Rmu_sc0016730.1_g000002

Plant mobile domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016730.1
OG0000179
Physical Location & Seq
Forward (+)
3805 .. 6646
2842 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016730.1_g000002.1.cds

Sequence Viewer

Length: 2055 bp
atgtttcgacaaccgagatctggaagagaccaacaaaactcgcatgtactgttgctgaagtcttcgcatcatgatcagaacactcctcagaccccattcaagcttctcagcgatcgtgtacgcaacggttcagtgaagtggagcaatgcatttcgtgcaaacgggggcttctcttacacagaattctacttggaatgggtagaagatatcttaagcaagaatggcaagcttactcgaggagctttgcgttataagaggcctccaaacaaaagcaccagtaacaaaagagatctgccccagaatgtgtttaatccatctggcatgatccatgagatccgacaacgtacttctgcagacctcgcagtatttgatgacttaggcattgagagtgaagatgtagagcccacctgtttggctgcctttcttgcttgttggttgtgtctgtttgttttacccagagacgacactggtttgattcgtccgggagtattcaaagttgccagtaaaatgttacagggtgtacagttttgcctagcagtaccagtgttggccaacatctataagggtttaggcgagatttctgttttcagcaatctaggtaactgctcggctgcccttccttttcattatatttatgcatggctagcagagtactttggcacccactttcagtctccgcttcccaacgacctaaggccccgtatggttcgcttctccggagaattttcagctaaatattgtggggactcacaggcgctttctttattcaatgcatgtgataatgtgaggatggatgcatttgccagggcgctttctttgttcaatgcatgtgataatgtgaggatggatgcatttgccagggtattttcggagaacagagtgattatcaacctcgagaacatctcccatttagacctcatatatctcatcagccttcgatctggtccacaccggttcaatcgacagtttagttatgtccaagacattcctagcagccttaagaatgacattcgtaccggcatgtgggctttgatttacaagcattgggattcctgcaccagaatgaacaccaagtgcgtggtaacgttgctgatccagagtgctatctcggagtacatggttactcgagatcatgtcgactggtggtctaaagtgtaccattctacaccagtgaaagcaacgaaagaagcgcctaccagtagactactgcacaagactctgaaagcaaaagaagataagaacgtcacccgtgcaacaccgcctcatcacaaaaatgtgattcctcgtgaagttgaatgtagcaccaatgtccctgcgcctcctaataggactttgcttcctagtagtgctttgctcccagatagcaaccgtcaggctcatccgatcgactttatggaaaatgatggagactctttagattctcacatcgctttggtccgtccacttaagctgaaaagaccagcaatccaagaaagaaggcgtagtgggagcagtagtagcaataatagtgaggtgcactttaagcgtcggaaaactgacaccagtcttggccctatttattgtgatcccaatgctgagttcactctgaataccggctttcttggtgacatttcaacttcttctcaaccgatgctgcaacgaaatgagggtgcagagattgatggtcactcactttgggggaacgatgacgcctctttagaccctatacgtgttctttctgcagcggaacttgaggcttacgctttacccacaaaagaaaaatccaatgcaaagaatgacttacagcaaattgacccgacatgtacaattctcaactcttgtggttcatgcatggttcaattaaggaaggagtcaaggtgggccaccagcctattcactgtcaataatatagaaaagaaccttgtgacggggttggtgctctcctcatccacattgtttgatcaagaagttaggtcaaggatgccccgacgactgcaccccactgtgctggcacgcctgcgcactcaaaagagactgtttgcaaccagactggtttttggagccaaacaattatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMD

Protein Analysis

684

Amino Acids

77.24

Weight (kDa)

9.25

Isoelectric Point (pI)

53.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000179)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18561 FvH4_1g29681 FvH4_2g15190 FvH4_3g22800 FvH4_3g22801 FvH4_3g26700 FvH4_4g15162 FvH4_4g15163 FvH4_4g15164 FvH4_4g22273 FvH4_7g02320 FvH4_7g03670 FvH4_7g03671
malus_domestica MD07G1097100.v1.1 MD11G1208600.v1.1 MD15G1303300.v1.1
prunus_persica Prupe.2G070800_v2.0.a1
pyrus_communis pycom02g13430 pycom04g06950 pycom04g09420 pycom04g09610 pycom06g05740 pycom07g00010 pycom07g06720 pycom07g09960 pycom07g10670 pycom07g10680 pycom07g10920 pycom07g27810 pycom08g12110 pycom08g13640 pycom09g03570 pycom09g13470 pycom09g13510 pycom10g01180 pycom10g02180 pycom10g06840 pycom12424g00130 pycom12g03090 pycom12g09570 pycom12g09580 pycom12g09590 pycom1310g00020 pycom13g25030 pycom13g25310 pycom13g25700 pycom13g26160 pycom13g27790 pycom13g28780 pycom13g28790 pycom1683g00070 pycom16g19330 pycom16g21210 pycom16g21710 pycom16g23400 pycom16g24730 pycom17g17550 pycom17g27670 pycom420g00110 pycom420g00130 pycom420g00610 pycom520g00600 pycom675g00050
rosa_chinensis RchiOBHm_Chr1g0316731
rosa_laevigata RLG00000030467
rosa_multiflora Rmu_co8112106.1_g000001 Rmu_co8301911.1_g000001 Rmu_sc0000161.1_g000042 Rmu_sc0000161.1_g000043 Rmu_sc0000173.1_g000035 Rmu_sc0000173.1_g000036 Rmu_sc0000480.1_g000024 Rmu_sc0000670.1_g000020 Rmu_sc0000670.1_g000021 Rmu_sc0000962.1_g000043 Rmu_sc0000962.1_g000044 Rmu_sc0001025.1_g000004 Rmu_sc0001075.1_g000026 Rmu_sc0001075.1_g000027 Rmu_sc0001167.1_g000050 Rmu_sc0001227.1_g000043 Rmu_sc0001346.1_g000006 Rmu_sc0001438.1_g000034 Rmu_sc0001946.1_g000002 Rmu_sc0001981.1_g000005 Rmu_sc0002106.1_g000005 Rmu_sc0002187.1_g000004 Rmu_sc0002187.1_g000005 Rmu_sc0002187.1_g000018 Rmu_sc0002539.1_g000097 Rmu_sc0003008.1_g000050 Rmu_sc0003008.1_g000051 Rmu_sc0003069.1_g000033 Rmu_sc0003069.1_g000034 Rmu_sc0003412.1_g000016 Rmu_sc0003553.1_g000005 Rmu_sc0003553.1_g000006 Rmu_sc0003641.1_g000025 Rmu_sc0003652.1_g000006 Rmu_sc0003687.1_g000019 Rmu_sc0003687.1_g000020 Rmu_sc0004234.1_g000013 Rmu_sc0004249.1_g000005 Rmu_sc0005044.1_g000027 Rmu_sc0005060.1_g000012 Rmu_sc0005816.1_g000005 Rmu_sc0006175.1_g000006 Rmu_sc0006175.1_g000007 Rmu_sc0006695.1_g000046 Rmu_sc0006725.1_g000014 Rmu_sc0006746.1_g000015 Rmu_sc0006746.1_g000016 Rmu_sc0006912.1_g000008 Rmu_sc0007355.1_g000004 Rmu_sc0007705.1_g000001 Rmu_sc0007903.1_g000003 Rmu_sc0007953.1_g000001 Rmu_sc0008630.1_g000001 Rmu_sc0008923.1_g000018 Rmu_sc0008923.1_g000019 Rmu_sc0009186.1_g000003 Rmu_sc0010184.1_g000007 Rmu_sc0010243.1_g000001 Rmu_sc0011242.1_g000004 Rmu_sc0012849.1_g000001 Rmu_sc0012849.1_g000002 Rmu_sc0012883.1_g000001 Rmu_sc0013028.1_g000015 Rmu_sc0015042.1_g000003 Rmu_sc0016730.1_g000002 Rmu_sc0017702.1_g000002 Rmu_sc0017791.1_g000007 Rmu_sc0017874.1_g000005 Rmu_sc0025334.1_g000001 Rmu_sc0025334.1_g000002 Rmu_sc0028789.1_g000001 Rmu_sc0030538.1_g000001 Rmu_sc0033137.1_g000001 Rmu_ssc0000183.1_g000013 Rmu_ssc0000259.1_g000061 Rmu_ssc0000259.1_g000062 Rmu_ssc0000259.1_g000063
rosa_roxburghii Rroxscaffold_173G00435030 Rroxscaffold_173G00435040 Rroxscaffold_1G00033030 Rroxscaffold_2G00093360 Rroxscaffold_2G00113080 Rroxscaffold_2G00146180 Rroxscaffold_3G00227920 Rroxscaffold_3G00251750 Rroxscaffold_4G00328240 Rroxscaffold_5G00333920 Rroxscaffold_5G00338240 Rroxscaffold_5G00342700 Rroxscaffold_6G00412810 Rroxscaffold_6G00423130 Rroxscaffold_7G00175190
rosa_rugosa Rorug01G0029200 Rorug01G0029300 Rorug01G0029400 Rorug01G0029400
rosa_samantha Rh1AG040900 Rh1BG038100 Rh1CG042000 Rh1DG027900
rosa_wichuraiana Rw0G019970 Rw1G003400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 252
Acc16I TGCGCA 1 cut(s) 2000
AccB1I GGYRCC 1 cut(s) 659
AccI GTMKAC 2 cut(s) 1137, 1201
AccIII TCCGGA 1 cut(s) 716
AciI CCGC 3 cut(s) 677, 1259, 1724
AclI AACGTT 1 cut(s) 1085
AclWI GGATC 4 cut(s) 319, 328, 1087, 1559
AcoI YGGCCR 1 cut(s) 549
AcsI RAATTY 2 cut(s) 182, 722
AcuI CTGAAG 1 cut(s) 77
AcyI GRCGYC 1 cut(s) 1689
AdeI CACNNNGTG 1 cut(s) 1074
AfiI CCNNNNNNNGG 3 cut(s) 20, 1023, 1906
AflII CTTAAG 3 cut(s) 211, 998, 1445
AflIII ACRYGT 2 cut(s) 1708, 1799
AgeI ACCGGT 1 cut(s) 951
AgsI TTSAA 8 cut(s) 100, 493, 769, 823, 958, 1295, 1614, 1838
AhdI GACNNNNNGTC 1 cut(s) 1144
AjnI CCWGG 2 cut(s) 803, 857
AjuI GAANNNNNNNTTGG 2 cut(s) 1562, 1594
AluBI AGCT 5 cut(s) 103, 229, 242, 731, 1450
AluI AGCT 5 cut(s) 103, 229, 242, 731, 1450
Alw21I GWGCWC 2 cut(s) 1518, 1920
Alw26I GTCTC 5 cut(s) 21, 453, 678, 1401, 2005
Alw44I GTGCAC 1 cut(s) 1514
AlwI GGATC 4 cut(s) 319, 328, 1087, 1559
Ama87I CYCGRG 3 cut(s) 234, 893, 1125
Aor13HI TCCGGA 1 cut(s) 716
AoxI GGCC 5 cut(s) 257, 549, 695, 1549, 1860
ApaLI GTGCAC 1 cut(s) 1514
ApeKI GCWGC 5 cut(s) 416, 611, 993, 1633, 1721
ApoI RAATTY 2 cut(s) 182, 722
AsiGI ACCGGT 1 cut(s) 951
AspLEI GCGC 5 cut(s) 757, 811, 1192, 1318, 2001
AspS9I GGNCC 5 cut(s) 696, 944, 1435, 1550, 1860
AsuC2I CCSGG 1 cut(s) 483
AsuHPI GGTGA 2 cut(s) 1237, 1616
AsuNHI GCTAGC 1 cut(s) 643
AvaI CYCGRG 3 cut(s) 234, 893, 1125
AvaII GGWCC 2 cut(s) 944, 1435
AxyI CCTNAGG 1 cut(s) 692
BaeGI GKGCMC 1 cut(s) 1518
BaeI ACNNNNGTAYC 2 cut(s) 997, 1030
BalI TGGCCA 1 cut(s) 551
BanI GGYRCC 1 cut(s) 659
BanII GRGCYC 1 cut(s) 405
BauI CACGAG 1 cut(s) 1284
BbsI GAAGAC 1 cut(s) 54
Bbv12I GWGCWC 2 cut(s) 1518, 1920
BbvI GCAGC 5 cut(s) 403, 598, 1005, 1620, 1733
BccI CCATC 5 cut(s) 322, 784, 838, 1397, 1655
BciT130I CCWGG 2 cut(s) 805, 859
BclI TGATCA 2 cut(s) 73, 1939
BcnI CCSGG 1 cut(s) 483
BcoDI GTCTC 5 cut(s) 21, 453, 678, 1401, 2005
BfaI CTAG 5 cut(s) 533, 596, 644, 990, 1341
BfmI CTRYAG 2 cut(s) 351, 1719
BfoI RGCGCY 3 cut(s) 758, 812, 1193
BfrI CTTAAG 3 cut(s) 211, 998, 1445
BglII AGATCT 2 cut(s) 17, 289
BisI GCNGC 5 cut(s) 417, 612, 994, 1634, 1722
BlsI GCNGC 5 cut(s) 418, 613, 995, 1635, 1723
BmcAI AGTACT 1 cut(s) 653
Bme1390I CCNGG 3 cut(s) 483, 805, 859
Bme18I GGWCC 2 cut(s) 944, 1435
BmeRI GACNNNNNGTC 1 cut(s) 1144
BmeT110I CYCGRG 3 cut(s) 234, 893, 1125
BmgT120I GGNCC 5 cut(s) 696, 944, 1435, 1550, 1860
BmiI GGNNCC 3 cut(s) 661, 698, 2041
BmrFI CCNGG 3 cut(s) 483, 805, 859
BmsI GCATC 5 cut(s) 76, 784, 838, 1620, 1950
BmtI GCTAGC 1 cut(s) 647
BoxI GACNNNNGTC 1 cut(s) 1542
BpiI GAAGAC 1 cut(s) 54
BplI GAGNNNNNCTC 2 cut(s) 887, 919
BpuEI CTTGAG 1 cut(s) 1751
BpuMI CCSGG 1 cut(s) 483
BsaAI YACGTR 1 cut(s) 1709
BsaHI GRCGYC 1 cut(s) 1689
BsaI GGTCTC 1 cut(s) 21
BsaJI CCNNGG 2 cut(s) 804, 858
BsaWI WCCGGW 2 cut(s) 716, 951
BsaXI ACNNNNNCTCC 4 cut(s) 1480, 1510, 1841, 1871
Bsc4I CCNNNNNNNGG 3 cut(s) 20, 1023, 1906
Bse118I RCCGGY 3 cut(s) 951, 1016, 1592
Bse1I ACTGG 9 cut(s) 276, 472, 501, 542, 1145, 1169, 1197, 1542, 2034
Bse21I CCTNAGG 1 cut(s) 692
Bse3DI GCAATG 1 cut(s) 151
BseAI TCCGGA 1 cut(s) 716
BseBI CCWGG 2 cut(s) 805, 859
BseDI CCNNGG 2 cut(s) 804, 858
BseGI GGATG 7 cut(s) 795, 799, 849, 853, 1378, 1925, 1965
BseLI CCNNNNNNNGG 3 cut(s) 20, 1023, 1906
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 3 cut(s) 101, 121, 1566
BseNI ACTGG 9 cut(s) 276, 472, 501, 542, 1145, 1169, 1197, 1542, 2034
BseRI GAGGAG 3 cut(s) 75, 252, 1912
BseSI GKGCMC 1 cut(s) 1518
BseXI GCAGC 5 cut(s) 403, 598, 1005, 1620, 1733
BsgI GTGCAG 4 cut(s) 1039, 1193, 1671, 1958
Bsh1285I CGRYCG 2 cut(s) 115, 1386
BshFI GGCC 5 cut(s) 259, 551, 697, 1551, 1862
BshNI GGYRCC 1 cut(s) 659
BshTI ACCGGT 1 cut(s) 951
BsiEI CGRYCG 2 cut(s) 115, 1386
BsiHKAI GWGCWC 2 cut(s) 1518, 1920
BsiHKCI CYCGRG 3 cut(s) 234, 893, 1125
BsiSI CCGG 5 cut(s) 482, 717, 952, 1017, 1593
BslFI GGGAC 2 cut(s) 758, 1295
BslI CCNNNNNNNGG 3 cut(s) 20, 1023, 1906
BsmAI GTCTC 5 cut(s) 21, 453, 678, 1401, 2005
BsmBI CGTCTC 1 cut(s) 453
BsmFI GGGAC 2 cut(s) 758, 1295
BsnI GGCC 5 cut(s) 259, 551, 697, 1551, 1862
Bso31I GGTCTC 1 cut(s) 21
BsoBI CYCGRG 3 cut(s) 234, 893, 1125
Bsp1286I GDGCHC 3 cut(s) 405, 1518, 1920
Bsp13I TCCGGA 1 cut(s) 716
Bsp1407I TGTACA 2 cut(s) 520, 1802
BspACI CCGC 3 cut(s) 677, 1259, 1724
BspANI GGCC 5 cut(s) 259, 551, 697, 1551, 1862
BspCNI CTCAG 3 cut(s) 100, 120, 1567
BspEI TCCGGA 1 cut(s) 716
BspHI TCATGA 1 cut(s) 70
BspLI GGNNCC 3 cut(s) 661, 698, 2041
BspMAI CTGCAG 2 cut(s) 355, 1723
BspOI GCTAGC 1 cut(s) 647
BspPI GGATC 4 cut(s) 319, 328, 1087, 1559
BspT107I GGYRCC 1 cut(s) 659
BspTI CTTAAG 3 cut(s) 211, 998, 1445
BspTNI GGTCTC 1 cut(s) 21
BsrDI GCAATG 1 cut(s) 151
BsrFI RCCGGY 3 cut(s) 951, 1016, 1592
BsrGI TGTACA 2 cut(s) 520, 1802
BsrI ACTGG 9 cut(s) 276, 472, 501, 542, 1145, 1169, 1197, 1542, 2034
BssAI RCCGGY 3 cut(s) 951, 1016, 1592
BssECI CCNNGG 2 cut(s) 804, 858
BssNI GRCGYC 1 cut(s) 1689
BssSI CACGAG 1 cut(s) 1284
Bst2BI CACGAG 1 cut(s) 1284
Bst2UI CCWGG 2 cut(s) 805, 859
Bst4CI ACNGT 8 cut(s) 51, 128, 525, 966, 1370, 1879, 1984, 2016
Bst6I CTCTTC 1 cut(s) 19
BstACI GRCGYC 1 cut(s) 1689
BstAFI CTTAAG 3 cut(s) 211, 998, 1445
BstAPI GCANNNNNTGC 1 cut(s) 155
BstAUI TGTACA 2 cut(s) 520, 1802
BstBAI YACGTR 1 cut(s) 1709
BstC8I GCNNGC 5 cut(s) 227, 645, 1989, 1993, 1997
BstDEI CTNAG 5 cut(s) 87, 107, 376, 692, 1575
BstF5I GGATG 7 cut(s) 795, 799, 849, 853, 1378, 1925, 1965
BstH2I RGCGCY 3 cut(s) 758, 812, 1193
BstHHI GCGC 5 cut(s) 757, 811, 1192, 1318, 2001
BstMAI GTCTC 5 cut(s) 21, 453, 678, 1401, 2005
BstMCI CGRYCG 2 cut(s) 115, 1386
BstMWI GCNNNNNNNGC 7 cut(s) 155, 222, 359, 425, 644, 1497, 1522
BstNI CCWGG 2 cut(s) 805, 859
BstNSI RCATGY 5 cut(s) 47, 777, 831, 1024, 1803
BstPAI GACNNNNGTC 1 cut(s) 1542
BstSCI CCNGG 3 cut(s) 481, 803, 857
BstSFI CTRYAG 2 cut(s) 351, 1719
BstSLI GKGCMC 1 cut(s) 1518
BstV1I GCAGC 5 cut(s) 403, 598, 1005, 1620, 1733
BstV2I GAAGAC 1 cut(s) 54
BstX2I RGATCY 3 cut(s) 17, 289, 333
BstXI CCANNNNNNTGG 3 cut(s) 412, 1078, 1987
BstYI RGATCY 3 cut(s) 17, 289, 333
Bsu36I CCTNAGG 1 cut(s) 692
BsuRI GGCC 5 cut(s) 259, 551, 697, 1551, 1862
BtgZI GCGATG 1 cut(s) 1411
BtsCI GGATG 7 cut(s) 795, 799, 849, 853, 1378, 1925, 1965
BtsIMutI CAGTG 6 cut(s) 138, 465, 549, 1176, 1875, 1980
Cac8I GCNNGC 5 cut(s) 227, 645, 1989, 1993, 1997
CciI TCATGA 1 cut(s) 70
CfoI GCGC 5 cut(s) 757, 811, 1192, 1318, 2001
Cfr10I RCCGGY 3 cut(s) 951, 1016, 1592
Cfr13I GGNCC 5 cut(s) 696, 944, 1435, 1550, 1860
CseI GACGC 2 cut(s) 1514, 1697
CspAI ACCGGT 1 cut(s) 951
CspCI CAANNNNNGTGG 4 cut(s) 1801, 1836, 1918, 1953
DdeI CTNAG 5 cut(s) 87, 107, 376, 692, 1575
DraIII CACNNNGTG 1 cut(s) 1074
DriI GACNNNNNGTC 1 cut(s) 1144
EaeI YGGCCR 1 cut(s) 549
Eam1104I CTCTTC 1 cut(s) 19
Eam1105I GACNNNNNGTC 1 cut(s) 1144
EarI CTCTTC 1 cut(s) 19
Eco147I AGGCCT 1 cut(s) 259
Eco24I GRGCYC 1 cut(s) 405
Eco31I GGTCTC 1 cut(s) 21
Eco32I GATATC 1 cut(s) 208
Eco47I GGWCC 2 cut(s) 944, 1435
Eco57I CTGAAG 1 cut(s) 77
Eco81I CCTNAGG 1 cut(s) 692
Eco88I CYCGRG 3 cut(s) 234, 893, 1125
EcoO109I RGGNCCY 1 cut(s) 696
EcoRI GAATTC 1 cut(s) 182
EcoRII CCWGG 2 cut(s) 803, 857
EcoRV GATATC 1 cut(s) 208
EcoT22I ATGCAT 7 cut(s) 151, 640, 775, 799, 829, 853, 1832
EcoT38I GRGCYC 1 cut(s) 405
Esp3I CGTCTC 1 cut(s) 453
FalI AAGNNNNNCTT 2 cut(s) 1763, 1795
FaqI GGGAC 2 cut(s) 758, 1295
FbaI TGATCA 2 cut(s) 73, 1939
FblI GTMKAC 2 cut(s) 1137, 1201
Fnu4HI GCNGC 5 cut(s) 417, 612, 994, 1634, 1722
FokI GGATG 7 cut(s) 802, 806, 856, 860, 1365, 1912, 1972
FriOI GRGCYC 1 cut(s) 405
Fsp4HI GCNGC 5 cut(s) 417, 612, 994, 1634, 1722
FspBI CTAG 5 cut(s) 533, 596, 644, 990, 1341
FspI TGCGCA 1 cut(s) 2000
GlaI GCGC 5 cut(s) 756, 810, 1191, 1317, 2000
GluI GCNGC 5 cut(s) 417, 612, 994, 1634, 1722
HaeII RGCGCY 3 cut(s) 758, 812, 1193
HaeIII GGCC 5 cut(s) 259, 551, 697, 1551, 1862
HapII CCGG 5 cut(s) 482, 717, 952, 1017, 1593
HgaI GACGC 2 cut(s) 1514, 1697
HhaI GCGC 5 cut(s) 757, 811, 1192, 1318, 2001
Hin1I GRCGYC 1 cut(s) 1689
Hin6I GCGC 5 cut(s) 755, 809, 1190, 1316, 1999
HinP1I GCGC 5 cut(s) 755, 809, 1190, 1316, 1999
HincII GTYRAC 1 cut(s) 1138
HindII GTYRAC 1 cut(s) 1138
HindIII AAGCTT 2 cut(s) 101, 227
HinfI GANTC 8 cut(s) 475, 746, 1049, 1216, 1279, 1409, 1418, 1850
HpaII CCGG 5 cut(s) 482, 717, 952, 1017, 1593
HphI GGTGA 2 cut(s) 1237, 1616
Hpy166II GTNNAC 9 cut(s) 119, 521, 947, 1138, 1156, 1202, 1442, 1516, 1581
Hpy188I TCNGA 9 cut(s) 78, 90, 338, 871, 1111, 1221, 1383, 1530, 1587
Hpy188III TCNNGA 8 cut(s) 21, 71, 717, 895, 1096, 1127, 1286, 1943
Hpy8I GTNNAC 9 cut(s) 119, 521, 947, 1138, 1156, 1202, 1442, 1516, 1581
Hpy99I CGWCG 2 cut(s) 1530, 1971
HpyAV CCTTC 4 cut(s) 626, 944, 1470, 1840
HpyCH4III ACNGT 8 cut(s) 51, 128, 525, 966, 1370, 1879, 1984, 2016
HpyCH4IV ACGT 4 cut(s) 343, 1085, 1242, 1708
HpyF10VI GCNNNNNNNGC 7 cut(s) 155, 222, 359, 425, 644, 1497, 1522
HpyF3I CTNAG 5 cut(s) 87, 107, 376, 692, 1575
HpySE526I ACGT 4 cut(s) 343, 1085, 1242, 1708
Hsp92I GRCGYC 1 cut(s) 1689
HspAI GCGC 5 cut(s) 755, 809, 1190, 1316, 1999
Kpn2I TCCGGA 1 cut(s) 716
Ksp22I TGATCA 2 cut(s) 73, 1939
LmnI GCTCC 5 cut(s) 141, 239, 1359, 1488, 2039
Lsp1109I GCAGC 5 cut(s) 403, 598, 1005, 1620, 1733
LweI GCATC 5 cut(s) 76, 784, 838, 1620, 1950
MaeI CTAG 5 cut(s) 533, 596, 644, 990, 1341
MaeII ACGT 4 cut(s) 343, 1085, 1242, 1708
MaeIII GTNAC 9 cut(s) 278, 510, 599, 1081, 1120, 1243, 1604, 1664, 1903
MboII GAAGA 6 cut(s) 36, 54, 215, 404, 1244, 1611
MflI RGATCY 3 cut(s) 17, 289, 333
MhlI GDGCHC 3 cut(s) 405, 1518, 1920
MlsI TGGCCA 1 cut(s) 551
MluCI AATT 6 cut(s) 182, 722, 1788, 1806, 1838, 2048
MluNI TGGCCA 1 cut(s) 551
MlyI GAGTC 4 cut(s) 740, 1210, 1403, 1859
MmeI TCCRAC 2 cut(s) 361, 1508
Mox20I TGGCCA 1 cut(s) 551
Mph1103I ATGCAT 7 cut(s) 151, 640, 775, 799, 829, 853, 1832
MroI TCCGGA 1 cut(s) 716
MscI TGGCCA 1 cut(s) 551
MseI TTAA 6 cut(s) 212, 309, 999, 1446, 1521, 1841
MslI CAYNNNNRTG 2 cut(s) 1061, 1272
Msp20I TGGCCA 1 cut(s) 551
MspA1I CMGCKG 1 cut(s) 1724
MspCI CTTAAG 3 cut(s) 211, 998, 1445
MspI CCGG 5 cut(s) 482, 717, 952, 1017, 1593
MspR9I CCNGG 3 cut(s) 483, 805, 859
MvaI CCWGG 2 cut(s) 805, 859
MwoI GCNNNNNNNGC 7 cut(s) 155, 222, 359, 425, 644, 1497, 1522
NciI CCSGG 1 cut(s) 483
NheI GCTAGC 1 cut(s) 643
NlaIV GGNNCC 3 cut(s) 661, 698, 2041
NmeAIII GCCGAG 1 cut(s) 587
NmuCI GTSAC 4 cut(s) 1243, 1604, 1664, 1903
NsbI TGCGCA 1 cut(s) 2000
NsiI ATGCAT 7 cut(s) 151, 640, 775, 799, 829, 853, 1832
NspI RCATGY 5 cut(s) 47, 777, 831, 1024, 1803
PaeR7I CTCGAG 3 cut(s) 234, 893, 1125
PagI TCATGA 1 cut(s) 70
PceI AGGCCT 1 cut(s) 259
PciI ACATGT 1 cut(s) 1799
PfeI GAWTC 4 cut(s) 475, 1049, 1279, 1418
PfoI TCCNGGA 1 cut(s) 481
PinAI ACCGGT 1 cut(s) 951
PkrI GCNGC 5 cut(s) 418, 613, 995, 1635, 1723
Ple19I CGATCG 2 cut(s) 115, 1386
PleI GAGTC 4 cut(s) 740, 1210, 1403, 1858
PpsI GAGTC 4 cut(s) 740, 1210, 1403, 1858
Ppu21I YACGTR 1 cut(s) 1709
PscI ACATGT 1 cut(s) 1799
PshAI GACNNNNGTC 1 cut(s) 1542
PsiI TTATAA 1 cut(s) 252
Psp1406I AACGTT 1 cut(s) 1085
Psp6I CCWGG 2 cut(s) 803, 857
PspGI CCWGG 2 cut(s) 803, 857
PspN4I GGNNCC 3 cut(s) 661, 698, 2041
PspPI GGNCC 5 cut(s) 696, 944, 1435, 1550, 1860
PspXI VCTCGAGB 1 cut(s) 234
PstI CTGCAG 2 cut(s) 355, 1723
PsuI RGATCY 3 cut(s) 17, 289, 333
PvuI CGATCG 2 cut(s) 115, 1386
RseI CAYNNNNRTG 2 cut(s) 1061, 1272
SalI GTCGAC 1 cut(s) 1136
SaqAI TTAA 6 cut(s) 212, 309, 999, 1446, 1521, 1841
SatI GCNGC 5 cut(s) 417, 612, 994, 1634, 1722
Sau96I GGNCC 5 cut(s) 696, 944, 1435, 1550, 1860
ScaI AGTACT 1 cut(s) 653
SchI GAGTC 4 cut(s) 740, 1210, 1403, 1859
ScrFI CCNGG 3 cut(s) 483, 805, 859
SduI GDGCHC 3 cut(s) 405, 1518, 1920
SfaNI GCATC 5 cut(s) 76, 784, 838, 1620, 1950
SfcI CTRYAG 2 cut(s) 351, 1719
Sfr274I CTCGAG 3 cut(s) 234, 893, 1125
SinI GGWCC 2 cut(s) 944, 1435
SlaI CTCGAG 3 cut(s) 234, 893, 1125
SmiMI CAYNNNNRTG 2 cut(s) 1061, 1272
SmlI CTYRAG 7 cut(s) 211, 234, 893, 998, 1125, 1445, 1730
SmoI CTYRAG 7 cut(s) 211, 234, 893, 998, 1125, 1445, 1730
Sse9I AATT 6 cut(s) 182, 722, 1788, 1806, 1838, 2048
SseBI AGGCCT 1 cut(s) 259
SsiI CCGC 3 cut(s) 677, 1259, 1724
SspI AATATT 1 cut(s) 737
SspMI CTAG 5 cut(s) 533, 596, 644, 990, 1341
StuI AGGCCT 1 cut(s) 259
StyD4I CCNGG 3 cut(s) 481, 803, 857
TaaI ACNGT 8 cut(s) 51, 128, 525, 966, 1370, 1879, 1984, 2016
TaiI ACGT 4 cut(s) 346, 1088, 1245, 1711
TaqI TCGA 8 cut(s) 7, 235, 894, 937, 961, 1126, 1137, 1386
TasI AATT 6 cut(s) 182, 722, 1788, 1806, 1838, 2048
TatI WGTACW 5 cut(s) 46, 520, 651, 1113, 1802
TfiI GAWTC 4 cut(s) 475, 1049, 1279, 1418
Tru1I TTAA 6 cut(s) 212, 309, 999, 1446, 1521, 1841
Tru9I TTAA 6 cut(s) 212, 309, 999, 1446, 1521, 1841
TscAI CASTG 6 cut(s) 138, 472, 549, 1176, 1882, 1987
TseFI GTSAC 4 cut(s) 1243, 1604, 1664, 1903
TseI GCWGC 5 cut(s) 416, 611, 993, 1633, 1721
Tsp45I GTSAC 4 cut(s) 1243, 1604, 1664, 1903
TspDTI ATGAA 3 cut(s) 614, 1079, 1815
TspGWI ACGGA 1 cut(s) 1427
TspRI CASTG 6 cut(s) 138, 472, 549, 1176, 1882, 1987
Vha464I CTTAAG 3 cut(s) 211, 998, 1445
VneI GTGCAC 1 cut(s) 1514
VpaK11BI GGWCC 2 cut(s) 944, 1435
XapI RAATTY 2 cut(s) 182, 722
XceI RCATGY 5 cut(s) 47, 777, 831, 1024, 1803
XhoI CTCGAG 3 cut(s) 234, 893, 1125
XmiI GTMKAC 2 cut(s) 1137, 1201
XspI CTAG 5 cut(s) 533, 596, 644, 990, 1341
ZrmI AGTACT 1 cut(s) 653
Zsp2I ATGCAT 7 cut(s) 151, 640, 775, 799, 829, 853, 1832
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.