pycom17g01570

Protein of unknown function (DUF295)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0000144
Physical Location & Seq
Forward (+)
1040946 .. 1041240
295 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g01570.1

Sequence Viewer

Length: 255 bp
ATGGAGAATATTGTACCTCCCCTCAACTTACTTGATCGGATTCACTTAAGCGTCCTCTGCAAGTACTGGAGTTGGATTGCTATGCGAAGGGACATCCGCAGTACTGCTCCGCTATTTCCCTGGTTAGTTCTCGGTAAAGTTATCAGGATAGGTTTGCCTAAGCGAATTCGAGGGCGGTTTCATAGTTCCTCCAAAGGTTGGTTGATTATGGTAAAGGGAAAATCCATATTTCTACCAAACCCTATTTCAGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box F-box-like

Protein Analysis

85

Amino Acids

9.69

Weight (kDa)

11.57

Isoelectric Point (pI)

44.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000144)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g03062 FvH4_2g03731 FvH4_2g04271 FvH4_2g04880 FvH4_2g04887 FvH4_2g06581 FvH4_2g16550 FvH4_2g16551 FvH4_2g16580 FvH4_4g01551 FvH4_4g01581 FvH4_4g01590 FvH4_4g01970 FvH4_4g02080 FvH4_4g02090 FvH4_4g02150 FvH4_5g18721 FvH4_5g33551 FvH4_5g33621 FvH4_7g08620
malus_domestica MD03G1012300.v1.1 MD05G1134000.v1.1 MD17G1018900.v1.1
prunus_persica Prupe.8G151600_v2.0.a1 Prupe.8G152400_v2.0.a1
pyrus_communis pycom03g01090 pycom17g01570
rosa_chinensis RchiOBHm_Chr4g0388141 RchiOBHm_Chr4g0388171 RchiOBHm_Chr4g0393001 RchiOBHm_Chr4g0393391 RchiOBHm_Chr4g0393471 RchiOBHm_Chr5g0063131 RchiOBHm_Chr6g0247891 RchiOBHm_Chr6g0254551 RchiOBHm_Chr6g0254611 RchiOBHm_Chr6g0254631 RchiOBHm_Chr6g0254681 RchiOBHm_Chr6g0280611
rosa_laevigata RLG00000001327 RLG00000001371 RLG00000003555 RLG00000003556 RLG00000009751 RLG00000009755 RLG00000010077 RLG00000012931 RLG00000013040 RLG00000013044 RLG00000013045 RLG00000014594 RLG00000014599 RLG00000014600 RLG00000014604 RLG00000014897 RLG00000014902 RLG00000014904 RLG00000014975 RLG00000014978 RLG00000014979 RLG00000015006 RLG00000023873 RLG00000035608
rosa_multiflora Rmu_co8471587.1_g000001 Rmu_sc0000976.1_g000004 Rmu_sc0001432.1_g000003 Rmu_sc0001432.1_g000004 Rmu_sc0001590.1_g000006 Rmu_sc0003093.1_g000008 Rmu_sc0005045.1_g000035 Rmu_sc0006323.1_g000014 Rmu_sc0007214.1_g000010 Rmu_sc0007839.1_g000011 Rmu_sc0008530.1_g000006 Rmu_sc0008789.1_g000010 Rmu_sc0009578.1_g000013 Rmu_sc0012965.1_g000003 Rmu_sc0036636.1_g000001
rosa_roxburghii Rroxscaffold_178G00437520 Rroxscaffold_178G00437560 Rroxscaffold_2G00106430 Rroxscaffold_5G00334690 Rroxscaffold_5G00338370 Rroxscaffold_5G00356450 Rroxscaffold_6G00388740 Rroxscaffold_6G00406660 Rroxscaffold_7G00187690 Rroxscaffold_7G00187810 Rroxscaffold_7G00187840 Rroxscaffold_7G00187880 Rroxscaffold_7G00205770 Rroxscaffold_7G00205790 Rroxscaffold_7G00205830 Rroxscaffold_7G00205840 Rroxscaffold_7G00205880 Rroxscaffold_7G00205920 Rroxscaffold_7G00205990 Rroxscaffold_7G00210640 Rroxscaffold_7G00210680 Rroxscaffold_7G00211580 Rroxscaffold_7G00211600
rosa_rugosa Rorug03G0315100 Rorug03G0315200 Rorug03G0315800 Rorug04G0001400 Rorug04G0001700 Rorug04G0003000 Rorug05G0354500 Rorug05G0546700 Rorug05G0546800 Rorug05G0546900 Rorug05G0553400 Rorug05G0553500 Rorug05G0553500 Rorug05G0553600 Rorug05G0553900 Rorug05G0554100 Rorug05G0554300 Rorug05G0582500 Rorug06G0132600 Rorug06G0132700 Rorug06G0132800 Rorug06G0133300 Rorug06G0133300 Rorug06G0185400 Rorug07G0074300 Rorug07G0074400 Rorug07G0275100
rosa_samantha Rh3AG195300 Rh3BG225400 Rh3BG225500 Rh3CG220300 Rh3DG220800 Rh3DG220900 Rh4AG020900 Rh4AG021400 Rh4AG047100 Rh4BG015300 Rh4BG041200 Rh4BG042800 Rh4BG043400 Rh4CG021500 Rh4CG021600 Rh4CG050100 Rh4CG050200 Rh5AG414800 Rh5CG453300 Rh6AG062600 Rh6AG070300 Rh6AG070500 Rh6AG070900 Rh6AG071200 Rh6AG099000 Rh6AG245300 Rh6AG245400 Rh6AG245800 Rh6BG055700 Rh6BG056000 Rh6BG062800 Rh6BG063100 Rh6BG063200 Rh6BG063300 Rh6BG247500 Rh6BG247600 Rh6BG247700 Rh6BG248200 Rh6BG249300 Rh6BG508200 Rh6DG034800 Rh6DG053300 Rh6DG053600 Rh6DG053700 Rh6DG059700 Rh6DG059800 Rh6DG082300 Rh6DG240400 Rh7AG202900 Rh7AG203000 Rh7AG407700 Rh7AG429300 Rh7BG202700 Rh7BG403000 Rh7CG213700 Rh7CG448100
rosa_wichuraiana Rw3G017790 Rw4G001400 Rw4G003730 Rw5G039000 Rw6G005550 Rw6G005570 Rw6G006160 Rw6G006180 Rw6G006200 Rw6G006220 Rw6G006250 Rw6G021280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 198
AciI CCGC 3 cut(s) 97, 110, 175
AcsI RAATTY 1 cut(s) 165
AfaI GTAC 3 cut(s) 15, 65, 103
AfiI CCNNNNNNNGG 2 cut(s) 198, 248
AflII CTTAAG 1 cut(s) 46
AjnI CCWGG 1 cut(s) 119
AjuI GAANNNNNNNTTGG 1 cut(s) 229
ApoI RAATTY 1 cut(s) 165
BciT130I CCWGG 1 cut(s) 121
BfrI CTTAAG 1 cut(s) 46
BmcAI AGTACT 2 cut(s) 65, 103
Bme1390I CCNGG 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 121
BpmI CTGGAG 1 cut(s) 88
Bpu10I CCTNAGC 1 cut(s) 159
BsaJI CCNNGG 1 cut(s) 119
Bsc4I CCNNNNNNNGG 2 cut(s) 198, 248
Bse1I ACTGG 1 cut(s) 71
BseBI CCWGG 1 cut(s) 121
BseDI CCNNGG 1 cut(s) 119
BseGI GGATG 1 cut(s) 93
BseLI CCNNNNNNNGG 2 cut(s) 198, 248
BseNI ACTGG 1 cut(s) 71
BslFI GGGAC 1 cut(s) 104
BslI CCNNNNNNNGG 2 cut(s) 198, 248
BsmFI GGGAC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 3 cut(s) 97, 110, 175
BspTI CTTAAG 1 cut(s) 46
BsrI ACTGG 1 cut(s) 71
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 1 cut(s) 34
Bst2UI CCWGG 1 cut(s) 121
BstAFI CTTAAG 1 cut(s) 46
BstDEI CTNAG 1 cut(s) 159
BstENI CCTNNNNNAGG 1 cut(s) 246
BstF5I GGATG 1 cut(s) 93
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 57
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
BtsCI GGATG 1 cut(s) 93
CseI GACGC 1 cut(s) 40
Csp6I GTAC 3 cut(s) 14, 64, 102
CviQI GTAC 3 cut(s) 14, 64, 102
DdeI CTNAG 1 cut(s) 159
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
EcoNI CCTNNNNNAGG 1 cut(s) 246
EcoRI GAATTC 1 cut(s) 165
EcoRII CCWGG 1 cut(s) 119
FaiI YATR 4 cut(s) 83, 183, 209, 227
FaqI GGGAC 1 cut(s) 104
FokI GGATG 1 cut(s) 80
GsuI CTGGAG 1 cut(s) 88
HgaI GACGC 1 cut(s) 40
HinfI GANTC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 39
Hpy188III TCNNGA 2 cut(s) 145, 249
HpyAV CCTTC 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 60
HpyF10VI GCNNNNNNNGC 1 cut(s) 57
HpyF3I CTNAG 1 cut(s) 159
Kzo9I GATC 1 cut(s) 34
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 5 cut(s) 52, 106, 130, 133, 234
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MluCI AATT 1 cut(s) 165
MmeI TCCRAC 1 cut(s) 53
MnlI CCTC 5 cut(s) 27, 32, 65, 164, 199
MseI TTAA 1 cut(s) 47
MspCI CTTAAG 1 cut(s) 46
MspR9I CCNGG 1 cut(s) 121
MvaI CCWGG 1 cut(s) 121
MwoI GCNNNNNNNGC 1 cut(s) 57
NdeII GATC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 40
PflMI CCANNNNNTGG 1 cut(s) 198
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
RsaI GTAC 3 cut(s) 15, 65, 103
RsaNI GTAC 3 cut(s) 14, 64, 102
SaqAI TTAA 1 cut(s) 47
Sau3AI GATC 1 cut(s) 34
ScaI AGTACT 2 cut(s) 65, 103
ScrFI CCNGG 1 cut(s) 121
SetI ASST 3 cut(s) 19, 154, 199
SgeI CNNG 8 cut(s) 44, 73, 79, 132, 133, 143, 157, 182
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
Sse9I AATT 1 cut(s) 165
SsiI CCGC 3 cut(s) 97, 110, 175
SspI AATATT 1 cut(s) 10
StyD4I CCNGG 1 cut(s) 119
TaqI TCGA 1 cut(s) 169
TasI AATT 1 cut(s) 165
TatI WGTACW 2 cut(s) 63, 101
TfiI GAWTC 1 cut(s) 40
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 170
Van91I CCANNNNNTGG 1 cut(s) 198
Vha464I CTTAAG 1 cut(s) 46
XagI CCTNNNNNAGG 1 cut(s) 246
XapI RAATTY 1 cut(s) 165
ZrmI AGTACT 2 cut(s) 65, 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.