FvH4_5g26960

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0000181
Physical Location & Seq
Reverse (-)
18282914 .. 18283360
447 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g26960.t1

Sequence Viewer

Length: 447 bp
ATGTCTCTCGAAATACCATTCATCTTGGATGAAGATCTGAAACCCCGATCGGGAGGGAAGGATGTAGAAGAGCCAGAGACAGATGGATCAGAAGAAGAAAAGAAAATGAAAGATTGCAGAGTTTGTATGAAGGAGAACGGGGATCACATGTCATATGAATGCCCTTACTTGGAGTGTATTCCAGATCCCAAGGACACACCTGTTGGGGAGGCCTATATGATAGTTTGCGCCCACTGCGGTTTGTCGAAACATGGGCACCAGGATGGAACCTGGGAAGGACGCGCGATATTTGATTTTCGTAAGTCTAGTTTATTCGTTCGACAGCCTGATGATACTAACGACCAAGTTGTGGGGGAACATCATGCTACTTCTGAAGGACGTTGTGCAACAATGGATCCTTGTAGGATTCCATTTGGTATTCCGAAAGTCTGGTGTGGTACATCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

149

Amino Acids

16.61

Weight (kDa)

4.83

Isoelectric Point (pI)

41.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000181)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g02310 FvH4_1g02340 FvH4_1g02340 FvH4_1g02340 FvH4_3g13110 FvH4_4g04530 FvH4_5g26960 FvH4_5g26990 FvH4_6g01091 FvH4_6g08071 FvH4_6g19630 FvH4_6g38111 FvH4_6g38112 FvH4_6g48801 FvH4_6g48810 FvH4_6g48861 FvH4_6g49020 FvH4_6g49040 FvH4_6g49040 FvH4_6g49060 FvH4_6g49070 FvH4_6g49070 FvH4_6g49870 FvH4_6g49880
malus_domestica MD05G1007300.v1.1 MD05G1007600.v1.1 MD08G1121900.v1.1 MD08G1122000.v1.1 MD08G1122200.v1.1 MD08G1122700.v1.1
prunus_persica Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G187100_v2.0.a1 Prupe.2G227700_v2.0.a1 Prupe.2G227800_v2.0.a1 Prupe.2G227900_v2.0.a1 Prupe.4G043000_v2.0.a1 Prupe.4G046400_v2.0.a1 Prupe.4G077400_v2.0.a1 Prupe.4G077500_v2.0.a1 Prupe.4G159200_v2.0.a1 Prupe.4G159300_v2.0.a1 Prupe.4G159500_v2.0.a1 Prupe.6G311400_v2.0.a1 Prupe.6G311400_v2.0.a1
pyrus_communis pycom05g00390 pycom07g27750 pycom08g10150 pycom08g10170
rosa_chinensis RchiOBHm_Chr1g0328161 RchiOBHm_Chr1g0372961 RchiOBHm_Chr2g0131001 RchiOBHm_Chr2g0151211 RchiOBHm_Chr2g0151231 RchiOBHm_Chr2g0151281 RchiOBHm_Chr2g0151321 RchiOBHm_Chr2g0170041 RchiOBHm_Chr3g0457761 RchiOBHm_Chr3g0457871 RchiOBHm_Chr5g0014841 RchiOBHm_Chr5g0021371 RchiOBHm_Chr5g0038581 RchiOBHm_Chr5g0038691 RchiOBHm_Chr5g0038761 RchiOBHm_Chr6g0246131 RchiOBHm_Chr6g0246181
rosa_laevigata RLG00000015270 RLG00000020541 RLG00000021919 RLG00000025188 RLG00000032146 RLG00000032147 RLG00000032607 RLG00000033860
rosa_multiflora Rmu_sc0001102.1_g000003 Rmu_sc0002298.1_g000007 Rmu_sc0002516.1_g000005 Rmu_sc0002516.1_g000013 Rmu_sc0003629.1_g000050 Rmu_sc0023055.1_g000001
rosa_roxburghii Rroxscaffold_1G00042380 Rroxscaffold_1G00042450 Rroxscaffold_1G00042460 Rroxscaffold_1G00042550 Rroxscaffold_1G00061700 Rroxscaffold_1G00061730 Rroxscaffold_1G00063310 Rroxscaffold_1G00065700 Rroxscaffold_2G00096530 Rroxscaffold_2G00096560 Rroxscaffold_2G00096590 Rroxscaffold_2G00096660 Rroxscaffold_2G00101110 Rroxscaffold_2G00113390 Rroxscaffold_5G00339030 Rroxscaffold_5G00351680 Rroxscaffold_6G00421510 Rroxscaffold_7G00168250 Rroxscaffold_7G00214760 Rroxscaffold_7G00214840
rosa_rugosa Rorug02G0294400 Rorug02G0545100 Rorug05G0008000 Rorug05G0066600 Rorug05G0173700 Rorug05G0173800 Rorug05G0290700 Rorug05G0290800 Rorug05G0290800 Rorug05G0519600 Rorug05G0519700
rosa_samantha Rh1CG087500 Rh1DG094400 Rh2AG570900 Rh2AG612800 Rh2BG354000 Rh2BG498100 Rh2BG498500 Rh2BG498600 Rh2BG628900 Rh2DG372100 Rh2DG509000 Rh2DG509300 Rh2DG509400 Rh2DG509600 Rh2DG640700 Rh3AG083900 Rh3BG086400 Rh3CG086700 Rh5AG102700 Rh5AG259700 Rh5AG261200 Rh5BG098700 Rh5BG098800 Rh5BG099500 Rh5BG113500 Rh5BG113900 Rh5BG155300 Rh5BG264600 Rh5CG111100 Rh5CG125200 Rh5CG169000 Rh5CG297600 Rh5DG098300 Rh5DG272900 Rh6AG033700 Rh6BG028900 Rh6CG029100 Rh6CG029200 Rh6DG028200 Rh6DG028300 Rh7CG429700
rosa_wichuraiana Rw0G009330 Rw0G012230 Rw0G018980 Rw1G008830 Rw2G035660 Rw2G039830 Rw2G040230 Rw2G040240 Rw5G013700 Rw5G024330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 255
AccB7I CCANNNNNTGG 1 cut(s) 349
AccII CGCG 2 cut(s) 282, 284
AciI CCGC 1 cut(s) 237
AclWI GGATC 5 cut(s) 94, 150, 179, 389, 402
AcuI CTGAAG 1 cut(s) 393
AfaI GTAC 1 cut(s) 439
AfiI CCNNNNNNNGG 3 cut(s) 50, 169, 349
AflIII ACRYGT 1 cut(s) 147
AjnI CCWGG 2 cut(s) 258, 269
Alw26I GTCTC 2 cut(s) 9, 71
AlwI GGATC 5 cut(s) 94, 150, 179, 389, 402
AoxI GGCC 1 cut(s) 210
AspLEI GCGC 2 cut(s) 230, 284
BaeGI GKGCMC 1 cut(s) 258
BamHI GGATCC 1 cut(s) 394
BanI GGYRCC 1 cut(s) 255
BccI CCATC 2 cut(s) 77, 257
BciT130I CCWGG 2 cut(s) 260, 271
BcoDI GTCTC 2 cut(s) 9, 71
BfaI CTAG 1 cut(s) 306
BglII AGATCT 1 cut(s) 34
Bme1390I CCNGG 2 cut(s) 260, 271
BmiI GGNNCC 3 cut(s) 257, 268, 396
BmrFI CCNGG 2 cut(s) 260, 271
BsaBI GATNNNNATC 1 cut(s) 33
BsaJI CCNNGG 2 cut(s) 189, 270
Bsc4I CCNNNNNNNGG 3 cut(s) 50, 169, 349
Bse8I GATNNNNATC 1 cut(s) 33
BseBI CCWGG 2 cut(s) 260, 271
BseDI CCNNGG 2 cut(s) 189, 270
BseGI GGATG 3 cut(s) 34, 67, 268
BseJI GATNNNNATC 1 cut(s) 33
BseLI CCNNNNNNNGG 3 cut(s) 50, 169, 349
BseSI GKGCMC 1 cut(s) 258
Bsh1236I CGCG 2 cut(s) 282, 284
Bsh1285I CGRYCG 1 cut(s) 50
BshFI GGCC 1 cut(s) 212
BshNI GGYRCC 1 cut(s) 255
BsiEI CGRYCG 1 cut(s) 50
BslI CCNNNNNNNGG 3 cut(s) 50, 169, 349
BsmAI GTCTC 2 cut(s) 9, 71
BsmI GAATGC 1 cut(s) 164
BsnI GGCC 1 cut(s) 212
Bsp1286I GDGCHC 1 cut(s) 258
Bsp143I GATC 6 cut(s) 34, 47, 86, 142, 184, 394
BspACI CCGC 1 cut(s) 237
BspANI GGCC 1 cut(s) 212
BspFNI CGCG 2 cut(s) 282, 284
BspLI GGNNCC 3 cut(s) 257, 268, 396
BspPI GGATC 5 cut(s) 94, 150, 179, 389, 402
BspQI GCTCTTC 1 cut(s) 63
BspT107I GGYRCC 1 cut(s) 255
BssECI CCNNGG 2 cut(s) 189, 270
BssMI GATC 6 cut(s) 34, 47, 86, 142, 184, 394
BssT1I CCWWGG 1 cut(s) 189
Bst2UI CCWGG 2 cut(s) 260, 271
Bst6I CTCTTC 1 cut(s) 63
BstF5I GGATG 3 cut(s) 34, 67, 268
BstFNI CGCG 2 cut(s) 282, 284
BstHHI GCGC 2 cut(s) 230, 284
BstKTI GATC 6 cut(s) 37, 50, 89, 145, 187, 397
BstMAI GTCTC 2 cut(s) 9, 71
BstMBI GATC 6 cut(s) 34, 47, 86, 142, 184, 394
BstMCI CGRYCG 1 cut(s) 50
BstMWI GCNNNNNNNGC 1 cut(s) 234
BstNI CCWGG 2 cut(s) 260, 271
BstNSI RCATGY 1 cut(s) 151
BstSCI CCNGG 2 cut(s) 258, 269
BstSLI GKGCMC 1 cut(s) 258
BstUI CGCG 2 cut(s) 282, 284
BstX2I RGATCY 3 cut(s) 34, 184, 394
BstYI RGATCY 3 cut(s) 34, 184, 394
BsuRI GGCC 1 cut(s) 212
BtsCI GGATG 3 cut(s) 34, 67, 268
BtsI GCAGTG 1 cut(s) 232
BtsIMutI CAGTG 1 cut(s) 232
CfoI GCGC 2 cut(s) 230, 284
CseI GACGC 1 cut(s) 288
Csp6I GTAC 1 cut(s) 438
CviAII CATG 3 cut(s) 148, 251, 362
CviJI RGCY 3 cut(s) 73, 212, 325
CviKI_1 RGCY 3 cut(s) 73, 212, 325
CviQI GTAC 1 cut(s) 438
DpnI GATC 6 cut(s) 36, 49, 88, 144, 186, 396
DpnII GATC 6 cut(s) 34, 47, 86, 142, 184, 394
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco130I CCWWGG 1 cut(s) 189
Eco147I AGGCCT 1 cut(s) 212
Eco57I CTGAAG 1 cut(s) 393
EcoRII CCWGG 2 cut(s) 258, 269
EcoT14I CCWWGG 1 cut(s) 189
ErhI CCWWGG 1 cut(s) 189
FaeI CATG 3 cut(s) 151, 254, 365
FaiI YATR 9 cut(s) 128, 149, 154, 156, 216, 218, 252, 363, 445
FatI CATG 3 cut(s) 147, 250, 361
FauNDI CATATG 1 cut(s) 154
FokI GGATG 3 cut(s) 41, 74, 275
FspBI CTAG 1 cut(s) 306
GlaI GCGC 2 cut(s) 229, 283
HaeIII GGCC 1 cut(s) 212
HgaI GACGC 1 cut(s) 288
HhaI GCGC 2 cut(s) 230, 284
Hin1II CATG 3 cut(s) 151, 254, 365
Hin6I GCGC 2 cut(s) 228, 282
HinP1I GCGC 2 cut(s) 228, 282
HinfI GANTC 1 cut(s) 406
Hpy188I TCNGA 4 cut(s) 39, 91, 373, 423
Hpy188III TCNNGA 3 cut(s) 8, 51, 182
HpyAV CCTTC 4 cut(s) 52, 124, 269, 368
HpyCH4IV ACGT 1 cut(s) 379
HpyCH4V TGCA 2 cut(s) 117, 386
HpyF10VI GCNNNNNNNGC 1 cut(s) 234
HpySE526I ACGT 1 cut(s) 379
Hsp92II CATG 3 cut(s) 151, 254, 365
HspAI GCGC 2 cut(s) 228, 282
Kzo9I GATC 6 cut(s) 34, 47, 86, 142, 184, 394
LguI GCTCTTC 1 cut(s) 63
LpnPI CCDG 9 cut(s) 87, 195, 213, 245, 256, 272, 283, 339, 415
MaeI CTAG 1 cut(s) 306
MaeII ACGT 1 cut(s) 379
MalI GATC 6 cut(s) 36, 49, 88, 144, 186, 396
MboI GATC 6 cut(s) 34, 47, 86, 142, 184, 394
MboII GAAGA 4 cut(s) 44, 80, 104, 107
MflI RGATCY 3 cut(s) 34, 184, 394
MhlI GDGCHC 1 cut(s) 258
MnlI CCTC 2 cut(s) 47, 202
MslI CAYNNNNRTG 2 cut(s) 157, 261
MspR9I CCNGG 2 cut(s) 260, 271
Mva1269I GAATGC 1 cut(s) 164
MvaI CCWGG 2 cut(s) 260, 271
MvnI CGCG 2 cut(s) 282, 284
MwoI GCNNNNNNNGC 1 cut(s) 234
NdeI CATATG 1 cut(s) 154
NdeII GATC 6 cut(s) 34, 47, 86, 142, 184, 394
NlaIII CATG 3 cut(s) 151, 254, 365
NlaIV GGNNCC 3 cut(s) 257, 268, 396
NspI RCATGY 1 cut(s) 151
PceI AGGCCT 1 cut(s) 212
PciI ACATGT 1 cut(s) 147
PciSI GCTCTTC 1 cut(s) 63
PctI GAATGC 1 cut(s) 164
PfeI GAWTC 1 cut(s) 406
PflMI CCANNNNNTGG 1 cut(s) 349
Ple19I CGATCG 1 cut(s) 50
PscI ACATGT 1 cut(s) 147
Psp6I CCWGG 2 cut(s) 258, 269
PspGI CCWGG 2 cut(s) 258, 269
PspN4I GGNNCC 3 cut(s) 257, 268, 396
PsuI RGATCY 3 cut(s) 34, 184, 394
PvuI CGATCG 1 cut(s) 50
RsaI GTAC 1 cut(s) 439
RsaNI GTAC 1 cut(s) 438
RseI CAYNNNNRTG 2 cut(s) 157, 261
SapI GCTCTTC 1 cut(s) 63
Sau3AI GATC 6 cut(s) 34, 47, 86, 142, 184, 394
ScrFI CCNGG 2 cut(s) 260, 271
SduI GDGCHC 1 cut(s) 258
SetI ASST 3 cut(s) 202, 272, 382
SmiMI CAYNNNNRTG 2 cut(s) 157, 261
SseBI AGGCCT 1 cut(s) 212
SsiI CCGC 1 cut(s) 237
SspMI CTAG 1 cut(s) 306
StuI AGGCCT 1 cut(s) 212
StyD4I CCNGG 2 cut(s) 258, 269
StyI CCWWGG 1 cut(s) 189
TaiI ACGT 1 cut(s) 382
TaqI TCGA 3 cut(s) 9, 245, 319
TfiI GAWTC 1 cut(s) 406
TscAI CASTG 1 cut(s) 239
TspDTI ATGAA 5 cut(s) 10, 45, 122, 143, 171
TspRI CASTG 1 cut(s) 239
Van91I CCANNNNNTGG 1 cut(s) 349
XceI RCATGY 1 cut(s) 151
XspI CTAG 1 cut(s) 306
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.