Rh1DG027900

Plant mobile domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
4223158 .. 4224032
875 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG027900.1

Sequence Viewer

Length: 510 bp
ATGAAAGAGGAAGGGGACAAATCAGAATCCGTACATGCTTCATGTCCTGGCTTTGGAAGGTTTTGTATGAGGCAAAGTTCAATGGAACACACCAATAAGATATCCCGTTCCAAGGAGTCTGCTTGCTCCGGGAAGATAGCTCCAGAGGTACAGCATCAGCGGTTGGCTGACAATAAATCTCATCTTGACAGAGCCTTTAATCTTCAAACAGCTGAAAAATGTCACTATGAATCGCTACTTGACTTCCTAGCCTCTTCAGAGAATCGTAGAGAGAAGCTGAAAAGAGAGCAAGAACGATTGGAGGAGCGGATAGACAAGCTTCGTGTTTCCATATCAGGAAGTGAGTTAAAGATAGCTGAACATAAAAATGCTGTTGATCGGTTGCTGAAACAGAAAGTCGAAATTTCAAAGACTCCCGTATTGACTTCTAAAGATGCTAAAACTTTGAAGAATCTGAAAGATTCACTCGAGGGTCAGTGCAAAGGCTTCAAGGACTTTACTTTGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

169

Amino Acids

19.32

Weight (kDa)

9.19

Isoelectric Point (pI)

50.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000179)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18561 FvH4_1g29681 FvH4_2g15190 FvH4_3g22800 FvH4_3g22801 FvH4_3g26700 FvH4_4g15162 FvH4_4g15163 FvH4_4g15164 FvH4_4g22273 FvH4_7g02320 FvH4_7g03670 FvH4_7g03671
malus_domestica MD07G1097100.v1.1 MD11G1208600.v1.1 MD15G1303300.v1.1
prunus_persica Prupe.2G070800_v2.0.a1
pyrus_communis pycom02g13430 pycom04g06950 pycom04g09420 pycom04g09610 pycom06g05740 pycom07g00010 pycom07g06720 pycom07g09960 pycom07g10670 pycom07g10680 pycom07g10920 pycom07g27810 pycom08g12110 pycom08g13640 pycom09g03570 pycom09g13470 pycom09g13510 pycom10g01180 pycom10g02180 pycom10g06840 pycom12424g00130 pycom12g03090 pycom12g09570 pycom12g09580 pycom12g09590 pycom1310g00020 pycom13g25030 pycom13g25310 pycom13g25700 pycom13g26160 pycom13g27790 pycom13g28780 pycom13g28790 pycom1683g00070 pycom16g19330 pycom16g21210 pycom16g21710 pycom16g23400 pycom16g24730 pycom17g17550 pycom17g27670 pycom420g00110 pycom420g00130 pycom420g00610 pycom520g00600 pycom675g00050
rosa_chinensis RchiOBHm_Chr1g0316731
rosa_laevigata RLG00000030467
rosa_multiflora Rmu_co8112106.1_g000001 Rmu_co8301911.1_g000001 Rmu_sc0000161.1_g000042 Rmu_sc0000161.1_g000043 Rmu_sc0000173.1_g000035 Rmu_sc0000173.1_g000036 Rmu_sc0000480.1_g000024 Rmu_sc0000670.1_g000020 Rmu_sc0000670.1_g000021 Rmu_sc0000962.1_g000043 Rmu_sc0000962.1_g000044 Rmu_sc0001025.1_g000004 Rmu_sc0001075.1_g000026 Rmu_sc0001075.1_g000027 Rmu_sc0001167.1_g000050 Rmu_sc0001227.1_g000043 Rmu_sc0001346.1_g000006 Rmu_sc0001438.1_g000034 Rmu_sc0001946.1_g000002 Rmu_sc0001981.1_g000005 Rmu_sc0002106.1_g000005 Rmu_sc0002187.1_g000004 Rmu_sc0002187.1_g000005 Rmu_sc0002187.1_g000018 Rmu_sc0002539.1_g000097 Rmu_sc0003008.1_g000050 Rmu_sc0003008.1_g000051 Rmu_sc0003069.1_g000033 Rmu_sc0003069.1_g000034 Rmu_sc0003412.1_g000016 Rmu_sc0003553.1_g000005 Rmu_sc0003553.1_g000006 Rmu_sc0003641.1_g000025 Rmu_sc0003652.1_g000006 Rmu_sc0003687.1_g000019 Rmu_sc0003687.1_g000020 Rmu_sc0004234.1_g000013 Rmu_sc0004249.1_g000005 Rmu_sc0005044.1_g000027 Rmu_sc0005060.1_g000012 Rmu_sc0005816.1_g000005 Rmu_sc0006175.1_g000006 Rmu_sc0006175.1_g000007 Rmu_sc0006695.1_g000046 Rmu_sc0006725.1_g000014 Rmu_sc0006746.1_g000015 Rmu_sc0006746.1_g000016 Rmu_sc0006912.1_g000008 Rmu_sc0007355.1_g000004 Rmu_sc0007705.1_g000001 Rmu_sc0007903.1_g000003 Rmu_sc0007953.1_g000001 Rmu_sc0008630.1_g000001 Rmu_sc0008923.1_g000018 Rmu_sc0008923.1_g000019 Rmu_sc0009186.1_g000003 Rmu_sc0010184.1_g000007 Rmu_sc0010243.1_g000001 Rmu_sc0011242.1_g000004 Rmu_sc0012849.1_g000001 Rmu_sc0012849.1_g000002 Rmu_sc0012883.1_g000001 Rmu_sc0013028.1_g000015 Rmu_sc0015042.1_g000003 Rmu_sc0016730.1_g000002 Rmu_sc0017702.1_g000002 Rmu_sc0017791.1_g000007 Rmu_sc0017874.1_g000005 Rmu_sc0025334.1_g000001 Rmu_sc0025334.1_g000002 Rmu_sc0028789.1_g000001 Rmu_sc0030538.1_g000001 Rmu_sc0033137.1_g000001 Rmu_ssc0000183.1_g000013 Rmu_ssc0000259.1_g000061 Rmu_ssc0000259.1_g000062 Rmu_ssc0000259.1_g000063
rosa_roxburghii Rroxscaffold_173G00435030 Rroxscaffold_173G00435040 Rroxscaffold_1G00033030 Rroxscaffold_2G00093360 Rroxscaffold_2G00113080 Rroxscaffold_2G00146180 Rroxscaffold_3G00227920 Rroxscaffold_3G00251750 Rroxscaffold_4G00328240 Rroxscaffold_5G00333920 Rroxscaffold_5G00338240 Rroxscaffold_5G00342700 Rroxscaffold_6G00412810 Rroxscaffold_6G00423130 Rroxscaffold_7G00175190
rosa_rugosa Rorug01G0029200 Rorug01G0029300 Rorug01G0029400 Rorug01G0029400
rosa_samantha Rh1AG040900 Rh1BG038100 Rh1CG042000 Rh1DG027900
rosa_wichuraiana Rw0G019970 Rw1G003400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 307
AciI CCGC 2 cut(s) 160, 307
AcsI RAATTY 1 cut(s) 402
AcuI CTGAAG 1 cut(s) 240
AfaI GTAC 2 cut(s) 33, 150
AfiI CCNNNNNNNGG 2 cut(s) 53, 112
AgsI TTSAA 5 cut(s) 81, 206, 408, 448, 490
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 5 cut(s) 140, 212, 277, 319, 356
AluI AGCT 5 cut(s) 140, 212, 277, 319, 356
Ama87I CYCGRG 1 cut(s) 467
ApoI RAATTY 1 cut(s) 402
AsuC2I CCSGG 1 cut(s) 130
AvaI CYCGRG 1 cut(s) 467
BciT130I CCWGG 1 cut(s) 48
BcnI CCSGG 1 cut(s) 130
BfaI CTAG 1 cut(s) 248
Bme1390I CCNGG 2 cut(s) 48, 130
BmeT110I CYCGRG 1 cut(s) 467
BmrFI CCNGG 2 cut(s) 48, 130
BmsI GCATC 2 cut(s) 163, 424
BpmI CTGGAG 1 cut(s) 126
BpuMI CCSGG 1 cut(s) 130
BsaJI CCNNGG 1 cut(s) 111
Bsc4I CCNNNNNNNGG 2 cut(s) 53, 112
BseBI CCWGG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 111
BseLI CCNNNNNNNGG 2 cut(s) 53, 112
BseRI GAGGAG 1 cut(s) 317
BsiHKCI CYCGRG 1 cut(s) 467
BsiSI CCGG 1 cut(s) 129
BslFI GGGAC 1 cut(s) 29
BslI CCNNNNNNNGG 2 cut(s) 53, 112
BsmFI GGGAC 1 cut(s) 29
BsoBI CYCGRG 1 cut(s) 467
Bsp143I GATC 1 cut(s) 376
BspACI CCGC 2 cut(s) 160, 307
BsrBI CCGCTC 1 cut(s) 307
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 1 cut(s) 376
BssT1I CCWWGG 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 48
Bst6I CTCTTC 1 cut(s) 259
BstC8I GCNNGC 1 cut(s) 124
BstKTI GATC 1 cut(s) 379
BstMBI GATC 1 cut(s) 376
BstNI CCWGG 1 cut(s) 48
BstNSI RCATGY 1 cut(s) 38
BstSCI CCNGG 2 cut(s) 46, 128
BtsIMutI CAGTG 1 cut(s) 482
Cac8I GCNNGC 1 cut(s) 124
Csp6I GTAC 2 cut(s) 32, 149
CviAII CATG 2 cut(s) 35, 42
CviQI GTAC 2 cut(s) 32, 149
DpnI GATC 1 cut(s) 378
DpnII GATC 1 cut(s) 376
Eam1104I CTCTTC 1 cut(s) 259
EarI CTCTTC 1 cut(s) 259
Eco130I CCWWGG 1 cut(s) 111
Eco32I GATATC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 240
Eco88I CYCGRG 1 cut(s) 467
EcoRII CCWGG 1 cut(s) 46
EcoRV GATATC 1 cut(s) 102
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 2 cut(s) 38, 45
FaiI YATR 6 cut(s) 36, 43, 68, 228, 332, 363
FaqI GGGAC 1 cut(s) 29
FatI CATG 2 cut(s) 34, 41
FspBI CTAG 1 cut(s) 248
GsuI CTGGAG 1 cut(s) 126
HapII CCGG 1 cut(s) 129
Hin1II CATG 2 cut(s) 38, 45
HindIII AAGCTT 1 cut(s) 317
HinfI GANTC 7 cut(s) 26, 116, 230, 262, 412, 451, 461
HpaII CCGG 1 cut(s) 129
Hpy188I TCNGA 3 cut(s) 25, 259, 456
Hpy188III TCNNGA 3 cut(s) 143, 185, 336
HpyAV CCTTC 2 cut(s) 5, 51
HpyCH4V TGCA 1 cut(s) 480
Hsp92II CATG 2 cut(s) 38, 45
Kzo9I GATC 1 cut(s) 376
LmnI GCTCC 3 cut(s) 131, 145, 304
LpnPI CCDG 5 cut(s) 33, 60, 142, 156, 321
LweI GCATC 2 cut(s) 163, 424
MaeI CTAG 1 cut(s) 248
MaeIII GTNAC 1 cut(s) 221
MalI GATC 1 cut(s) 378
MbiI CCGCTC 1 cut(s) 307
MboI GATC 1 cut(s) 376
MboII GAAGA 4 cut(s) 145, 194, 246, 460
MluCI AATT 1 cut(s) 402
MlyI GAGTC 2 cut(s) 125, 406
MnlI CCTC 6 cut(s) 63, 139, 262, 295, 463, 498
MseI TTAA 2 cut(s) 198, 347
MslI CAYNNNNRTG 1 cut(s) 366
MspA1I CMGCKG 2 cut(s) 160, 212
MspI CCGG 1 cut(s) 129
MspR9I CCNGG 2 cut(s) 48, 130
MvaI CCWGG 1 cut(s) 48
NciI CCSGG 1 cut(s) 130
NdeII GATC 1 cut(s) 376
NlaIII CATG 2 cut(s) 38, 45
NmuCI GTSAC 1 cut(s) 221
NspI RCATGY 1 cut(s) 38
PaeR7I CTCGAG 1 cut(s) 467
PfeI GAWTC 5 cut(s) 26, 230, 262, 451, 461
PfoI TCCNGGA 1 cut(s) 128
PleI GAGTC 2 cut(s) 124, 406
PpsI GAGTC 2 cut(s) 124, 406
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspXI VCTCGAGB 1 cut(s) 467
PvuII CAGCTG 1 cut(s) 212
RsaI GTAC 2 cut(s) 33, 150
RsaNI GTAC 2 cut(s) 32, 149
RseI CAYNNNNRTG 1 cut(s) 366
SaqAI TTAA 2 cut(s) 198, 347
Sau3AI GATC 1 cut(s) 376
SchI GAGTC 2 cut(s) 125, 406
ScrFI CCNGG 2 cut(s) 48, 130
SetI ASST 8 cut(s) 62, 142, 150, 214, 279, 321, 358, 509
SfaNI GCATC 2 cut(s) 163, 424
Sfr274I CTCGAG 1 cut(s) 467
SlaI CTCGAG 1 cut(s) 467
SmiMI CAYNNNNRTG 1 cut(s) 366
SmlI CTYRAG 1 cut(s) 467
SmoI CTYRAG 1 cut(s) 467
Sse9I AATT 1 cut(s) 402
SsiI CCGC 2 cut(s) 160, 307
SspMI CTAG 1 cut(s) 248
StyD4I CCNGG 2 cut(s) 46, 128
StyI CCWWGG 1 cut(s) 111
TaqI TCGA 2 cut(s) 399, 468
TasI AATT 1 cut(s) 402
TfiI GAWTC 5 cut(s) 26, 230, 262, 451, 461
Tru1I TTAA 2 cut(s) 198, 347
Tru9I TTAA 2 cut(s) 198, 347
TscAI CASTG 1 cut(s) 482
TseFI GTSAC 1 cut(s) 221
Tsp45I GTSAC 1 cut(s) 221
TspDTI ATGAA 3 cut(s) 17, 30, 243
TspGWI ACGGA 1 cut(s) 19
TspRI CASTG 1 cut(s) 482
XapI RAATTY 1 cut(s) 402
XceI RCATGY 1 cut(s) 38
XhoI CTCGAG 1 cut(s) 467
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.