Rh6BG247700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
45914887 .. 45915081
195 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG247700.1

Sequence Viewer

Length: 195 bp
ATGGATGTTGATGAAGATGATGAGGAATTTATGGAAGGCCATGAGGATAACGAGGAAGGCAATAACAACGAAGAAGAAGAAGGGGATGATAATAACATGGAAGATAATGAGGAGCATGAGAGCATTCTTGAGTGGGCTGGACAAATCTTACTCAGTGTTTATGCTAAAGCAAAGCAACTAAACCCAGATTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.45

Weight (kDa)

4.05

Isoelectric Point (pI)

52.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000144)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g03062 FvH4_2g03731 FvH4_2g04271 FvH4_2g04880 FvH4_2g04887 FvH4_2g06581 FvH4_2g16550 FvH4_2g16551 FvH4_2g16580 FvH4_4g01551 FvH4_4g01581 FvH4_4g01590 FvH4_4g01970 FvH4_4g02080 FvH4_4g02090 FvH4_4g02150 FvH4_5g18721 FvH4_5g33551 FvH4_5g33621 FvH4_7g08620
malus_domestica MD03G1012300.v1.1 MD05G1134000.v1.1 MD17G1018900.v1.1
prunus_persica Prupe.8G151600_v2.0.a1 Prupe.8G152400_v2.0.a1
pyrus_communis pycom03g01090 pycom17g01570
rosa_chinensis RchiOBHm_Chr4g0388141 RchiOBHm_Chr4g0388171 RchiOBHm_Chr4g0393001 RchiOBHm_Chr4g0393391 RchiOBHm_Chr4g0393471 RchiOBHm_Chr5g0063131 RchiOBHm_Chr6g0247891 RchiOBHm_Chr6g0254551 RchiOBHm_Chr6g0254611 RchiOBHm_Chr6g0254631 RchiOBHm_Chr6g0254681 RchiOBHm_Chr6g0280611
rosa_laevigata RLG00000001327 RLG00000001371 RLG00000003555 RLG00000003556 RLG00000009751 RLG00000009755 RLG00000010077 RLG00000012931 RLG00000013040 RLG00000013044 RLG00000013045 RLG00000014594 RLG00000014599 RLG00000014600 RLG00000014604 RLG00000014897 RLG00000014902 RLG00000014904 RLG00000014975 RLG00000014978 RLG00000014979 RLG00000015006 RLG00000023873 RLG00000035608
rosa_multiflora Rmu_co8471587.1_g000001 Rmu_sc0000976.1_g000004 Rmu_sc0001432.1_g000003 Rmu_sc0001432.1_g000004 Rmu_sc0001590.1_g000006 Rmu_sc0003093.1_g000008 Rmu_sc0005045.1_g000035 Rmu_sc0006323.1_g000014 Rmu_sc0007214.1_g000010 Rmu_sc0007839.1_g000011 Rmu_sc0008530.1_g000006 Rmu_sc0008789.1_g000010 Rmu_sc0009578.1_g000013 Rmu_sc0012965.1_g000003 Rmu_sc0036636.1_g000001
rosa_roxburghii Rroxscaffold_178G00437520 Rroxscaffold_178G00437560 Rroxscaffold_2G00106430 Rroxscaffold_5G00334690 Rroxscaffold_5G00338370 Rroxscaffold_5G00356450 Rroxscaffold_6G00388740 Rroxscaffold_6G00406660 Rroxscaffold_7G00187690 Rroxscaffold_7G00187810 Rroxscaffold_7G00187840 Rroxscaffold_7G00187880 Rroxscaffold_7G00205770 Rroxscaffold_7G00205790 Rroxscaffold_7G00205830 Rroxscaffold_7G00205840 Rroxscaffold_7G00205880 Rroxscaffold_7G00205920 Rroxscaffold_7G00205990 Rroxscaffold_7G00210640 Rroxscaffold_7G00210680 Rroxscaffold_7G00211580 Rroxscaffold_7G00211600
rosa_rugosa Rorug03G0315100 Rorug03G0315200 Rorug03G0315800 Rorug04G0001400 Rorug04G0001700 Rorug04G0003000 Rorug05G0354500 Rorug05G0546700 Rorug05G0546800 Rorug05G0546900 Rorug05G0553400 Rorug05G0553500 Rorug05G0553500 Rorug05G0553600 Rorug05G0553900 Rorug05G0554100 Rorug05G0554300 Rorug05G0582500 Rorug06G0132600 Rorug06G0132700 Rorug06G0132800 Rorug06G0133300 Rorug06G0133300 Rorug06G0185400 Rorug07G0074300 Rorug07G0074400 Rorug07G0275100
rosa_samantha Rh3AG195300 Rh3BG225400 Rh3BG225500 Rh3CG220300 Rh3DG220800 Rh3DG220900 Rh4AG020900 Rh4AG021400 Rh4AG047100 Rh4BG015300 Rh4BG041200 Rh4BG042800 Rh4BG043400 Rh4CG021500 Rh4CG021600 Rh4CG050100 Rh4CG050200 Rh5AG414800 Rh5CG453300 Rh6AG062600 Rh6AG070300 Rh6AG070500 Rh6AG070900 Rh6AG071200 Rh6AG099000 Rh6AG245300 Rh6AG245400 Rh6AG245800 Rh6BG055700 Rh6BG056000 Rh6BG062800 Rh6BG063100 Rh6BG063200 Rh6BG063300 Rh6BG247500 Rh6BG247600 Rh6BG247700 Rh6BG248200 Rh6BG249300 Rh6BG508200 Rh6DG034800 Rh6DG053300 Rh6DG053600 Rh6DG053700 Rh6DG059700 Rh6DG059800 Rh6DG082300 Rh6DG240400 Rh7AG202900 Rh7AG203000 Rh7AG407700 Rh7AG429300 Rh7BG202700 Rh7BG403000 Rh7CG213700 Rh7CG448100
rosa_wichuraiana Rw3G017790 Rw4G001400 Rw4G003730 Rw5G039000 Rw6G005550 Rw6G005570 Rw6G006160 Rw6G006180 Rw6G006200 Rw6G006220 Rw6G006250 Rw6G021280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 26
AoxI GGCC 1 cut(s) 37
ApoI RAATTY 1 cut(s) 26
BpuEI CTTGAG 1 cut(s) 149
BseGI GGATG 2 cut(s) 10, 91
BseMII CTCAG 1 cut(s) 166
BseRI GAGGAG 1 cut(s) 125
BshFI GGCC 1 cut(s) 39
BsmI GAATGC 1 cut(s) 123
BsnI GGCC 1 cut(s) 39
BspANI GGCC 1 cut(s) 39
BspCNI CTCAG 1 cut(s) 165
BstDEI CTNAG 1 cut(s) 152
BstF5I GGATG 2 cut(s) 10, 91
BsuRI GGCC 1 cut(s) 39
BtsCI GGATG 2 cut(s) 10, 91
BtsIMutI CAGTG 1 cut(s) 160
CviAII CATG 3 cut(s) 41, 97, 116
CviJI RGCY 2 cut(s) 39, 137
CviKI_1 RGCY 2 cut(s) 39, 137
DdeI CTNAG 1 cut(s) 152
FaeI CATG 3 cut(s) 44, 100, 119
FaiI YATR 5 cut(s) 32, 42, 98, 117, 162
FatI CATG 3 cut(s) 40, 96, 115
FokI GGATG 2 cut(s) 17, 98
HaeIII GGCC 1 cut(s) 39
Hin1II CATG 3 cut(s) 44, 100, 119
Hpy188III TCNNGA 1 cut(s) 128
HpyAV CCTTC 3 cut(s) 29, 50, 74
HpyF3I CTNAG 1 cut(s) 152
Hsp92II CATG 3 cut(s) 44, 100, 119
LmnI GCTCC 1 cut(s) 112
LpnPI CCDG 1 cut(s) 123
MboII GAAGA 5 cut(s) 26, 83, 86, 89, 113
MluCI AATT 1 cut(s) 26
MnlI CCTC 4 cut(s) 16, 37, 46, 103
MseI TTAA 1 cut(s) 193
Mva1269I GAATGC 1 cut(s) 123
NlaIII CATG 3 cut(s) 44, 100, 119
PctI GAATGC 1 cut(s) 123
SaqAI TTAA 1 cut(s) 193
SgeI CNNG 6 cut(s) 53, 64, 109, 128, 140, 150
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 1 cut(s) 26
TasI AATT 1 cut(s) 26
Tru1I TTAA 1 cut(s) 193
Tru9I TTAA 1 cut(s) 193
TscAI CASTG 1 cut(s) 160
TspDTI ATGAA 1 cut(s) 27
TspRI CASTG 1 cut(s) 160
XapI RAATTY 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.