Rroxscaffold_4G00328240

Plant mobile domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0000179
Physical Location & Seq
Forward (+)
61147696 .. 61148567
872 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00328240.1

Sequence Viewer

Length: 759 bp
ATGAAAGAGGAAGGGGACAAATCAGAATCCGTACATGCTTCATGTCCTGGCTTTGGAAGGTTTTGTATGAGGCAAAGTTCAATGGAACACACCAGTAAGATATCCCCTTCCAAGGAGGTTTCATCTGACAGAAACAATATTGATGCAGAGCATATTATCTCTAAAATTCGCCGCAAAGCAACGTCGAAGTTGTTGGAACACATCAAGCAGATTGTGTTAAAGAATCCCATAGAGTGCCTTCCACTATTCAAAGTAGAACTTGAAAAGCTCATCGCTGCCTTTACCGAGTATGGGATTGATCCTTCACCATTAAAGGTCAATGTTGACAAGCTCATGATGGATATTGCTAATTACAATTCCATGCAGTCTGCTTGCTCCGGGAAGATAGCTCCAGAGGTACAGCATCAGCAGTTGGTTGACAATAAATCTCGTCTTGACAGAGCCTTTAATCTTCAAACAGCTGAAAAATGTCAATATGAATCGCTACTTGACTCCCTAGCCTCTTCAGAGAATCGTAGAGAGAAGCTGAAAAGAGAGCAAGAACGATTGGAGGAGCGGATAGACAAGCTTCGTGTTTCCATATCAGGAAGTGAGTTAAAGATAGCTGAACATAAAAATGCTGTTGACCGGTTGCTGAAACAGAAAGTCGAAATTTCAAAGACTCCCGTATTGACTTCTAAAGATGCTAAAACTTTGAAGAATCTGAAAGATTCACTCGAGGGTCAGTGCAAAGGCTTCAAGGACTTTACTTTGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMD

Protein Analysis

252

Amino Acids

28.66

Weight (kDa)

9.0

Isoelectric Point (pI)

47.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000179)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18561 FvH4_1g29681 FvH4_2g15190 FvH4_3g22800 FvH4_3g22801 FvH4_3g26700 FvH4_4g15162 FvH4_4g15163 FvH4_4g15164 FvH4_4g22273 FvH4_7g02320 FvH4_7g03670 FvH4_7g03671
malus_domestica MD07G1097100.v1.1 MD11G1208600.v1.1 MD15G1303300.v1.1
prunus_persica Prupe.2G070800_v2.0.a1
pyrus_communis pycom02g13430 pycom04g06950 pycom04g09420 pycom04g09610 pycom06g05740 pycom07g00010 pycom07g06720 pycom07g09960 pycom07g10670 pycom07g10680 pycom07g10920 pycom07g27810 pycom08g12110 pycom08g13640 pycom09g03570 pycom09g13470 pycom09g13510 pycom10g01180 pycom10g02180 pycom10g06840 pycom12424g00130 pycom12g03090 pycom12g09570 pycom12g09580 pycom12g09590 pycom1310g00020 pycom13g25030 pycom13g25310 pycom13g25700 pycom13g26160 pycom13g27790 pycom13g28780 pycom13g28790 pycom1683g00070 pycom16g19330 pycom16g21210 pycom16g21710 pycom16g23400 pycom16g24730 pycom17g17550 pycom17g27670 pycom420g00110 pycom420g00130 pycom420g00610 pycom520g00600 pycom675g00050
rosa_chinensis RchiOBHm_Chr1g0316731
rosa_laevigata RLG00000030467
rosa_multiflora Rmu_co8112106.1_g000001 Rmu_co8301911.1_g000001 Rmu_sc0000161.1_g000042 Rmu_sc0000161.1_g000043 Rmu_sc0000173.1_g000035 Rmu_sc0000173.1_g000036 Rmu_sc0000480.1_g000024 Rmu_sc0000670.1_g000020 Rmu_sc0000670.1_g000021 Rmu_sc0000962.1_g000043 Rmu_sc0000962.1_g000044 Rmu_sc0001025.1_g000004 Rmu_sc0001075.1_g000026 Rmu_sc0001075.1_g000027 Rmu_sc0001167.1_g000050 Rmu_sc0001227.1_g000043 Rmu_sc0001346.1_g000006 Rmu_sc0001438.1_g000034 Rmu_sc0001946.1_g000002 Rmu_sc0001981.1_g000005 Rmu_sc0002106.1_g000005 Rmu_sc0002187.1_g000004 Rmu_sc0002187.1_g000005 Rmu_sc0002187.1_g000018 Rmu_sc0002539.1_g000097 Rmu_sc0003008.1_g000050 Rmu_sc0003008.1_g000051 Rmu_sc0003069.1_g000033 Rmu_sc0003069.1_g000034 Rmu_sc0003412.1_g000016 Rmu_sc0003553.1_g000005 Rmu_sc0003553.1_g000006 Rmu_sc0003641.1_g000025 Rmu_sc0003652.1_g000006 Rmu_sc0003687.1_g000019 Rmu_sc0003687.1_g000020 Rmu_sc0004234.1_g000013 Rmu_sc0004249.1_g000005 Rmu_sc0005044.1_g000027 Rmu_sc0005060.1_g000012 Rmu_sc0005816.1_g000005 Rmu_sc0006175.1_g000006 Rmu_sc0006175.1_g000007 Rmu_sc0006695.1_g000046 Rmu_sc0006725.1_g000014 Rmu_sc0006746.1_g000015 Rmu_sc0006746.1_g000016 Rmu_sc0006912.1_g000008 Rmu_sc0007355.1_g000004 Rmu_sc0007705.1_g000001 Rmu_sc0007903.1_g000003 Rmu_sc0007953.1_g000001 Rmu_sc0008630.1_g000001 Rmu_sc0008923.1_g000018 Rmu_sc0008923.1_g000019 Rmu_sc0009186.1_g000003 Rmu_sc0010184.1_g000007 Rmu_sc0010243.1_g000001 Rmu_sc0011242.1_g000004 Rmu_sc0012849.1_g000001 Rmu_sc0012849.1_g000002 Rmu_sc0012883.1_g000001 Rmu_sc0013028.1_g000015 Rmu_sc0015042.1_g000003 Rmu_sc0016730.1_g000002 Rmu_sc0017702.1_g000002 Rmu_sc0017791.1_g000007 Rmu_sc0017874.1_g000005 Rmu_sc0025334.1_g000001 Rmu_sc0025334.1_g000002 Rmu_sc0028789.1_g000001 Rmu_sc0030538.1_g000001 Rmu_sc0033137.1_g000001 Rmu_ssc0000183.1_g000013 Rmu_ssc0000259.1_g000061 Rmu_ssc0000259.1_g000062 Rmu_ssc0000259.1_g000063
rosa_roxburghii Rroxscaffold_173G00435030 Rroxscaffold_173G00435040 Rroxscaffold_1G00033030 Rroxscaffold_2G00093360 Rroxscaffold_2G00113080 Rroxscaffold_2G00146180 Rroxscaffold_3G00227920 Rroxscaffold_3G00251750 Rroxscaffold_4G00328240 Rroxscaffold_5G00333920 Rroxscaffold_5G00338240 Rroxscaffold_5G00342700 Rroxscaffold_6G00412810 Rroxscaffold_6G00423130 Rroxscaffold_7G00175190
rosa_rugosa Rorug01G0029200 Rorug01G0029300 Rorug01G0029400 Rorug01G0029400
rosa_samantha Rh1AG040900 Rh1BG038100 Rh1CG042000 Rh1DG027900
rosa_wichuraiana Rw0G019970 Rw1G003400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 556
AciI CCGC 2 cut(s) 172, 556
AclWI GGATC 1 cut(s) 293
AcsI RAATTY 2 cut(s) 165, 651
AcuI CTGAAG 1 cut(s) 489
AfaI GTAC 2 cut(s) 33, 399
AfiI CCNNNNNNNGG 3 cut(s) 53, 112, 291
AgeI ACCGGT 1 cut(s) 627
AgsI TTSAA 7 cut(s) 81, 250, 263, 455, 657, 697, 739
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 7 cut(s) 268, 331, 389, 461, 526, 568, 605
AluI AGCT 7 cut(s) 268, 331, 389, 461, 526, 568, 605
AlwI GGATC 1 cut(s) 293
Ama87I CYCGRG 1 cut(s) 716
ApeKI GCWGC 1 cut(s) 275
ApoI RAATTY 2 cut(s) 165, 651
AsiGI ACCGGT 1 cut(s) 627
AsuC2I CCSGG 1 cut(s) 379
AsuHPI GGTGA 1 cut(s) 297
AvaI CYCGRG 1 cut(s) 716
BbvI GCAGC 1 cut(s) 262
BccI CCATC 1 cut(s) 331
BciT130I CCWGG 1 cut(s) 48
BcnI CCSGG 1 cut(s) 379
BfaI CTAG 1 cut(s) 497
BisI GCNGC 2 cut(s) 172, 276
BlsI GCNGC 2 cut(s) 173, 277
Bme1390I CCNGG 2 cut(s) 48, 379
BmeT110I CYCGRG 1 cut(s) 716
BmrFI CCNGG 2 cut(s) 48, 379
BmsI GCATC 3 cut(s) 133, 412, 673
BpmI CTGGAG 1 cut(s) 375
BpuMI CCSGG 1 cut(s) 379
BsaJI CCNNGG 1 cut(s) 111
BsaWI WCCGGW 1 cut(s) 627
Bsc4I CCNNNNNNNGG 3 cut(s) 53, 112, 291
Bse118I RCCGGY 1 cut(s) 627
Bse1I ACTGG 1 cut(s) 93
BseBI CCWGG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 111
BseLI CCNNNNNNNGG 3 cut(s) 53, 112, 291
BseNI ACTGG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 566
BseXI GCAGC 1 cut(s) 262
BshTI ACCGGT 1 cut(s) 627
BsiHKCI CYCGRG 1 cut(s) 716
BsiSI CCGG 2 cut(s) 378, 628
BslFI GGGAC 1 cut(s) 29
BslI CCNNNNNNNGG 3 cut(s) 53, 112, 291
BsmFI GGGAC 1 cut(s) 29
BsoBI CYCGRG 1 cut(s) 716
Bsp143I GATC 1 cut(s) 298
BspACI CCGC 2 cut(s) 172, 556
BspHI TCATGA 1 cut(s) 333
BspPI GGATC 1 cut(s) 293
BsrBI CCGCTC 1 cut(s) 556
BsrFI RCCGGY 1 cut(s) 627
BsrI ACTGG 1 cut(s) 93
BssAI RCCGGY 1 cut(s) 627
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 1 cut(s) 298
BssT1I CCWWGG 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 48
Bst6I CTCTTC 1 cut(s) 508
BstC8I GCNNGC 1 cut(s) 373
BstKTI GATC 1 cut(s) 301
BstMBI GATC 1 cut(s) 298
BstNI CCWGG 1 cut(s) 48
BstNSI RCATGY 1 cut(s) 38
BstSCI CCNGG 2 cut(s) 46, 377
BstV1I GCAGC 1 cut(s) 262
BtgZI GCGATG 1 cut(s) 256
BtsIMutI CAGTG 1 cut(s) 731
Cac8I GCNNGC 1 cut(s) 373
CciI TCATGA 1 cut(s) 333
Cfr10I RCCGGY 1 cut(s) 627
Csp6I GTAC 2 cut(s) 32, 398
CspAI ACCGGT 1 cut(s) 627
CviAII CATG 4 cut(s) 35, 42, 334, 361
CviQI GTAC 2 cut(s) 32, 398
DpnI GATC 1 cut(s) 300
DpnII GATC 1 cut(s) 298
Eam1104I CTCTTC 1 cut(s) 508
EarI CTCTTC 1 cut(s) 508
Eco130I CCWWGG 1 cut(s) 111
Eco32I GATATC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 489
Eco88I CYCGRG 1 cut(s) 716
EcoRII CCWGG 1 cut(s) 46
EcoRV GATATC 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 4 cut(s) 38, 45, 337, 364
FalI AAGNNNNNCTT 2 cut(s) 243, 275
FaqI GGGAC 1 cut(s) 29
FatI CATG 4 cut(s) 34, 41, 333, 360
Fnu4HI GCNGC 2 cut(s) 172, 276
Fsp4HI GCNGC 2 cut(s) 172, 276
FspBI CTAG 1 cut(s) 497
GluI GCNGC 2 cut(s) 172, 276
GsuI CTGGAG 1 cut(s) 375
HapII CCGG 2 cut(s) 378, 628
Hin1II CATG 4 cut(s) 38, 45, 337, 364
HincII GTYRAC 3 cut(s) 325, 418, 625
HindII GTYRAC 3 cut(s) 325, 418, 625
HindIII AAGCTT 1 cut(s) 566
HinfI GANTC 8 cut(s) 26, 223, 479, 491, 511, 661, 700, 710
HpaII CCGG 2 cut(s) 378, 628
HphI GGTGA 1 cut(s) 297
Hpy166II GTNNAC 3 cut(s) 325, 418, 625
Hpy188I TCNGA 4 cut(s) 25, 127, 508, 705
Hpy188III TCNNGA 4 cut(s) 334, 392, 434, 585
Hpy8I GTNNAC 3 cut(s) 325, 418, 625
Hpy99I CGWCG 1 cut(s) 187
HpyAV CCTTC 5 cut(s) 5, 51, 117, 248, 312
HpyCH4IV ACGT 1 cut(s) 182
HpyCH4V TGCA 3 cut(s) 146, 364, 729
HpySE526I ACGT 1 cut(s) 182
Hsp92II CATG 4 cut(s) 38, 45, 337, 364
Kzo9I GATC 1 cut(s) 298
LmnI GCTCC 3 cut(s) 380, 394, 553
LpnPI CCDG 7 cut(s) 33, 60, 106, 391, 405, 570, 641
Lsp1109I GCAGC 1 cut(s) 262
LweI GCATC 3 cut(s) 133, 412, 673
MaeI CTAG 1 cut(s) 497
MaeII ACGT 1 cut(s) 182
MalI GATC 1 cut(s) 300
MbiI CCGCTC 1 cut(s) 556
MboI GATC 1 cut(s) 298
MboII GAAGA 4 cut(s) 394, 443, 495, 709
MluCI AATT 4 cut(s) 165, 349, 355, 651
MlyI GAGTC 2 cut(s) 485, 655
MmeI TCCRAC 1 cut(s) 174
MnlI CCTC 7 cut(s) 63, 109, 388, 511, 544, 712, 747
MseI TTAA 4 cut(s) 218, 311, 447, 596
MslI CAYNNNNRTG 1 cut(s) 615
MspA1I CMGCKG 1 cut(s) 461
MspI CCGG 2 cut(s) 378, 628
MspR9I CCNGG 2 cut(s) 48, 379
MvaI CCWGG 1 cut(s) 48
NciI CCSGG 1 cut(s) 379
NdeII GATC 1 cut(s) 298
NlaIII CATG 4 cut(s) 38, 45, 337, 364
NspI RCATGY 1 cut(s) 38
PaeR7I CTCGAG 1 cut(s) 716
PagI TCATGA 1 cut(s) 333
PfeI GAWTC 6 cut(s) 26, 223, 479, 511, 700, 710
PfoI TCCNGGA 1 cut(s) 377
PinAI ACCGGT 1 cut(s) 627
PkrI GCNGC 2 cut(s) 173, 277
PleI GAGTC 2 cut(s) 485, 655
PpsI GAGTC 2 cut(s) 485, 655
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspXI VCTCGAGB 1 cut(s) 716
PvuII CAGCTG 1 cut(s) 461
RsaI GTAC 2 cut(s) 33, 399
RsaNI GTAC 2 cut(s) 32, 398
RseI CAYNNNNRTG 1 cut(s) 615
SaqAI TTAA 4 cut(s) 218, 311, 447, 596
SatI GCNGC 2 cut(s) 172, 276
Sau3AI GATC 1 cut(s) 298
SchI GAGTC 2 cut(s) 485, 655
ScrFI CCNGG 2 cut(s) 48, 379
SfaNI GCATC 3 cut(s) 133, 412, 673
Sfr274I CTCGAG 1 cut(s) 716
SlaI CTCGAG 1 cut(s) 716
SmiMI CAYNNNNRTG 1 cut(s) 615
SmlI CTYRAG 1 cut(s) 716
SmoI CTYRAG 1 cut(s) 716
Sse9I AATT 4 cut(s) 165, 349, 355, 651
SsiI CCGC 2 cut(s) 172, 556
SspI AATATT 1 cut(s) 139
SspMI CTAG 1 cut(s) 497
StyD4I CCNGG 2 cut(s) 46, 377
StyI CCWWGG 1 cut(s) 111
TaiI ACGT 1 cut(s) 185
TaqI TCGA 3 cut(s) 185, 648, 717
TasI AATT 4 cut(s) 165, 349, 355, 651
TauI GCSGC 1 cut(s) 174
TfiI GAWTC 6 cut(s) 26, 223, 479, 511, 700, 710
Tru1I TTAA 4 cut(s) 218, 311, 447, 596
Tru9I TTAA 4 cut(s) 218, 311, 447, 596
TscAI CASTG 1 cut(s) 731
TseI GCWGC 1 cut(s) 275
TspDTI ATGAA 4 cut(s) 17, 30, 111, 492
TspGWI ACGGA 1 cut(s) 19
TspRI CASTG 1 cut(s) 731
XapI RAATTY 2 cut(s) 165, 651
XceI RCATGY 1 cut(s) 38
XhoI CTCGAG 1 cut(s) 716
XspI CTAG 1 cut(s) 497
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.