Rmu_sc0003064.1_g000002

Belongs to the serpin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003064.1
OG0000163
Physical Location & Seq
Reverse (-)
9536 .. 10373
838 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003064.1_g000002.1.cds

Sequence Viewer

Length: 744 bp
ctggttccgatctcgatcagtacgtttctttcttttctcaagtccaagtccgtcgacgaccttaactccgtcgcctaccatctcatcacttccgttctagccgatggatcggccaaaggcgggtcatgtttgaacttggccaacggtttatggacagacgagtctaaacctcttgaggattcttaccaagaggtggtgtgcgggtcttacaaggcttccctaaaacaagtagatttcaaggccaaccccggtaaagtgagagttgaagttaattcatgggtgaagaaggagacaaaaggccttatcactgagattcttcctctaaactcagtcaccaacgaaacaggacgcatctttgcaaatgctttatacttcaatgcctcttggagagagagctacagcttccatgaacactacacaaaagagaaggatcatgagttccaccttctcaatggggactgggtgaagattttttacgaaacaggtgaagatgacggccgatgtttctctatgtgcttgcttcatccagatgaaagagatgggctgccatctctagctgagagagtatgttcagaatccggttttataaatggtcatctgaagagtacaaacctagactgggttgaagtgggtgaattcttgattccaaagtttaagttttcttcggcgtttgaagcctctggtattctggagaaactaggactggtgttaaaccctccggggcaatatttcatgaatccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 ko05146 ko05164 map03013 map05146 map05164
Pfam Domains
Protein Families
Serpin

Protein Analysis

247

Amino Acids

27.62

Weight (kDa)

5.3

Isoelectric Point (pI)

17.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000163)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G64020
fragaria_vesca FvH4_1g24600 FvH4_1g24640 FvH4_2g15000 FvH4_3g03700 FvH4_3g03710 FvH4_3g09790 FvH4_3g09790 FvH4_3g09810 FvH4_3g09811 FvH4_3g23720 FvH4_3g32870 FvH4_3g32890 FvH4_3g37550 FvH4_3g37560 FvH4_5g01890 FvH4_5g10280 FvH4_5g10280 FvH4_5g10280 FvH4_5g10280 FvH4_5g10280 FvH4_5g10280 FvH4_5g10280 FvH4_5g10280 FvH4_5g10280 FvH4_5g21100 FvH4_5g21110 FvH4_5g21330 FvH4_5g21331 FvH4_5g21520 FvH4_5g21540 FvH4_5g21970 FvH4_6g01280
malus_domestica MD00G1084800.v1.1 MD00G1141300.v1.1 MD02G1102800.v1.1 MD02G1282200.v1.1 MD02G1282300.v1.1 MD03G1207900.v1.1 MD03G1230000.v1.1 MD04G1136400.v1.1 MD04G1136500.v1.1 MD04G1189000.v1.1 MD05G1248700.v1.1 MD05G1248800.v1.1 MD06G1030400.v1.1 MD10G1229200.v1.1 MD10G1229300.v1.1 MD15G1291400.v1.1 MD15G1431300.v1.1
prunus_persica Prupe.5G041800_v2.0.a1 Prupe.5G041900_v2.0.a1 Prupe.5G042000_v2.0.a1 Prupe.5G042100_v2.0.a1 Prupe.5G042200_v2.0.a1
pyrus_communis pycom02g14630 pycom02g24090 pycom04g12410 pycom04g16760 pycom05g22550 pycom10g19280 pycom12g05670 pycom15g25490 pycom15g38110
rosa_chinensis RchiOBHm_Chr2g0122001 RchiOBHm_Chr2g0163171 RchiOBHm_Chr2g0163181 RchiOBHm_Chr3g0455201 RchiOBHm_Chr5g0005751 RchiOBHm_Chr5g0015501 RchiOBHm_Chr5g0015511 RchiOBHm_Chr5g0015521 RchiOBHm_Chr5g0015531 RchiOBHm_Chr5g0060021 RchiOBHm_Chr7g0187971 RchiOBHm_Chr7g0207951 RchiOBHm_Chr7g0208671 RchiOBHm_Chr7g0208691 RchiOBHm_Chr7g0208941 RchiOBHm_Chr7g0208951 RchiOBHm_Chr7g0208961
rosa_laevigata RLG00000003132 RLG00000003177 RLG00000003178 RLG00000003179 RLG00000003180 RLG00000003201 RLG00000003202 RLG00000003270 RLG00000004739 RLG00000004741 RLG00000004744 RLG00000021379 RLG00000025378 RLG00000031323 RLG00000031324 RLG00000032205 RLG00000032206 RLG00000035339
rosa_multiflora Rmu_co8189380.1_g000001 Rmu_co8284591.1_g000001 Rmu_co8360283.1_g000002 Rmu_co8379053.1_g000001 Rmu_sc0000493.1_g000007 Rmu_sc0000532.1_g000030 Rmu_sc0000532.1_g000031 Rmu_sc0000570.1_g000033 Rmu_sc0000905.1_g000012 Rmu_sc0001730.1_g000002 Rmu_sc0002045.1_g000039 Rmu_sc0003064.1_g000001 Rmu_sc0003064.1_g000002 Rmu_sc0003064.1_g000006 Rmu_sc0003880.1_g000012 Rmu_sc0004103.1_g000003 Rmu_sc0005082.1_g000007 Rmu_sc0011272.1_g000002 Rmu_sc0015523.1_g000021 Rmu_sc0015523.1_g000022 Rmu_sc0019960.1_g000007 Rmu_sc0029514.1_g000001 Rmu_ssc0000422.1_g000010
rosa_roxburghii Rroxscaffold_1G00013660 Rroxscaffold_1G00060980 Rroxscaffold_1G00060990 Rroxscaffold_1G00061000 Rroxscaffold_1G00061010 Rroxscaffold_2G00087490 Rroxscaffold_2G00122080 Rroxscaffold_2G00123490 Rroxscaffold_3G00249930 Rroxscaffold_3G00249940 Rroxscaffold_3G00249950 Rroxscaffold_3G00249980 Rroxscaffold_3G00250310 Rroxscaffold_3G00250320 Rroxscaffold_3G00266850 Rroxscaffold_3G00266870 Rroxscaffold_3G00266910 Rroxscaffold_6G00424480
rosa_rugosa Rorug02G0228900 Rorug02G0236000 Rorug02G0501100 Rorug03G0004700 Rorug03G0004700 Rorug03G0004800 Rorug04G0417800 Rorug05G0027800 Rorug05G0027900 Rorug05G0028000 Rorug05G0327700 Rorug05G0384800 Rorug06G0486000 Rorug06G0486100 Rorug06G0486200 Rorug06G0486200 Rorug06G0486300 Rorug06G0486400 Rorug06G0486500 Rorug07G0100400 Rorug07G0105400 Rorug07G0105400 Rorug07G0107300 Rorug07G0107400 Rorug07G0107500 Rorug07G0113300
rosa_samantha Rh7AG091300 Rh7BG092800 Rh7CG091600 Rh7CG257500 Rh7DG093500
rosa_wichuraiana Rw0G001260 Rw0G017680 Rw2G023470 Rw3G005130 Rw5G004560 Rw5G010480 Rw7G020400 Rw7G020410 Rw7G020540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 587
AasI GACNNNNNNGTC 1 cut(s) 160
AccB7I CCANNNNNTGG 1 cut(s) 193
AccI GTMKAC 1 cut(s) 54
AciI CCGC 2 cut(s) 120, 201
AclWI GGATC 2 cut(s) 115, 438
AcoI YGGCCR 3 cut(s) 111, 138, 496
AcsI RAATTY 1 cut(s) 635
AcuI CTGAAG 1 cut(s) 620
AfaI GTAC 2 cut(s) 22, 607
AfiI CCNNNNNNNGG 3 cut(s) 120, 193, 619
AgsI TTSAA 6 cut(s) 133, 238, 266, 376, 626, 674
AloI GAACNNNNNNTCC 2 cut(s) 422, 454
AluBI AGCT 3 cut(s) 396, 402, 557
AluI AGCT 3 cut(s) 396, 402, 557
Alw26I GTCTC 1 cut(s) 284
AlwI GGATC 2 cut(s) 115, 438
AoxI GGCC 5 cut(s) 111, 138, 240, 298, 496
ApeKI GCWGC 1 cut(s) 544
ApoI RAATTY 1 cut(s) 635
AsuC2I CCSGG 2 cut(s) 249, 720
AsuHPI GGTGA 5 cut(s) 292, 325, 475, 497, 644
BalI TGGCCA 1 cut(s) 140
BarI GAAGNNNNNNTAC 2 cut(s) 458, 490
BbvI GCAGC 1 cut(s) 531
BccI CCATC 4 cut(s) 87, 98, 533, 556
BceAI ACGGC 1 cut(s) 511
BcnI CCSGG 2 cut(s) 249, 720
BcoDI GTCTC 1 cut(s) 284
BfaI CTAG 4 cut(s) 98, 554, 614, 698
BfmI CTRYAG 1 cut(s) 397
BisI GCNGC 1 cut(s) 545
BlsI GCNGC 1 cut(s) 546
Bme1390I CCNGG 2 cut(s) 249, 720
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 2 cut(s) 249, 720
BmrI ACTGGG 2 cut(s) 469, 628
BmsI GCATC 1 cut(s) 360
BmuI ACTGGG 2 cut(s) 469, 628
BpmI CTGGAG 1 cut(s) 710
BpuEI CTTGAG 2 cut(s) 23, 194
BpuMI CCSGG 2 cut(s) 249, 720
BsaBI GATNNNNATC 1 cut(s) 14
BsaJI CCNNGG 2 cut(s) 247, 719
BsaWI WCCGGW 1 cut(s) 578
BsaXI ACNNNNNCTCC 2 cut(s) 50, 80
Bsc4I CCNNNNNNNGG 3 cut(s) 120, 193, 619
Bse1I ACTGG 3 cut(s) 464, 623, 708
Bse8I GATNNNNATC 1 cut(s) 14
BseDI CCNNGG 2 cut(s) 247, 719
BseGI GGATG 1 cut(s) 523
BseJI GATNNNNATC 1 cut(s) 14
BseLI CCNNNNNNNGG 3 cut(s) 120, 193, 619
BseMII CTCAG 3 cut(s) 300, 342, 549
BseNI ACTGG 3 cut(s) 464, 623, 708
BseX3I CGGCCG 1 cut(s) 496
BseXI GCAGC 1 cut(s) 531
Bsh1285I CGRYCG 1 cut(s) 499
BshFI GGCC 5 cut(s) 113, 140, 242, 300, 498
BsiEI CGRYCG 1 cut(s) 499
BsiSI CCGG 3 cut(s) 249, 579, 719
BslFI GGGAC 1 cut(s) 470
BslI CCNNNNNNNGG 3 cut(s) 120, 193, 619
BsmAI GTCTC 1 cut(s) 284
BsmFI GGGAC 1 cut(s) 470
BsnI GGCC 5 cut(s) 113, 140, 242, 300, 498
Bsp143I GATC 4 cut(s) 9, 15, 107, 430
BspACI CCGC 2 cut(s) 120, 201
BspANI GGCC 5 cut(s) 113, 140, 242, 300, 498
BspCNI CTCAG 3 cut(s) 301, 341, 550
BspHI TCATGA 2 cut(s) 433, 732
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 2 cut(s) 115, 438
BsrI ACTGG 3 cut(s) 464, 623, 708
BssECI CCNNGG 2 cut(s) 247, 719
BssMI GATC 4 cut(s) 9, 15, 107, 430
Bst4CI ACNGT 1 cut(s) 146
Bst6I CTCTTC 1 cut(s) 596
BstC8I GCNNGC 1 cut(s) 518
BstDEI CTNAG 3 cut(s) 309, 328, 558
BstF5I GGATG 1 cut(s) 523
BstKTI GATC 4 cut(s) 12, 18, 110, 433
BstMAI GTCTC 1 cut(s) 284
BstMBI GATC 4 cut(s) 9, 15, 107, 430
BstMCI CGRYCG 1 cut(s) 499
BstMWI GCNNNNNNNGC 1 cut(s) 674
BstSCI CCNGG 2 cut(s) 247, 718
BstSFI CTRYAG 1 cut(s) 397
BstV1I GCAGC 1 cut(s) 531
BstZI CGGCCG 1 cut(s) 496
BsuRI GGCC 5 cut(s) 113, 140, 242, 300, 498
BtsCI GGATG 1 cut(s) 523
BtsIMutI CAGTG 1 cut(s) 306
Cac8I GCNNGC 1 cut(s) 518
CciI TCATGA 2 cut(s) 433, 732
CseI GACGC 1 cut(s) 357
Csp6I GTAC 2 cut(s) 21, 606
CviAII CATG 5 cut(s) 126, 276, 407, 434, 733
CviQI GTAC 2 cut(s) 21, 606
DdeI CTNAG 3 cut(s) 309, 328, 558
DpnI GATC 4 cut(s) 11, 17, 109, 432
DpnII GATC 4 cut(s) 9, 15, 107, 430
DrdI GACNNNNNNGTC 1 cut(s) 160
DseDI GACNNNNNNGTC 1 cut(s) 160
EaeI YGGCCR 3 cut(s) 111, 138, 496
EagI CGGCCG 1 cut(s) 496
Eam1104I CTCTTC 1 cut(s) 596
EarI CTCTTC 1 cut(s) 596
EclXI CGGCCG 1 cut(s) 496
Eco147I AGGCCT 1 cut(s) 300
Eco52I CGGCCG 1 cut(s) 496
Eco57I CTGAAG 1 cut(s) 620
EcoRI GAATTC 1 cut(s) 635
FaeI CATG 5 cut(s) 129, 279, 410, 437, 736
FaqI GGGAC 1 cut(s) 470
FatI CATG 5 cut(s) 125, 275, 406, 433, 732
FauI CCCGC 2 cut(s) 113, 194
FblI GTMKAC 1 cut(s) 54
Fnu4HI GCNGC 1 cut(s) 545
FokI GGATG 1 cut(s) 510
Fsp4HI GCNGC 1 cut(s) 545
FspBI CTAG 4 cut(s) 98, 554, 614, 698
GluI GCNGC 1 cut(s) 545
GsuI CTGGAG 1 cut(s) 710
HaeIII GGCC 5 cut(s) 113, 140, 242, 300, 498
HapII CCGG 3 cut(s) 249, 579, 719
HgaI GACGC 1 cut(s) 357
Hin1II CATG 5 cut(s) 129, 279, 410, 437, 736
HincII GTYRAC 1 cut(s) 55
HindII GTYRAC 1 cut(s) 55
HinfI GANTC 6 cut(s) 161, 179, 313, 575, 643, 736
HpaII CCGG 3 cut(s) 249, 579, 719
HphI GGTGA 5 cut(s) 292, 325, 475, 497, 644
Hpy166II GTNNAC 1 cut(s) 55
Hpy188I TCNGA 3 cut(s) 9, 574, 600
Hpy188III TCNNGA 7 cut(s) 13, 173, 434, 527, 640, 689, 733
Hpy8I GTNNAC 1 cut(s) 55
Hpy99I CGWCG 3 cut(s) 56, 59, 74
HpyAV CCTTC 3 cut(s) 280, 421, 455
HpyCH4III ACNGT 1 cut(s) 146
HpyCH4IV ACGT 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 359
HpyF10VI GCNNNNNNNGC 1 cut(s) 674
HpyF3I CTNAG 3 cut(s) 309, 328, 558
HpySE526I ACGT 1 cut(s) 23
Hsp92II CATG 5 cut(s) 129, 279, 410, 437, 736
Kzo9I GATC 4 cut(s) 9, 15, 107, 430
Lsp1109I GCAGC 1 cut(s) 531
LweI GCATC 1 cut(s) 360
MaeI CTAG 4 cut(s) 98, 554, 614, 698
MaeII ACGT 1 cut(s) 23
MaeIII GTNAC 1 cut(s) 331
MalI GATC 4 cut(s) 11, 17, 109, 432
MboI GATC 4 cut(s) 9, 15, 107, 430
MboII GAAGA 6 cut(s) 295, 308, 478, 500, 613, 654
MlsI TGGCCA 1 cut(s) 140
MluCI AATT 2 cut(s) 271, 635
MluNI TGGCCA 1 cut(s) 140
MlyI GAGTC 1 cut(s) 170
MnlI CCTC 7 cut(s) 169, 180, 184, 330, 391, 688, 726
Mox20I TGGCCA 1 cut(s) 140
MscI TGGCCA 1 cut(s) 140
MseI TTAA 4 cut(s) 63, 270, 654, 710
MslI CAYNNNNRTG 1 cut(s) 528
Msp20I TGGCCA 1 cut(s) 140
MspI CCGG 3 cut(s) 249, 579, 719
MspR9I CCNGG 2 cut(s) 249, 720
MwoI GCNNNNNNNGC 1 cut(s) 674
NciI CCSGG 2 cut(s) 249, 720
NdeII GATC 4 cut(s) 9, 15, 107, 430
NlaIII CATG 5 cut(s) 129, 279, 410, 437, 736
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 331
PagI TCATGA 2 cut(s) 433, 732
PceI AGGCCT 1 cut(s) 300
PcsI WCGNNNNNNNCGW 1 cut(s) 20
PfeI GAWTC 5 cut(s) 179, 313, 575, 643, 736
PflMI CCANNNNNTGG 1 cut(s) 193
PkrI GCNGC 1 cut(s) 546
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PsiI TTATAA 1 cut(s) 587
PspN4I GGNNCC 1 cut(s) 6
RsaI GTAC 2 cut(s) 22, 607
RsaNI GTAC 2 cut(s) 21, 606
RseI CAYNNNNRTG 1 cut(s) 528
SalI GTCGAC 1 cut(s) 53
SaqAI TTAA 4 cut(s) 63, 270, 654, 710
SatI GCNGC 1 cut(s) 545
Sau3AI GATC 4 cut(s) 9, 15, 107, 430
SchI GAGTC 1 cut(s) 170
ScrFI CCNGG 2 cut(s) 249, 720
SfaNI GCATC 1 cut(s) 360
SfcI CTRYAG 1 cut(s) 397
SgrDI CGTCGACG 1 cut(s) 53
SmiMI CAYNNNNRTG 1 cut(s) 528
SmlI CTYRAG 2 cut(s) 38, 173
SmoI CTYRAG 2 cut(s) 38, 173
Sse9I AATT 2 cut(s) 271, 635
SseBI AGGCCT 1 cut(s) 300
SsiI CCGC 2 cut(s) 120, 201
SspI AATATT 1 cut(s) 728
SspMI CTAG 4 cut(s) 98, 554, 614, 698
StuI AGGCCT 1 cut(s) 300
StyD4I CCNGG 2 cut(s) 247, 718
TaaI ACNGT 1 cut(s) 146
TaiI ACGT 1 cut(s) 26
TaqI TCGA 2 cut(s) 14, 54
TasI AATT 2 cut(s) 271, 635
TatI WGTACW 1 cut(s) 605
TfiI GAWTC 5 cut(s) 179, 313, 575, 643, 736
Tru1I TTAA 4 cut(s) 63, 270, 654, 710
Tru9I TTAA 4 cut(s) 63, 270, 654, 710
TscAI CASTG 1 cut(s) 313
TseFI GTSAC 1 cut(s) 331
TseI GCWGC 1 cut(s) 544
Tsp45I GTSAC 1 cut(s) 331
TspDTI ATGAA 5 cut(s) 264, 423, 512, 546, 721
TspGWI ACGGA 3 cut(s) 40, 58, 82
TspRI CASTG 1 cut(s) 313
Van91I CCANNNNNTGG 1 cut(s) 193
XapI RAATTY 1 cut(s) 635
XcmI CCANNNNNNNNNTGG 1 cut(s) 449
XmiI GTMKAC 1 cut(s) 54
XspI CTAG 4 cut(s) 98, 554, 614, 698
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.