Rmu_sc0000210.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000210.1
OG0000195
Physical Location & Seq
Reverse (-)
56174 .. 57495
1322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000210.1_g000011.1.cds

Sequence Viewer

Length: 1245 bp
atgtcctcttgcaatggaacttgtgctttgtgtaattctccgtggcattcatcttttgagtgttctttgagatttgagtgcccagattttatgcaagagtgtgagtacgagatgggcatgtatcaagagacatttgtacccgatgcatatccacaagaagaagcttatgagcctagtaaggaatttgttgaaggactactagctcaattgcaagcctcccgagatcttttacatgcctctcaagctaggatttcacaagagactatggttcccgaaggatatcctcatgagcaagcgtatgagtctaggaagccttctcttgaagaattgctagctcaattgcaagcgtcccaagctcggttgcaagcttctcaagaaatacttatacataccaatgagcaacttgagactaaagtgtatatcgagcatcttgagcaagaatcatttatgcaagttgaaaatgatgatagtgatgttgatgtacaagaaattgagcttggttatgaaagtttcaatgcaagtggggtgagagactacacttcggaggaatgggtacaatattggaaatctaagcttccaaatgaaggggagatacttgaagatgattccgaagaggaggatgacttgtctagtgaggaggatactgagtttgaagttatacaccataatcccttgttcatcgaggaggatgtggagcttcaagtcatatatcataatcctttattcattgaggccgatgttcccaaggaggaagagagtccttcaatactttgtgatgatcaacaaattgaagagccaaggactttctctcctcccacatccatggagatccatcatgagcttcccaaggtggattgtagaatattgagcacttacgttattcatgagaggagtgggatcaaggtatttttacctcccaatccatcattaagtggtcaatgtttctacaatgatgtgatggattggaaaggaaatggagcacttgcactcaccatttcccatcactctcaagagcttctaccacctatttttcctatgagcatcatttctaatccacttgagaaggagaaggcaaggttggctcctagaagaaaaattgagaagagagggaagactaagaagctacacttttggccaccaattggagtattcttatgtagttcttggtcttgtctctatgacacatcgatgagtcccttagccccaaacaatagggtggtcgcacttgagaagtatccaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

414

Amino Acids

47.6

Weight (kDa)

4.49

Isoelectric Point (pI)

71.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 1142
AclWI GGATC 2 cut(s) 823, 905
AcoI YGGCCR 1 cut(s) 1133
AcsI RAATTY 1 cut(s) 182
AfaI GTAC 4 cut(s) 107, 138, 483, 555
AfiI CCNNNNNNNGG 3 cut(s) 357, 584, 1142
AgsI TTSAA 9 cut(s) 191, 323, 458, 514, 599, 653, 701, 765, 791
AjuI GAANNNNNNNTTGG 4 cut(s) 480, 512, 1061, 1093
Alw21I GWGCWC 2 cut(s) 872, 982
Alw26I GTCTC 5 cut(s) 122, 254, 401, 525, 1178
AlwI GGATC 2 cut(s) 823, 905
Ama87I CYCGRG 1 cut(s) 219
AoxI GGCC 2 cut(s) 732, 1133
ApoI RAATTY 1 cut(s) 182
AsuHPI GGTGA 2 cut(s) 538, 982
AsuNHI GCTAGC 1 cut(s) 331
AvaI CYCGRG 1 cut(s) 219
BaeGI GKGCMC 1 cut(s) 83
BaeI ACNNNNGTAYC 2 cut(s) 120, 153
BalI TGGCCA 1 cut(s) 1135
BarI GAAGNNNNNNTAC 2 cut(s) 576, 608
BbsI GAAGAC 1 cut(s) 1118
Bbv12I GWGCWC 2 cut(s) 872, 982
BccI CCATC 5 cut(s) 106, 840, 931, 952, 1008
BciVI GTATCC 2 cut(s) 634, 1245
BclI TGATCA 1 cut(s) 778
BcoDI GTCTC 5 cut(s) 122, 254, 401, 525, 1178
BfaI CTAG 7 cut(s) 174, 200, 246, 306, 332, 630, 1086
BfuI GTATCC 2 cut(s) 634, 1245
BglII AGATCT 1 cut(s) 223
BmeT110I CYCGRG 1 cut(s) 219
BmiI GGNNCC 2 cut(s) 270, 1083
BmsI GCATC 3 cut(s) 133, 436, 1050
BmtI GCTAGC 1 cut(s) 335
BpiI GAAGAC 1 cut(s) 1118
Bpu10I CCTNAGC 1 cut(s) 1198
BpuEI CTTGAG 6 cut(s) 225, 357, 425, 452, 993, 1079
Bsa29I ATCGAT 1 cut(s) 1187
BsaBI GATNNNNATC 1 cut(s) 147
BsaJI CCNNGG 5 cut(s) 41, 744, 797, 822, 846
BsaXI ACNNNNNCTCC 2 cut(s) 793, 823
Bsc4I CCNNNNNNNGG 3 cut(s) 357, 584, 1142
Bse3DI GCAATG 1 cut(s) 19
Bse8I GATNNNNATC 1 cut(s) 147
BseCI ATCGAT 1 cut(s) 1187
BseDI CCNNGG 5 cut(s) 41, 744, 797, 822, 846
BseGI GGATG 3 cut(s) 625, 694, 818
BseJI GATNNNNATC 1 cut(s) 147
BseLI CCNNNNNNNGG 3 cut(s) 357, 584, 1142
BseMI GCAATG 1 cut(s) 19
BseMII CTCAG 1 cut(s) 636
BseRI GAGGAG 5 cut(s) 629, 650, 698, 801, 904
BseSI GKGCMC 1 cut(s) 83
BshFI GGCC 2 cut(s) 734, 1135
BshVI ATCGAT 1 cut(s) 1187
BsiHKAI GWGCWC 2 cut(s) 872, 982
BsiHKCI CYCGRG 1 cut(s) 219
BslFI GGGAC 2 cut(s) 334, 1179
BslI CCNNNNNNNGG 3 cut(s) 357, 584, 1142
BsmAI GTCTC 5 cut(s) 122, 254, 401, 525, 1178
BsmFI GGGAC 2 cut(s) 334, 1179
BsmI GAATGC 1 cut(s) 46
BsnI GGCC 2 cut(s) 734, 1135
BsoBI CYCGRG 1 cut(s) 219
Bsp1286I GDGCHC 3 cut(s) 83, 872, 982
Bsp1407I TGTACA 1 cut(s) 481
Bsp143I GATC 4 cut(s) 223, 778, 828, 897
Bsp19I CCATGG 1 cut(s) 822
BspANI GGCC 2 cut(s) 734, 1135
BspCNI CTCAG 1 cut(s) 637
BspDI ATCGAT 1 cut(s) 1187
BspHI TCATGA 3 cut(s) 286, 835, 883
BspLI GGNNCC 2 cut(s) 270, 1083
BspOI GCTAGC 1 cut(s) 335
BspPI GGATC 2 cut(s) 823, 905
BspQI GCTCTTC 1 cut(s) 786
BsrDI GCAATG 1 cut(s) 19
BsrGI TGTACA 1 cut(s) 481
BssECI CCNNGG 5 cut(s) 41, 744, 797, 822, 846
BssMI GATC 4 cut(s) 223, 778, 828, 897
BssT1I CCWWGG 4 cut(s) 744, 797, 822, 846
Bst6I CTCTTC 4 cut(s) 606, 747, 786, 1097
BstAUI TGTACA 1 cut(s) 481
BstC8I GCNNGC 5 cut(s) 213, 294, 333, 345, 366
BstDEI CTNAG 4 cut(s) 570, 645, 1116, 1198
BstDSI CCRYGG 2 cut(s) 41, 822
BstF5I GGATG 3 cut(s) 625, 694, 818
BstKTI GATC 4 cut(s) 226, 781, 831, 900
BstMAI GTCTC 5 cut(s) 122, 254, 401, 525, 1178
BstMBI GATC 4 cut(s) 223, 778, 828, 897
BstMWI GCNNNNNNNGC 4 cut(s) 242, 353, 433, 1079
BstNSI RCATGY 2 cut(s) 121, 236
BstSLI GKGCMC 1 cut(s) 83
BstV2I GAAGAC 1 cut(s) 1118
BstX2I RGATCY 2 cut(s) 223, 828
BstXI CCANNNNNNTGG 1 cut(s) 823
BstYI RGATCY 2 cut(s) 223, 828
Bsu15I ATCGAT 1 cut(s) 1187
BsuI GTATCC 2 cut(s) 634, 1245
BsuRI GGCC 2 cut(s) 734, 1135
BsuTUI ATCGAT 1 cut(s) 1187
BtgI CCRYGG 2 cut(s) 41, 822
BtsCI GGATG 3 cut(s) 625, 694, 818
Cac8I GCNNGC 5 cut(s) 213, 294, 333, 345, 366
CciI TCATGA 3 cut(s) 286, 835, 883
ClaI ATCGAT 1 cut(s) 1187
CseI GACGC 1 cut(s) 336
Csp6I GTAC 4 cut(s) 106, 137, 482, 554
CspCI CAANNNNNGTGG 2 cut(s) 502, 537
CviAII CATG 6 cut(s) 118, 233, 287, 823, 836, 884
CviQI GTAC 4 cut(s) 106, 137, 482, 554
DdeI CTNAG 4 cut(s) 570, 645, 1116, 1198
DpnI GATC 4 cut(s) 225, 780, 830, 899
DpnII GATC 4 cut(s) 223, 778, 828, 897
EaeI YGGCCR 1 cut(s) 1133
Eam1104I CTCTTC 4 cut(s) 606, 747, 786, 1097
EarI CTCTTC 4 cut(s) 606, 747, 786, 1097
Eco130I CCWWGG 4 cut(s) 744, 797, 822, 846
Eco32I GATATC 1 cut(s) 281
Eco88I CYCGRG 1 cut(s) 219
EcoRV GATATC 1 cut(s) 281
EcoT14I CCWWGG 4 cut(s) 744, 797, 822, 846
EcoT22I ATGCAT 1 cut(s) 148
ErhI CCWWGG 4 cut(s) 744, 797, 822, 846
FaeI CATG 6 cut(s) 121, 236, 290, 826, 839, 887
FalI AAGNNNNNCTT 4 cut(s) 366, 398, 1112, 1144
FaqI GGGAC 2 cut(s) 334, 1179
FatI CATG 6 cut(s) 117, 232, 286, 822, 835, 883
FbaI TGATCA 1 cut(s) 778
FokI GGATG 3 cut(s) 632, 701, 805
FspBI CTAG 7 cut(s) 174, 200, 246, 306, 332, 630, 1086
HaeIII GGCC 2 cut(s) 734, 1135
HgaI GACGC 1 cut(s) 336
Hin1II CATG 6 cut(s) 121, 236, 290, 826, 839, 887
HindIII AAGCTT 3 cut(s) 162, 366, 572
HinfI GANTC 5 cut(s) 302, 440, 605, 757, 1192
HphI GGTGA 2 cut(s) 538, 982
Hpy188I TCNGA 2 cut(s) 544, 610
HpyAV CCTTC 7 cut(s) 185, 269, 324, 578, 771, 1057, 1063
HpyCH4IV ACGT 1 cut(s) 876
HpyCH4V TGCA 9 cut(s) 12, 94, 146, 211, 343, 364, 451, 518, 986
HpyF10VI GCNNNNNNNGC 4 cut(s) 242, 353, 433, 1079
HpyF3I CTNAG 4 cut(s) 570, 645, 1116, 1198
HpySE526I ACGT 1 cut(s) 876
Hsp92II CATG 6 cut(s) 121, 236, 290, 826, 839, 887
Ksp22I TGATCA 1 cut(s) 778
Kzo9I GATC 4 cut(s) 223, 778, 828, 897
LguI GCTCTTC 1 cut(s) 786
LmnI GCTCC 3 cut(s) 694, 977, 1087
LpnPI CCDG 1 cut(s) 96
LweI GCATC 3 cut(s) 133, 436, 1050
MaeI CTAG 7 cut(s) 174, 200, 246, 306, 332, 630, 1086
MaeII ACGT 1 cut(s) 876
MalI GATC 4 cut(s) 225, 780, 830, 899
MboI GATC 4 cut(s) 223, 778, 828, 897
MboII GAAGA 9 cut(s) 170, 335, 611, 623, 764, 803, 1101, 1114, 1123
MfeI CAATTG 3 cut(s) 206, 338, 1140
MflI RGATCY 2 cut(s) 223, 828
MhlI GDGCHC 3 cut(s) 83, 872, 982
MlsI TGGCCA 1 cut(s) 1135
MluCI AATT 9 cut(s) 34, 182, 206, 326, 338, 489, 786, 1095, 1140
MluNI TGGCCA 1 cut(s) 1135
MlyI GAGTC 3 cut(s) 311, 766, 1201
Mox20I TGGCCA 1 cut(s) 1135
Mph1103I ATGCAT 1 cut(s) 148
MscI TGGCCA 1 cut(s) 1135
MseI TTAA 1 cut(s) 929
MslI CAYNNNNRTG 3 cut(s) 393, 821, 1187
Msp20I TGGCCA 1 cut(s) 1135
MunI CAATTG 3 cut(s) 206, 338, 1140
Mva1269I GAATGC 1 cut(s) 46
MwoI GCNNNNNNNGC 4 cut(s) 242, 353, 433, 1079
NcoI CCATGG 1 cut(s) 822
NdeII GATC 4 cut(s) 223, 778, 828, 897
NheI GCTAGC 1 cut(s) 331
NlaIII CATG 6 cut(s) 121, 236, 290, 826, 839, 887
NlaIV GGNNCC 2 cut(s) 270, 1083
NsiI ATGCAT 1 cut(s) 148
NspI RCATGY 2 cut(s) 121, 236
PagI TCATGA 3 cut(s) 286, 835, 883
PciSI GCTCTTC 1 cut(s) 786
PctI GAATGC 1 cut(s) 46
PfeI GAWTC 2 cut(s) 440, 605
PflMI CCANNNNNTGG 1 cut(s) 1142
PleI GAGTC 3 cut(s) 310, 765, 1200
PpsI GAGTC 3 cut(s) 310, 765, 1200
PspN4I GGNNCC 2 cut(s) 270, 1083
PsuI RGATCY 2 cut(s) 223, 828
RsaI GTAC 4 cut(s) 107, 138, 483, 555
RsaNI GTAC 4 cut(s) 106, 137, 482, 554
RseI CAYNNNNRTG 3 cut(s) 393, 821, 1187
SapI GCTCTTC 1 cut(s) 786
SaqAI TTAA 1 cut(s) 929
Sau3AI GATC 4 cut(s) 223, 778, 828, 897
SchI GAGTC 3 cut(s) 311, 766, 1201
SduI GDGCHC 3 cut(s) 83, 872, 982
SfaNI GCATC 3 cut(s) 133, 436, 1050
SmiMI CAYNNNNRTG 3 cut(s) 393, 821, 1187
SmlI CTYRAG 7 cut(s) 240, 372, 404, 431, 1008, 1058, 1226
SmoI CTYRAG 7 cut(s) 240, 372, 404, 431, 1008, 1058, 1226
Sse9I AATT 9 cut(s) 34, 182, 206, 326, 338, 489, 786, 1095, 1140
SspI AATATT 2 cut(s) 560, 864
SspMI CTAG 7 cut(s) 174, 200, 246, 306, 332, 630, 1086
StyI CCWWGG 4 cut(s) 744, 797, 822, 846
TaiI ACGT 1 cut(s) 879
TaqI TCGA 3 cut(s) 423, 681, 1187
TasI AATT 9 cut(s) 34, 182, 206, 326, 338, 489, 786, 1095, 1140
TatI WGTACW 1 cut(s) 481
TfiI GAWTC 2 cut(s) 440, 605
Tru1I TTAA 1 cut(s) 929
Tru9I TTAA 1 cut(s) 929
TspDTI ATGAA 6 cut(s) 39, 519, 597, 667, 715, 872
TspGWI ACGGA 1 cut(s) 30
Van91I CCANNNNNTGG 1 cut(s) 1142
XapI RAATTY 1 cut(s) 182
XceI RCATGY 2 cut(s) 121, 236
XspI CTAG 7 cut(s) 174, 200, 246, 306, 332, 630, 1086
Zsp2I ATGCAT 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.