901, 3911
ApeKI GCWGC 7 cut(s) 29, 164, 416, 446, 922, 1151, 1248
ApoI RAATTY 9 cut(s) 750, 931, 1012, 1954, 1997, 2338, 3396, 4144, 4442
ArsI GACNNNNNNTTYG 2 cut(s) 1049, 1081
Asp700I GAANNNNTTC 3 cut(s) 594, 999, 3456
AspA2I CCTAGG 3 cut(s) 631, 1004, 3130
AspLEI GCGC 4 cut(s) 43, 169, 812, 1695
AspS9I GGNCC 6 cut(s) 201, 649, 1044, 3902, 3912, 4541
AsuC2I CCSGG 2 cut(s) 511, 1874
AsuHPI GGTGA 9 cut(s) 616, 692, 952, 1284, 2072, 3518, 3826, 3963, 4163
AvaI CYCGRG 1 cut(s) 1328
AvaII GGWCC 2 cut(s) 1044, 4541
AvrII CCTAGG 3 cut(s) 631, 1004, 3130
BaeGI GKGCMC 1 cut(s) 3516
BalI TGGCCA 2 cut(s) 611, 2397
BanII GRGCYC 4 cut(s) 2532, 3003, 3144, 3285
BarI GAAGNNNNNNTAC 4 cut(s) 40, 72, 339, 371
BbsI GAAGAC 3 cut(s) 347, 1133, 3551
Bbv12I GWGCWC 3 cut(s) 12, 2532, 3849
BbvI GCAGC 7 cut(s) 16, 151, 428, 458, 909, 1138, 1260
BceAI ACGGC 2 cut(s) 3067, 3426
BciT130I CCWGG 7 cut(s) 205, 305, 860, 976, 1715, 4413, 4545
BciVI GTATCC 5 cut(s) 139, 1579, 2886, 3349, 4070
BclI TGATCA 2 cut(s) 70, 1959
BcnI CCSGG 2 cut(s) 511, 1874
BcoDI GTCTC 7 cut(s) 290, 2228, 2660, 3090, 3663, 4190, 4357
BfmI CTRYAG 3 cut(s) 1494, 3328, 3447
BfoI RGCGCY 1 cut(s) 44
BfrI CTTAAG 2 cut(s) 1759, 2194
BfuAI ACCTGC 1 cut(s) 3817
BfuI GTATCC 5 cut(s) 139, 1579, 2886, 3349, 4070
BglII AGATCT 2 cut(s) 1786, 1843
BisI GCNGC 7 cut(s) 30, 165, 417, 447, 923, 1152, 1249
BlnI CCTAGG 3 cut(s) 631, 1004, 3130
BlsI GCNGC 7 cut(s) 31, 166, 418, 448, 924, 1153, 1250
Bme1390I CCNGG 9 cut(s) 205, 305, 511, 860, 976, 1715, 1874, 4413, 4545
Bme18I GGWCC 2 cut(s) 1044, 4541
BmeRI GACNNNNNGTC 2 cut(s) 784, 3121
BmeT110I CYCGRG 1 cut(s) 1328
BmgBI CACGTC 2 cut(s) 2654, 2841
BmgT120I GGNCC 6 cut(s) 201, 649, 1044, 3902, 3912, 4541
BmiI GGNNCC 2 cut(s) 1339, 3284
BmrFI CCNGG 9 cut(s) 205, 305, 511, 860, 976, 1715, 1874, 4413, 4545
BmrI ACTGGG 2 cut(s) 3047, 3953
BmuI ACTGGG 2 cut(s) 3047, 3953
BpiI GAAGAC 3 cut(s) 347, 1133, 3551
BplI GAGNNNNNCTC 2 cut(s) 2620, 2652
BpmI CTGGAG 2 cut(s) 1490, 2986
Bpu10I CCTNAGC 1 cut(s) 3648
BpuMI CCSGG 2 cut(s) 511, 1874
BsaAI YACGTR 1 cut(s) 1754
BsaBI GATNNNNATC 1 cut(s) 2924
BsaHI GRCGYC 3 cut(s) 785, 3582, 4227
BsaJI CCNNGG 9 cut(s) 393, 631, 975, 1004, 1919, 2552, 3130, 3891, 4412
BsaWI WCCGGW 6 cut(s) 780, 1591, 2773, 3090, 3388, 3430
BsaXI ACNNNNNCTCC 6 cut(s) 2562, 2592, 3164, 3194, 3453, 3483
Bsc4I CCNNNNNNNGG 4 cut(s) 183, 1027, 2393, 3052
Bse118I RCCGGY 1 cut(s) 1136
Bse3DI GCAATG 2 cut(s) 2039, 3322
Bse8I GATNNNNATC 1 cut(s) 2924
BseAI TCCGGA 1 cut(s) 3090
BseBI CCWGG 7 cut(s) 205, 305, 860, 976, 1715, 4413, 4545
BseDI CCNNGG 9 cut(s) 393, 631, 975, 1004, 1919, 2552, 3130, 3891, 4412
BseJI GATNNNNATC 1 cut(s) 2924
BseLI CCNNNNNNNGG 4 cut(s) 183, 1027, 2393, 3052
BseMI GCAATG 2 cut(s) 2039, 3322
BseMII CTCAG 7 cut(s) 35, 147, 1942, 2099, 2451, 2623, 3729
BseRI GAGGAG 5 cut(s) 51, 308, 2078, 2897, 4232
BseSI GKGCMC 1 cut(s) 3516
BseXI GCAGC 7 cut(s) 16, 151, 428, 458, 909, 1138, 1260
BseYI CCCAGC 1 cut(s) 2006
BsgI GTGCAG 6 cut(s) 465, 2201, 2995, 3136, 3277, 3795
BshFI GGCC 9 cut(s) 203, 611, 630, 650, 2115, 2397, 3646, 3903, 3913
BsiHKAI GWGCWC 3 cut(s) 12, 2532, 3849
BsiHKCI CYCGRG 1 cut(s) 1328
BslFI GGGAC 6 cut(s) 93, 441, 2369, 2772, 3735, 3941
BslI CCNNNNNNNGG 4 cut(s) 183, 1027, 2393, 3052
BsmAI GTCTC 7 cut(s) 290, 2228, 2660, 3090, 3663, 4190, 4357
BsmBI CGTCTC 3 cut(s) 2660, 3090, 4190
BsmFI GGGAC 6 cut(s) 93, 441, 2369, 2772, 3735, 3941
BsmI GAATGC 1 cut(s) 1671
BsnI GGCC 9 cut(s) 203, 611, 630, 650, 2115, 2397, 3646, 3903, 3913
BsoBI CYCGRG 1 cut(s) 1328
Bsp1286I GDGCHC 7 cut(s) 12, 2532, 3003, 3144, 3285, 3516, 3849
Bsp13I TCCGGA 1 cut(s) 3090
Bsp1407I TGTACA 1 cut(s) 3983
BspACI CCGC 4 cut(s) 103, 193, 829, 4174
BspANI GGCC 9 cut(s) 203, 611, 630, 650, 2115, 2397, 3646, 3903, 3913
BspCNI CTCAG 7 cut(s) 36, 146, 1941, 2100, 2452, 2622, 3730
BspEI TCCGGA 1 cut(s) 3090
BspHI TCATGA 1 cut(s) 235
BspLI GGNNCC 2 cut(s) 1339, 3284
BspMI ACCTGC 1 cut(s) 3817
BspPI GGATC 9 cut(s) 148, 290, 477, 909, 1067, 1357, 2933, 3777, 3944
BspQI GCTCTTC 2 cut(s) 2520, 3738
BspTI CTTAAG 2 cut(s) 1759, 2194
BsrDI GCAATG 2 cut(s) 2039, 3322
BsrFI RCCGGY 1 cut(s) 1136
BsrGI TGTACA 1 cut(s) 3983
BssAI RCCGGY 1 cut(s) 1136
BssECI CCNNGG 9 cut(s) 393, 631, 975, 1004, 1919, 2552, 3130, 3891, 4412
BssNAI GTATAC 2 cut(s) 3035, 3711
BssNI GRCGYC 3 cut(s) 785, 3582, 4227
BssT1I CCWWGG 5 cut(s) 393, 631, 1004, 3130, 3891
Bst1107I GTATAC 2 cut(s) 3035, 3711
Bst2UI CCWGG 7 cut(s) 205, 305, 860, 976, 1715, 4413, 4545
BstACI GRCGYC 3 cut(s) 785, 3582, 4227
BstAFI CTTAAG 2 cut(s) 1759, 2194
BstAPI GCANNNNNTGC 1 cut(s) 3818
BstAUI TGTACA 1 cut(s) 3983
BstBAI YACGTR 1 cut(s) 1754
BstC8I GCNNGC 8 cut(s) 195, 367, 451, 1697, 1889, 2173, 2441, 2693
BstDSI CCRYGG 1 cut(s) 1919
BstEII GGTNACC 1 cut(s) 1914
BstH2I RGCGCY 1 cut(s) 44
BstHHI GCGC 4 cut(s) 43, 169, 812, 1695
BstMAI GTCTC 7 cut(s) 290, 2228, 2660, 3090, 3663, 4190, 4357
BstMWI GCNNNNNNNGC 8 cut(s) 38, 62, 102, 118, 239, 330, 2168, 3818
BstNI CCWGG 7 cut(s) 205, 305, 860, 976, 1715, 4413, 4545
BstNSI RCATGY 4 cut(s) 1634, 2144, 2695, 4425
BstPI GGTNACC 1 cut(s) 1914
BstSCI CCNGG 9 cut(s) 203, 303, 509, 858, 974, 1713, 1872, 4411, 4543
BstSFI CTRYAG 3 cut(s) 1494, 3328, 3447
BstSLI GKGCMC 1 cut(s) 3516
BstV1I GCAGC 7 cut(s) 16, 151, 428, 458, 909, 1138, 1260
BstV2I GAAGAC 3 cut(s) 347, 1133, 3551
BstX2I RGATCY 5 cut(s) 901, 1072, 1786, 1843, 3769
BstXI CCANNNNNNTGG 2 cut(s) 670, 4502
BstYI RGATCY 5 cut(s) 901, 1072, 1786, 1843, 3769
BstZ17I GTATAC 2 cut(s) 3035, 3711
BsuI GTATCC 5 cut(s) 139, 1579, 2886, 3349, 4070
BsuRI GGCC 9 cut(s) 203, 611, 630, 650, 2115, 2397, 3646, 3903, 3913
BtgI CCRYGG 1 cut(s) 1919
BtgZI GCGATG 1 cut(s) 2923
BtrI CACGTC 2 cut(s) 2654, 2841
BtsIMutI CAGTG 4 cut(s) 427, 442, 948, 1295
BveI ACCTGC 1 cut(s) 3817
Cac8I GCNNGC 8 cut(s) 195, 367, 451, 1697, 1889, 2173, 2441, 2693
CaiI CAGNNNCTG 3 cut(s) 1076, 2616, 3310
CciI TCATGA 1 cut(s) 235
CfoI GCGC 4 cut(s) 43, 169, 812, 1695
Cfr10I RCCGGY 1 cut(s) 1136
Cfr13I GGNCC 6 cut(s) 201, 649, 1044, 3902, 3912, 4541
CseI GACGC 4 cut(s) 3296, 3556, 3590, 4235
CsiI ACCWGGT 1 cut(s) 4543
Csp6I GTAC 7 cut(s) 863, 1179, 2243, 2472, 2478, 3444, 3984
CspCI CAANNNNNGTGG 2 cut(s) 4301, 4336
CviQI GTAC 7 cut(s) 863, 1179, 2243, 2472, 2478, 3444, 3984
DraI TTTAAA 1 cut(s) 4149
DrdI GACNNNNNNGTC 1 cut(s) 2766
DriI GACNNNNNGTC 2 cut(s) 784, 3121
DseDI GACNNNNNNGTC 1 cut(s) 2766
EaeI YGGCCR 2 cut(s) 609, 2395
Eam1105I GACNNNNNGTC 2 cut(s) 784, 3121
Ecl136II GAGCTC 1 cut(s) 2530
Eco130I CCWWGG 5 cut(s) 393, 631, 1004, 3130, 3891
Eco147I AGGCCT 1 cut(s) 630
Eco24I GRGCYC 4 cut(s) 2532, 3003, 3144, 3285
Eco32I GATATC 5 cut(s) 88, 250, 1726, 2417, 2559
Eco47I GGWCC 2 cut(s) 1044, 4541
Eco47III AGCGCT 1 cut(s) 42
Eco53kI GAGCTC 1 cut(s) 2530
Eco57I CTGAAG 7 cut(s) 1077, 1827, 1844, 2586, 3005, 3146, 3287
Eco88I CYCGRG 1 cut(s) 1328
Eco91I GGTNACC 1 cut(s) 1914
EcoICRI GAGCTC 1 cut(s) 2530
EcoO65I GGTNACC 1 cut(s) 1914
EcoRII CCWGG 7 cut(s) 203, 303, 858, 974, 1713, 4411, 4543
EcoRV GATATC 5 cut(s) 88, 250, 1726, 2417, 2559
EcoT14I CCWWGG 5 cut(s) 393, 631, 1004, 3130, 3891
EcoT22I ATGCAT 1 cut(s) 4301
EcoT38I GRGCYC 4 cut(s) 2532, 3003, 3144, 3285
ErhI CCWWGG 5 cut(s) 393, 631, 1004, 3130, 3891
Esp3I CGTCTC 3 cut(s) 2660, 3090, 4190
FalI AAGNNNNNCTT 6 cut(s) 2159, 2191, 2177, 2209, 4517, 4549
FaqI GGGAC 6 cut(s) 93, 441, 2369, 2772, 3735, 3941
FauI CCCGC 1 cut(s) 186
FauNDI CATATG 2 cut(s) 762, 3355
FbaI TGATCA 2 cut(s) 70, 1959
FblI GTMKAC 3 cut(s) 2770, 3034, 3710
Fnu4HI GCNGC 7 cut(s) 30, 165, 417, 447, 923, 1152, 1249
FriOI GRGCYC 4 cut(s) 2532, 3003, 3144, 3285
Fsp4HI GCNGC 7 cut(s) 30, 165, 417, 447, 923, 1152, 1249
FspI TGCGCA 1 cut(s) 168
GlaI GCGC 4 cut(s) 42, 168, 811, 1694
GluI GCNGC 7 cut(s) 30, 165, 417, 447, 923, 1152, 1249
GsaI CCCAGC 1 cut(s) 2010
GsuI CTGGAG 2 cut(s) 1490, 2986
HaeII RGCGCY 1 cut(s) 44
HaeIII GGCC 9 cut(s) 203, 611, 630, 650, 2115, 2397, 3646, 3903, 3913
HgaI GACGC 4 cut(s) 3296, 3556, 3590, 4235
HhaI GCGC 4 cut(s) 43, 169, 812, 1695
Hin1I GRCGYC 3 cut(s) 785, 3582, 4227
Hin6I GCGC 4 cut(s) 41, 167, 810, 1693
HinP1I GCGC 4 cut(s) 41, 167, 810, 1693
HincII GTYRAC 3 cut(s) 840, 2205, 2838
HindII GTYRAC 3 cut(s) 840, 2205, 2838
HindIII AAGCTT 2 cut(s) 2278, 2986
HpaI GTTAAC 1 cut(s) 2205
HphI GGTGA 9 cut(s) 616, 692, 952, 1284, 2072, 3518, 3826, 3963, 4163
Hpy166II GTNNAC 9 cut(s) 840, 2205, 2771, 2838, 3035, 3711, 3940, 4306, 4552
Hpy8I GTNNAC 9 cut(s) 840, 2205, 2771, 2838, 3035, 3711, 3940, 4306, 4552
HpyCH4IV ACGT 6 cut(s) 785, 1753, 2449, 2653, 2840, 4315
HpyF10VI GCNNNNNNNGC 8 cut(s) 38, 62, 102, 118, 239, 330, 2168, 3818
HpySE526I ACGT 6 cut(s) 785, 1753, 2449, 2653, 2840, 4315
Hsp92I GRCGYC 3 cut(s) 785, 3582, 4227
HspAI GCGC 4 cut(s) 41, 167, 810, 1693
Kpn2I TCCGGA 1 cut(s) 3090
Ksp22I TGATCA 2 cut(s) 70, 1959
KspAI GTTAAC 1 cut(s) 2205
LguI GCTCTTC 2 cut(s) 2520, 3738
Lsp1109I GCAGC 7 cut(s) 16, 151, 428, 458, 909, 1138, 1260
MabI ACCWGGT 1 cut(s) 4543
MaeII ACGT 6 cut(s) 785, 1753, 2449, 2653, 2840, 4315
MfeI CAATTG 2 cut(s) 74, 2954
MflI RGATCY 5 cut(s) 901, 1072, 1786, 1843, 3769
MhlI GDGCHC 7 cut(s) 12, 2532, 3003, 3144, 3285, 3516, 3849
MlsI TGGCCA 2 cut(s) 611, 2397
MluNI TGGCCA 2 cut(s) 611, 2397
MlyI GAGTC 9 cut(s) 75, 423, 1886, 2197, 2391, 2650, 2754, 2924, 3368
MmeI TCCRAC 7 cut(s) 511, 1390, 2646, 3236, 3956, 4254, 4368
Mox20I TGGCCA 2 cut(s) 611, 2397
Mph1103I ATGCAT 1 cut(s) 4301
MroI TCCGGA 1 cut(s) 3090
MroXI GAANNNNTTC 3 cut(s) 594, 999, 3456
MscI TGGCCA 2 cut(s) 611, 2397
MslI CAYNNNNRTG 4 cut(s) 2196, 2212, 2901, 3358
Msp20I TGGCCA 2 cut(s) 611, 2397
MspA1I CMGCKG 1 cut(s) 2564
MspCI CTTAAG 2 cut(s) 1759, 2194
MspR9I CCNGG 9 cut(s) 205, 305, 511, 860, 976, 1715, 1874, 4413, 4545
MunI CAATTG 2 cut(s) 74, 2954
Mva1269I GAATGC 1 cut(s) 1671
MvaI CCWGG 7 cut(s) 205, 305, 860, 976, 1715, 4413, 4545
MwoI GCNNNNNNNGC 8 cut(s) 38, 62, 102, 118, 239, 330, 2168, 3818
NciI CCSGG 2 cut(s) 511, 1874
NdeI CATATG 2 cut(s) 762, 3355
NlaIV GGNNCC 2 cut(s) 1339, 3284
NmeAIII GCCGAG 1 cut(s) 300
NmuCI GTSAC 6 cut(s) 776, 958, 2189, 2366, 2903, 3113
NsbI TGCGCA 1 cut(s) 168
NsiI ATGCAT 1 cut(s) 4301
NspI RCATGY 4 cut(s) 1634, 2144, 2695, 4425
OliI CACNNNNGTG 1 cut(s) 2196
PaeI GCATGC 1 cut(s) 2695
PaeR7I CTCGAG 1 cut(s) 1328
PagI TCATGA 1 cut(s) 235
PceI AGGCCT 1 cut(s) 630
PciI ACATGT 3 cut(s) 1630, 2140, 4421
PciSI GCTCTTC 2 cut(s) 2520, 3738
PcsI WCGNNNNNNNCGW 1 cut(s) 2650
PctI GAATGC 1 cut(s) 1671
PdmI GAANNNNTTC 3 cut(s) 594, 999, 3456
PflMI CCANNNNNTGG 1 cut(s) 2393
PfoI TCCNGGA 1 cut(s) 1872
PkrI GCNGC 7 cut(s) 31, 166, 418, 448, 924, 1153, 1250
PleI GAGTC 9 cut(s) 75, 423, 1885, 2196, 2390, 2649, 2754, 2923, 3368
PpsI GAGTC 9 cut(s) 75, 423, 1885, 2196, 2390, 2649, 2754, 2923, 3368
Ppu21I YACGTR 1 cut(s) 1754
PscI ACATGT 3 cut(s) 1630, 2140, 4421
PsiI TTATAA 1 cut(s) 117
Psp124BI GAGCTC 1 cut(s) 2532
Psp6I CCWGG 7 cut(s) 203, 303, 858, 974, 1713, 4411, 4543
PspEI GGTNACC 1 cut(s) 1914
PspFI CCCAGC 1 cut(s) 2006
PspGI CCWGG 7 cut(s) 203, 303, 858, 974, 1713, 4411, 4543
PspN4I GGNNCC 2 cut(s) 1339, 3284
PspPI GGNCC 6 cut(s) 201, 649, 1044, 3902, 3912, 4541
PstNI CAGNNNCTG 3 cut(s) 1076, 2616, 3310
PsuI RGATCY 5 cut(s) 901, 1072, 1786, 1843, 3769
PvuII CAGCTG 1 cut(s) 2564
RsaI GTAC 7 cut(s) 864, 1180, 2244, 2473, 2479, 3445, 3985
RsaNI GTAC 7 cut(s) 863, 1179, 2243, 2472, 2478, 3444, 3984
RseI CAYNNNNRTG 4 cut(s) 2196, 2212, 2901, 3358
SacI GAGCTC 1 cut(s) 2532
SapI GCTCTTC 2 cut(s) 2520, 3738
SatI GCNGC 7 cut(s) 30, 165, 417, 447, 923, 1152, 1249
Sau96I GGNCC 6 cut(s) 201, 649, 1044, 3902, 3912, 4541
SchI GAGTC 9 cut(s) 75, 423, 1886, 2197, 2391, 2650, 2754, 2924, 3368
ScrFI CCNGG 9 cut(s) 205, 305, 511, 860, 976, 1715, 1874, 4413, 4545
SduI GDGCHC 7 cut(s) 12, 2532, 3003, 3144, 3285, 3516, 3849
SexAI ACCWGGT 1 cut(s) 4543
SfcI CTRYAG 3 cut(s) 1494, 3328, 3447
Sfr274I CTCGAG 1 cut(s) 1328
SinI GGWCC 2 cut(s) 1044, 4541
SlaI CTCGAG 1 cut(s) 1328
SmiMI CAYNNNNRTG 4 cut(s) 2196, 2212, 2901, 3358
SphI GCATGC 1 cut(s) 2695
SseBI AGGCCT 1 cut(s) 630
SsiI CCGC 4 cut(s) 103, 193, 829, 4174
SspI AATATT 1 cut(s) 2294
SstI GAGCTC 1 cut(s) 2532
StuI AGGCCT 1 cut(s) 630
StyD4I CCNGG 9 cut(s) 203, 303, 509, 858, 974, 1713, 1872, 4411, 4543
StyI CCWWGG 5 cut(s) 393, 631, 1004, 3130, 3891
TaiI ACGT 6 cut(s) 788, 1756, 2452, 2656, 2843, 4318
TaqII GACCGA 1 cut(s) 587
TatI WGTACW 2 cut(s) 2242, 3983
TscAI CASTG 4 cut(s) 427, 442, 955, 1302
TseFI GTSAC 6 cut(s) 776, 958, 2189, 2366, 2903, 3113
TseI GCWGC 7 cut(s) 29, 164, 416, 446, 922, 1151, 1248
Tsp45I GTSAC 6 cut(s) 776, 958, 2189, 2366, 2903, 3113
TspGWI ACGGA 6 cut(s) 425, 2304, 2376, 2939, 3132, 3461
TspRI CASTG 4 cut(s) 427, 442, 955, 1302
Van91I CCANNNNNTGG 1 cut(s) 2393
Vha464I CTTAAG 2 cut(s) 1759, 2194
VpaK11BI GGWCC 2 cut(s) 1044, 4541
XapI RAATTY 9 cut(s) 750, 931, 1012, 1954, 1997, 2338, 3396, 4144, 4442
XbaI TCTAGA 2 cut(s) 1783, 1840
XceI RCATGY 4 cut(s) 1634, 2144, 2695, 4425
XcmI CCANNNNNNNNNTGG 1 cut(s) 619
XhoI CTCGAG 1 cut(s) 1328
XmaJI CCTAGG 3 cut(s) 631, 1004, 3130
XmiI GTMKAC 3 cut(s) 2770, 3034, 3710
XmnI GAANNNNTTC 3 cut(s) 594, 999, 3456
ZraI GACGTC 1 cut(s) 786
Zsp2I ATGCAT 1 cut(s) 4301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.