Rmu_co8440151.1_g000001

receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8440151.1
OG0000114
Physical Location & Seq
Reverse (-)
2 .. 259
258 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8440151.1_g000001.1.cds

Sequence Viewer

Length: 258 bp
atgaaagctagtagtgtcgcagttgattcagctactacgggcgagtgtcaatataaggttatggttctggtgtttgaatccgcttctgaggctctgggcaacaatgcaacagatattcagactgccatagatggtggttttgaattggatgtgctaaatgatgatactggcctacgcaaaaattgcgtggcatcaggaggagtttgtgggcaaaactctactagtgctcaattcatttgcttttgccaggattcatct
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GUB_WAK_bind Pkinase Pkinase_Tyr WAK_assoc

Protein Analysis

86

Amino Acids

8.89

Weight (kDa)

4.05

Isoelectric Point (pI)

22.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000114)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_1g07120 FvH4_4g01160 FvH4_6g34940 FvH4_6g44062 FvH4_6g44106 FvH4_6g44106 FvH4_6g44106 FvH4_6g44107 FvH4_6g44107 FvH4_6g44109 FvH4_6g44140 FvH4_6g44190 FvH4_6g44200 FvH4_6g44240 FvH4_6g44241 FvH4_6g44242
malus_domestica MD09G1094900.v1.1 MD09G1100300.v1.1 MD09G1100400.v1.1 MD09G1100600.v1.1 MD09G1100800.v1.1 MD09G1100900.v1.1 MD09G1101300.v1.1 MD09G1255200.v1.1 MD17G1088400.v1.1 MD17G1088600.v1.1 MD17G1247900.v1.1 MD17G1248300.v1.1
prunus_persica Prupe.1G497000_v2.0.a1 Prupe.2G033300_v2.0.a1 Prupe.3G145500_v2.0.a1 Prupe.3G225400_v2.0.a1 Prupe.3G225700_v2.0.a1 Prupe.3G225700_v2.0.a1
pyrus_communis pycom06g12720 pycom06g12740 pycom09g01960 pycom09g02450 pycom17g08520 pycom17g08530 pycom17g08560 pycom17g24950 pycom17g25030 pycom17g25110 pycom17g25260 pycom17g25290
rosa_chinensis RchiOBHm_Chr1g0326521 RchiOBHm_Chr1g0326551 RchiOBHm_Chr1g0326591 RchiOBHm_Chr1g0328741 RchiOBHm_Chr1g0329371 RchiOBHm_Chr2g0145911 RchiOBHm_Chr2g0160891 RchiOBHm_Chr2g0160921 RchiOBHm_Chr2g0161001 RchiOBHm_Chr2g0161011 RchiOBHm_Chr2g0161431 RchiOBHm_Chr2g0165121 RchiOBHm_Chr2g0166301 RchiOBHm_Chr4g0399551 RchiOBHm_Chr4g0405681 RchiOBHm_Chr5g0066741 RchiOBHm_Chr5g0066841 RchiOBHm_Chr6g0273021 RchiOBHm_Chr7g0225151
rosa_laevigata RLG00000001843 RLG00000008827 RLG00000014283 RLG00000014284 RLG00000020173 RLG00000021244 RLG00000021246 RLG00000021248 RLG00000021283 RLG00000023606 RLG00000029921 RLG00000030066 RLG00000030067 RLG00000033456
rosa_multiflora Rmu_co7958161.1_g000001 Rmu_co8440151.1_g000001 Rmu_co8454989.1_g000001 Rmu_sc0000129.1_g000018 Rmu_sc0000322.1_g000011 Rmu_sc0000322.1_g000045 Rmu_sc0000605.1_g000051 Rmu_sc0000955.1_g000015 Rmu_sc0000955.1_g000020 Rmu_sc0001188.1_g000017 Rmu_sc0001188.1_g000019 Rmu_sc0001355.1_g000015 Rmu_sc0001702.1_g000005 Rmu_sc0001702.1_g000006 Rmu_sc0001702.1_g000007 Rmu_sc0001702.1_g000008 Rmu_sc0001702.1_g000009 Rmu_sc0001702.1_g000010 Rmu_sc0001702.1_g000011 Rmu_sc0001702.1_g000012 Rmu_sc0001702.1_g000013 Rmu_sc0001702.1_g000014 Rmu_sc0001702.1_g000015 Rmu_sc0001702.1_g000016 Rmu_sc0002473.1_g000012 Rmu_sc0002473.1_g000015 Rmu_sc0002773.1_g000029 Rmu_sc0004178.1_g000002 Rmu_sc0005189.1_g000006 Rmu_sc0005860.1_g000004 Rmu_sc0009205.1_g000005 Rmu_sc0009205.1_g000007 Rmu_sc0009205.1_g000023 Rmu_sc0009472.1_g000005 Rmu_sc0009858.1_g000015 Rmu_sc0020187.1_g000001
rosa_roxburghii Rroxscaffold_176G00431460 Rroxscaffold_176G00431480 Rroxscaffold_1G00014330 Rroxscaffold_1G00031590 Rroxscaffold_2G00088820 Rroxscaffold_2G00089330 Rroxscaffold_2G00089360 Rroxscaffold_2G00089370 Rroxscaffold_2G00089380 Rroxscaffold_2G00100370 Rroxscaffold_2G00100380 Rroxscaffold_4G00321410 Rroxscaffold_4G00323700 Rroxscaffold_4G00327640 Rroxscaffold_4G00327650 Rroxscaffold_5G00344450 Rroxscaffold_7G00202770 Rroxscaffold_7G00203450 Rroxscaffold_7G00203540
rosa_rugosa Rorug01G0061100 Rorug02G0482100 Rorug02G0485900 Rorug02G0485900 Rorug02G0489500 Rorug02G0489600 Rorug02G0489700 Rorug04G0016600 Rorug04G0016700 Rorug05G0379000 Rorug05G0516700 Rorug06G0007900 Rorug06G0009300
rosa_samantha Rh1AG076700 Rh1AG076800 Rh1AG077000 Rh1AG077300 Rh1AG094400 Rh1AG097500 Rh1AG402000 Rh1BG062700 Rh1BG062900 Rh1CG075500 Rh1CG075600 Rh1CG075800 Rh1CG090900 Rh1CG091400 Rh1CG091600 Rh1CG094100 Rh1DG082300 Rh1DG082500 Rh1DG097400 Rh2AG448200 Rh2AG448300 Rh2AG511600 Rh2AG547500 Rh2AG551400 Rh2AG551700 Rh2AG555800 Rh2AG588000 Rh2BG565900 Rh2BG566000 Rh2BG566300 Rh2BG569000 Rh2BG600000 Rh2CG435200 Rh2CG435300 Rh2CG496600 Rh2CG535400 Rh2CG535600 Rh2CG539700 Rh2CG562700 Rh2CG570900 Rh2DG574600 Rh2DG574800 Rh2DG578600 Rh2DG610200 Rh4CG140900 Rh4DG127800 Rh5AG438500 Rh5BG436500 Rh5BG455500 Rh5CG477600 Rh5DG470300 Rh6AG129500 Rh6AG129900 Rh6BG125700 Rh6BG126000 Rh6BG126700 Rh6BG126800 Rh6CG124500 Rh6CG124800 Rh6CG125200 Rh6CG125300 Rh6DG111400 Rh6DG111700 Rh6DG111800 Rh7DG373300
rosa_wichuraiana Rw0G014010 Rw1G006140 Rw1G006160 Rw1G006180 Rw1G006190 Rw1G007340 Rw1G007360 Rw2G045660 Rw2G045670 Rw2G045970 Rw2G048220 Rw4G010820 Rw5G041010 Rw6G011220 Rw6G011230 Rw7G031490

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 81
AgsI TTSAA 2 cut(s) 77, 143
AhlI ACTAGT 1 cut(s) 221
AjnI CCWGG 1 cut(s) 246
AluBI AGCT 2 cut(s) 8, 32
AluI AGCT 2 cut(s) 8, 32
Alw21I GWGCWC 1 cut(s) 229
AoxI GGCC 1 cut(s) 169
Bbv12I GWGCWC 1 cut(s) 229
BccI CCATC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 248
BcuI ACTAGT 1 cut(s) 221
BfaI CTAG 2 cut(s) 9, 222
Bme1390I CCNGG 1 cut(s) 248
BmrFI CCNGG 1 cut(s) 248
BmsI GCATC 1 cut(s) 200
Bse1I ACTGG 1 cut(s) 172
BseBI CCWGG 1 cut(s) 248
BseGI GGATG 1 cut(s) 154
BseMII CTCAG 1 cut(s) 78
BseNI ACTGG 1 cut(s) 172
BseRI GAGGAG 1 cut(s) 213
BshFI GGCC 1 cut(s) 171
BsiHKAI GWGCWC 1 cut(s) 229
BsnI GGCC 1 cut(s) 171
Bsp1286I GDGCHC 1 cut(s) 229
BspACI CCGC 1 cut(s) 81
BspANI GGCC 1 cut(s) 171
BspCNI CTCAG 1 cut(s) 79
BsrI ACTGG 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 248
BstAPI GCANNNNNTGC 1 cut(s) 183
BstDEI CTNAG 1 cut(s) 87
BstF5I GGATG 1 cut(s) 154
BstMWI GCNNNNNNNGC 2 cut(s) 89, 183
BstNI CCWGG 1 cut(s) 248
BstSCI CCNGG 1 cut(s) 246
BsuRI GGCC 1 cut(s) 171
BtsCI GGATG 1 cut(s) 154
CviJI RGCY 4 cut(s) 8, 32, 92, 171
CviKI_1 RGCY 4 cut(s) 8, 32, 92, 171
DdeI CTNAG 1 cut(s) 87
EcoRII CCWGG 1 cut(s) 246
FaiI YATR 3 cut(s) 54, 62, 128
FokI GGATG 1 cut(s) 161
FspBI CTAG 2 cut(s) 9, 222
HaeIII GGCC 1 cut(s) 171
HinfI GANTC 3 cut(s) 26, 77, 251
Hpy188I TCNGA 2 cut(s) 88, 120
Hpy188III TCNNGA 1 cut(s) 195
HpyCH4V TGCA 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 183
HpyF3I CTNAG 1 cut(s) 87
LpnPI CCDG 5 cut(s) 53, 80, 153, 180, 233
LweI GCATC 1 cut(s) 200
MaeI CTAG 2 cut(s) 9, 222
MhlI GDGCHC 1 cut(s) 229
MluCI AATT 3 cut(s) 143, 181, 230
MnlI CCTC 2 cut(s) 82, 191
MspR9I CCNGG 1 cut(s) 248
MvaI CCWGG 1 cut(s) 248
MwoI GCNNNNNNNGC 2 cut(s) 89, 183
PfeI GAWTC 3 cut(s) 26, 77, 251
Psp6I CCWGG 1 cut(s) 246
PspGI CCWGG 1 cut(s) 246
ScrFI CCNGG 1 cut(s) 248
SduI GDGCHC 1 cut(s) 229
SetI ASST 3 cut(s) 10, 34, 60
SfaNI GCATC 1 cut(s) 200
SgeI CNNG 9 cut(s) 21, 51, 55, 80, 107, 180, 199, 207, 234
SpeI ACTAGT 1 cut(s) 221
Sse9I AATT 3 cut(s) 143, 181, 230
SsiI CCGC 1 cut(s) 81
SspMI CTAG 2 cut(s) 9, 222
StyD4I CCNGG 1 cut(s) 246
TasI AATT 3 cut(s) 143, 181, 230
TfiI GAWTC 3 cut(s) 26, 77, 251
TspDTI ATGAA 3 cut(s) 17, 223, 243
XspI CTAG 2 cut(s) 9, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.