Rmu_sc0023055.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023055.1
OG0000181
Physical Location & Seq
Reverse (-)
1 .. 1676
1676 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023055.1_g000001.1.cds

Sequence Viewer

Length: 225 bp
atgtctcttggaaaagcagcgaagatcgacaatgatgtgtctttgtcgggcgaggaaaaaaacagtttggtggaaaagttaggaaacgctttttgggcattggtagaagatgattcattggaagatgaaatagaggatttgttggtatttgaagaaaaggctttgttggacgagctagccaaggcaaatttggaagaggaagaaaaggaggaagaaaggcttctg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.45

Weight (kDa)

4.05

Isoelectric Point (pI)

57.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000181)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g02310 FvH4_1g02340 FvH4_1g02340 FvH4_1g02340 FvH4_3g13110 FvH4_4g04530 FvH4_5g26960 FvH4_5g26990 FvH4_6g01091 FvH4_6g08071 FvH4_6g19630 FvH4_6g38111 FvH4_6g38112 FvH4_6g48801 FvH4_6g48810 FvH4_6g48861 FvH4_6g49020 FvH4_6g49040 FvH4_6g49040 FvH4_6g49060 FvH4_6g49070 FvH4_6g49070 FvH4_6g49870 FvH4_6g49880
malus_domestica MD05G1007300.v1.1 MD05G1007600.v1.1 MD08G1121900.v1.1 MD08G1122000.v1.1 MD08G1122200.v1.1 MD08G1122700.v1.1
prunus_persica Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G019700_v2.0.a1 Prupe.1G187100_v2.0.a1 Prupe.2G227700_v2.0.a1 Prupe.2G227800_v2.0.a1 Prupe.2G227900_v2.0.a1 Prupe.4G043000_v2.0.a1 Prupe.4G046400_v2.0.a1 Prupe.4G077400_v2.0.a1 Prupe.4G077500_v2.0.a1 Prupe.4G159200_v2.0.a1 Prupe.4G159300_v2.0.a1 Prupe.4G159500_v2.0.a1 Prupe.6G311400_v2.0.a1 Prupe.6G311400_v2.0.a1
pyrus_communis pycom05g00390 pycom07g27750 pycom08g10150 pycom08g10170
rosa_chinensis RchiOBHm_Chr1g0328161 RchiOBHm_Chr1g0372961 RchiOBHm_Chr2g0131001 RchiOBHm_Chr2g0151211 RchiOBHm_Chr2g0151231 RchiOBHm_Chr2g0151281 RchiOBHm_Chr2g0151321 RchiOBHm_Chr2g0170041 RchiOBHm_Chr3g0457761 RchiOBHm_Chr3g0457871 RchiOBHm_Chr5g0014841 RchiOBHm_Chr5g0021371 RchiOBHm_Chr5g0038581 RchiOBHm_Chr5g0038691 RchiOBHm_Chr5g0038761 RchiOBHm_Chr6g0246131 RchiOBHm_Chr6g0246181
rosa_laevigata RLG00000015270 RLG00000020541 RLG00000021919 RLG00000025188 RLG00000032146 RLG00000032147 RLG00000032607 RLG00000033860
rosa_multiflora Rmu_sc0001102.1_g000003 Rmu_sc0002298.1_g000007 Rmu_sc0002516.1_g000005 Rmu_sc0002516.1_g000013 Rmu_sc0003629.1_g000050 Rmu_sc0023055.1_g000001
rosa_roxburghii Rroxscaffold_1G00042380 Rroxscaffold_1G00042450 Rroxscaffold_1G00042460 Rroxscaffold_1G00042550 Rroxscaffold_1G00061700 Rroxscaffold_1G00061730 Rroxscaffold_1G00063310 Rroxscaffold_1G00065700 Rroxscaffold_2G00096530 Rroxscaffold_2G00096560 Rroxscaffold_2G00096590 Rroxscaffold_2G00096660 Rroxscaffold_2G00101110 Rroxscaffold_2G00113390 Rroxscaffold_5G00339030 Rroxscaffold_5G00351680 Rroxscaffold_6G00421510 Rroxscaffold_7G00168250 Rroxscaffold_7G00214760 Rroxscaffold_7G00214840
rosa_rugosa Rorug02G0294400 Rorug02G0545100 Rorug05G0008000 Rorug05G0066600 Rorug05G0173700 Rorug05G0173800 Rorug05G0290700 Rorug05G0290800 Rorug05G0290800 Rorug05G0519600 Rorug05G0519700
rosa_samantha Rh1CG087500 Rh1DG094400 Rh2AG570900 Rh2AG612800 Rh2BG354000 Rh2BG498100 Rh2BG498500 Rh2BG498600 Rh2BG628900 Rh2DG372100 Rh2DG509000 Rh2DG509300 Rh2DG509400 Rh2DG509600 Rh2DG640700 Rh3AG083900 Rh3BG086400 Rh3CG086700 Rh5AG102700 Rh5AG259700 Rh5AG261200 Rh5BG098700 Rh5BG098800 Rh5BG099500 Rh5BG113500 Rh5BG113900 Rh5BG155300 Rh5BG264600 Rh5CG111100 Rh5CG125200 Rh5CG169000 Rh5CG297600 Rh5DG098300 Rh5DG272900 Rh6AG033700 Rh6BG028900 Rh6CG029100 Rh6CG029200 Rh6DG028200 Rh6DG028300 Rh7CG429700
rosa_wichuraiana Rw0G009330 Rw0G012230 Rw0G018980 Rw1G008830 Rw2G035660 Rw2G039830 Rw2G040230 Rw2G040240 Rw5G013700 Rw5G024330

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 187
AgsI TTSAA 1 cut(s) 152
AjuI GAANNNNNNNTTGG 2 cut(s) 76, 108
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
Alw26I GTCTC 1 cut(s) 9
ApeKI GCWGC 1 cut(s) 17
ApoI RAATTY 1 cut(s) 187
Asp700I GAANNNNTTC 1 cut(s) 219
AsuNHI GCTAGC 1 cut(s) 175
BbvI GCAGC 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 9
BfaI CTAG 1 cut(s) 176
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
BmtI GCTAGC 1 cut(s) 179
BsaJI CCNNGG 1 cut(s) 180
BseDI CCNNGG 1 cut(s) 180
BseXI GCAGC 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 9
Bsp143I GATC 1 cut(s) 24
BspOI GCTAGC 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 1 cut(s) 24
BssT1I CCWWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 65
Bst6I CTCTTC 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 177
BstKTI GATC 1 cut(s) 27
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 1 cut(s) 24
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstV1I GCAGC 1 cut(s) 29
Cac8I GCNNGC 1 cut(s) 177
CviJI RGCY 4 cut(s) 161, 175, 179, 220
CviKI_1 RGCY 4 cut(s) 161, 175, 179, 220
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eam1104I CTCTTC 1 cut(s) 189
EarI CTCTTC 1 cut(s) 189
Eco130I CCWWGG 1 cut(s) 180
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FalI AAGNNNNNCTT 1 cut(s) 204
Fnu4HI GCNGC 1 cut(s) 18
Fsp4HI GCNGC 1 cut(s) 18
FspBI CTAG 1 cut(s) 176
GluI GCNGC 1 cut(s) 18
HinfI GANTC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
Kzo9I GATC 1 cut(s) 24
Lsp1109I GCAGC 1 cut(s) 29
MaeI CTAG 1 cut(s) 176
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 7 cut(s) 34, 119, 134, 164, 206, 212, 224
MluCI AATT 1 cut(s) 187
MmeI TCCRAC 1 cut(s) 147
MnlI CCTC 4 cut(s) 46, 127, 190, 202
MroXI GAANNNNTTC 1 cut(s) 219
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeII GATC 1 cut(s) 24
NheI GCTAGC 1 cut(s) 175
PdmI GAANNNNTTC 1 cut(s) 219
PfeI GAWTC 1 cut(s) 113
PkrI GCNGC 1 cut(s) 19
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 1 cut(s) 24
SetI ASST 1 cut(s) 177
SgeI CNNG 6 cut(s) 20, 60, 64, 184, 188, 193
Sse9I AATT 1 cut(s) 187
SspMI CTAG 1 cut(s) 176
StyI CCWWGG 1 cut(s) 180
TaaI ACNGT 1 cut(s) 65
TaqI TCGA 1 cut(s) 27
TasI AATT 1 cut(s) 187
TfiI GAWTC 1 cut(s) 113
TseI GCWGC 1 cut(s) 17
TspDTI ATGAA 2 cut(s) 105, 141
XapI RAATTY 1 cut(s) 187
XcmI CCANNNNNNNNNTGG 1 cut(s) 187
XmnI GAANNNNTTC 1 cut(s) 219
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.