Rmu_sc0034219.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034219.1
OG0000195
Physical Location & Seq
Forward (+)
965 .. 2182
1218 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034219.1_g000001.1.cds

Sequence Viewer

Length: 1122 bp
atgggcatgtatcaagagacatttgtatccaatgcatatccacaagatgaagcttatgagcctacgaagaaattcgttgaaggactactagtccaattgcaagcctcccgagatcttgtacatgcctctcaagctaggatctcacaagagaccatggttcccgaagcatatcctcatgagcaagtgtatgagtctgggaagccttctcttgaagaattgctaactcaattgcaagcatcccaagctcgattgcaagcttctcaagaaatgcttatacattccaatgagaaacttgagatgagtcttgcacaagagccacccttcacaatttttcatgagcatgaatctttctttgaccaagtagagcctatttcaagagaagaagcgtatattggccatcttgagcaagagtcttttatgcaagttgaagatgatgatagtgatgttgatgtaaaagaaagggagatatttgaagatgattccgaagaggagaatgtcttttctagtgaggaggatgcggagttcaaagtcatacaccataatcctttgttcgttgaggaggatgcagagcttgaagtcatacaccataatcccttattcattgaggctgatattcccatggaggaagagagtcattcactaacttgtgatgatgaagaaattgaagagccaaggactttctctcctcccacatccaaagtgatccatcatgagcttcccaaggtggaaagtaggacattgagcacttacattcttaatgagaggattgggatcaaggtacgtttacctcccaagccaccattaagtggtcaatgttgctacaatgaggtgatggattggaaaggaaatgaagcacttgcactcaccctttcctatcactctcaagagcttctaccacatattgttcctatgagcatcatttttaatccacttgagaaggagaagataaggatagtggctcctacaagaaaaattgacaagaagaggaaaattaagaagctacactttttctcgccaattggaatattcataggtagttcttggtgttgcctctatgataaatcaaggagtccattagagccgaacaatagggtggtcgtacttgagaagtatccaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

373

Amino Acids

43.1

Weight (kDa)

4.75

Isoelectric Point (pI)

59.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 806
AciI CCGC 1 cut(s) 518
AclWI GGATC 3 cut(s) 146, 697, 779
AcoI YGGCCR 1 cut(s) 394
AcsI RAATTY 1 cut(s) 71
AfaI GTAC 3 cut(s) 120, 780, 1101
AfiI CCNNNNNNNGG 1 cut(s) 806
AgsI TTSAA 8 cut(s) 80, 212, 375, 428, 473, 526, 575, 665
AhdI GACNNNNNGTC 1 cut(s) 89
AhlI ACTAGT 1 cut(s) 88
AjuI GAANNNNNNNTTGG 2 cut(s) 375, 407
AloI GAACNNNNNNTCC 2 cut(s) 506, 538
AluBI AGCT 8 cut(s) 53, 134, 245, 257, 571, 715, 889, 1000
AluI AGCT 8 cut(s) 53, 134, 245, 257, 571, 715, 889, 1000
Alw21I GWGCWC 1 cut(s) 746
Alw26I GTCTC 2 cut(s) 11, 143
AlwI GGATC 3 cut(s) 146, 697, 779
Ama87I CYCGRG 1 cut(s) 108
AoxI GGCC 1 cut(s) 394
ApoI RAATTY 1 cut(s) 71
Asp700I GAANNNNTTC 1 cut(s) 71
AsuHPI GGTGA 2 cut(s) 841, 856
AvaI CYCGRG 1 cut(s) 108
BaeI ACNNNNGTAYC 2 cut(s) 9, 42
BalI TGGCCA 1 cut(s) 396
Bbv12I GWGCWC 1 cut(s) 746
BccI CCATC 3 cut(s) 405, 714, 826
BciVI GTATCC 2 cut(s) 37, 1122
BcoDI GTCTC 2 cut(s) 11, 143
BcuI ACTAGT 1 cut(s) 88
BfaI CTAG 3 cut(s) 89, 135, 504
BfuI GTATCC 2 cut(s) 37, 1122
BglII AGATCT 1 cut(s) 112
BmeRI GACNNNNNGTC 1 cut(s) 89
BmeT110I CYCGRG 1 cut(s) 108
BmiI GGNNCC 2 cut(s) 159, 960
BmsI GCATC 4 cut(s) 245, 505, 553, 924
BpuEI CTTGAG 6 cut(s) 114, 246, 314, 422, 867, 953
BsaBI GATNNNNATC 1 cut(s) 770
BsaI GGTCTC 1 cut(s) 143
BsaJI CCNNGG 4 cut(s) 153, 618, 671, 720
BsaXI ACNNNNNCTCC 2 cut(s) 667, 697
Bsc4I CCNNNNNNNGG 1 cut(s) 806
Bse8I GATNNNNATC 1 cut(s) 770
BseDI CCNNGG 4 cut(s) 153, 618, 671, 720
BseGI GGATG 4 cut(s) 236, 520, 568, 692
BseJI GATNNNNATC 1 cut(s) 770
BseLI CCNNNNNNNGG 1 cut(s) 806
BseRI GAGGAG 4 cut(s) 503, 524, 572, 675
BshFI GGCC 1 cut(s) 396
BsiHKAI GWGCWC 1 cut(s) 746
BsiHKCI CYCGRG 1 cut(s) 108
BslI CCNNNNNNNGG 1 cut(s) 806
BsmAI GTCTC 2 cut(s) 11, 143
BsnI GGCC 1 cut(s) 396
Bso31I GGTCTC 1 cut(s) 143
BsoBI CYCGRG 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 746
Bsp1407I TGTACA 1 cut(s) 118
Bsp143I GATC 4 cut(s) 112, 138, 702, 771
Bsp19I CCATGG 2 cut(s) 153, 618
BspACI CCGC 1 cut(s) 518
BspANI GGCC 1 cut(s) 396
BspHI TCATGA 3 cut(s) 175, 334, 709
BspLI GGNNCC 2 cut(s) 159, 960
BspPI GGATC 3 cut(s) 146, 697, 779
BspQI GCTCTTC 1 cut(s) 660
BspTNI GGTCTC 1 cut(s) 143
BsrGI TGTACA 1 cut(s) 118
BssECI CCNNGG 4 cut(s) 153, 618, 671, 720
BssMI GATC 4 cut(s) 112, 138, 702, 771
BssT1I CCWWGG 4 cut(s) 153, 618, 671, 720
Bst6I CTCTTC 4 cut(s) 480, 621, 660, 977
BstAUI TGTACA 1 cut(s) 118
BstC8I GCNNGC 3 cut(s) 102, 234, 255
BstDSI CCRYGG 2 cut(s) 153, 618
BstF5I GGATG 4 cut(s) 236, 520, 568, 692
BstKTI GATC 4 cut(s) 115, 141, 705, 774
BstMAI GTCTC 2 cut(s) 11, 143
BstMBI GATC 4 cut(s) 112, 138, 702, 771
BstMWI GCNNNNNNNGC 2 cut(s) 131, 242
BstNSI RCATGY 2 cut(s) 10, 125
BstX2I RGATCY 2 cut(s) 112, 138
BstYI RGATCY 2 cut(s) 112, 138
BsuI GTATCC 2 cut(s) 37, 1122
BsuRI GGCC 1 cut(s) 396
BtgI CCRYGG 2 cut(s) 153, 618
BtsCI GGATG 4 cut(s) 236, 520, 568, 692
Cac8I GCNNGC 3 cut(s) 102, 234, 255
CciI TCATGA 3 cut(s) 175, 334, 709
Csp6I GTAC 3 cut(s) 119, 779, 1100
CviAII CATG 8 cut(s) 7, 122, 154, 176, 335, 341, 619, 710
CviQI GTAC 3 cut(s) 119, 779, 1100
DpnI GATC 4 cut(s) 114, 140, 704, 773
DpnII GATC 4 cut(s) 112, 138, 702, 771
DriI GACNNNNNGTC 1 cut(s) 89
EaeI YGGCCR 1 cut(s) 394
Eam1104I CTCTTC 4 cut(s) 480, 621, 660, 977
Eam1105I GACNNNNNGTC 1 cut(s) 89
EarI CTCTTC 4 cut(s) 480, 621, 660, 977
Eco130I CCWWGG 4 cut(s) 153, 618, 671, 720
Eco31I GGTCTC 1 cut(s) 143
Eco88I CYCGRG 1 cut(s) 108
EcoT14I CCWWGG 4 cut(s) 153, 618, 671, 720
EcoT22I ATGCAT 1 cut(s) 37
ErhI CCWWGG 4 cut(s) 153, 618, 671, 720
FaeI CATG 8 cut(s) 10, 125, 157, 179, 338, 344, 622, 713
FalI AAGNNNNNCTT 4 cut(s) 255, 287, 989, 1021
FatI CATG 8 cut(s) 6, 121, 153, 175, 334, 340, 618, 709
FokI GGATG 4 cut(s) 223, 527, 575, 679
FspBI CTAG 3 cut(s) 89, 135, 504
HaeIII GGCC 1 cut(s) 396
Hin1II CATG 8 cut(s) 10, 125, 157, 179, 338, 344, 622, 713
HindIII AAGCTT 2 cut(s) 51, 255
HinfI GANTC 7 cut(s) 191, 301, 344, 410, 479, 631, 1069
HphI GGTGA 2 cut(s) 841, 856
Hpy166II GTNNAC 1 cut(s) 785
Hpy188I TCNGA 1 cut(s) 484
Hpy8I GTNNAC 1 cut(s) 785
HpyAV CCTTC 4 cut(s) 74, 213, 331, 931
HpyCH4IV ACGT 1 cut(s) 781
HpyCH4V TGCA 8 cut(s) 35, 100, 232, 253, 308, 421, 566, 860
HpyF10VI GCNNNNNNNGC 2 cut(s) 131, 242
HpySE526I ACGT 1 cut(s) 781
Hsp92II CATG 8 cut(s) 10, 125, 157, 179, 338, 344, 622, 713
Kzo9I GATC 4 cut(s) 112, 138, 702, 771
LguI GCTCTTC 1 cut(s) 660
LmnI GCTCC 1 cut(s) 964
LpnPI CCDG 1 cut(s) 180
LweI GCATC 4 cut(s) 245, 505, 553, 924
MaeI CTAG 3 cut(s) 89, 135, 504
MaeII ACGT 1 cut(s) 781
MalI GATC 4 cut(s) 114, 140, 704, 773
MboI GATC 4 cut(s) 112, 138, 702, 771
MfeI CAATTG 3 cut(s) 95, 227, 1017
MflI RGATCY 2 cut(s) 112, 138
MhlI GDGCHC 1 cut(s) 746
MlsI TGGCCA 1 cut(s) 396
MluCI AATT 9 cut(s) 71, 95, 215, 227, 327, 660, 972, 990, 1017
MluNI TGGCCA 1 cut(s) 396
MlyI GAGTC 5 cut(s) 200, 310, 419, 640, 1078
Mox20I TGGCCA 1 cut(s) 396
Mph1103I ATGCAT 1 cut(s) 37
MroXI GAANNNNTTC 1 cut(s) 71
MscI TGGCCA 1 cut(s) 396
MseI TTAA 4 cut(s) 756, 803, 924, 993
MslI CAYNNNNRTG 2 cut(s) 282, 339
Msp20I TGGCCA 1 cut(s) 396
MunI CAATTG 3 cut(s) 95, 227, 1017
MwoI GCNNNNNNNGC 2 cut(s) 131, 242
NcoI CCATGG 2 cut(s) 153, 618
NdeII GATC 4 cut(s) 112, 138, 702, 771
NlaIII CATG 8 cut(s) 10, 125, 157, 179, 338, 344, 622, 713
NlaIV GGNNCC 2 cut(s) 159, 960
NsiI ATGCAT 1 cut(s) 37
NspI RCATGY 2 cut(s) 10, 125
PagI TCATGA 3 cut(s) 175, 334, 709
PciSI GCTCTTC 1 cut(s) 660
PdmI GAANNNNTTC 1 cut(s) 71
PfeI GAWTC 2 cut(s) 344, 479
PflMI CCANNNNNTGG 1 cut(s) 806
PleI GAGTC 5 cut(s) 199, 309, 418, 639, 1077
PpsI GAGTC 5 cut(s) 199, 309, 418, 639, 1077
PspN4I GGNNCC 2 cut(s) 159, 960
PsuI RGATCY 2 cut(s) 112, 138
RsaI GTAC 3 cut(s) 120, 780, 1101
RsaNI GTAC 3 cut(s) 119, 779, 1100
RseI CAYNNNNRTG 2 cut(s) 282, 339
SapI GCTCTTC 1 cut(s) 660
SaqAI TTAA 4 cut(s) 756, 803, 924, 993
Sau3AI GATC 4 cut(s) 112, 138, 702, 771
SchI GAGTC 5 cut(s) 200, 310, 419, 640, 1078
SduI GDGCHC 1 cut(s) 746
SfaNI GCATC 4 cut(s) 245, 505, 553, 924
SmiMI CAYNNNNRTG 2 cut(s) 282, 339
SmlI CTYRAG 7 cut(s) 129, 261, 293, 401, 882, 932, 1103
SmoI CTYRAG 7 cut(s) 129, 261, 293, 401, 882, 932, 1103
SpeI ACTAGT 1 cut(s) 88
Sse9I AATT 9 cut(s) 71, 95, 215, 227, 327, 660, 972, 990, 1017
SsiI CCGC 1 cut(s) 518
SspI AATATT 1 cut(s) 1026
SspMI CTAG 3 cut(s) 89, 135, 504
StyI CCWWGG 4 cut(s) 153, 618, 671, 720
TaiI ACGT 1 cut(s) 784
TaqI TCGA 1 cut(s) 247
TasI AATT 9 cut(s) 71, 95, 215, 227, 327, 660, 972, 990, 1017
TatI WGTACW 1 cut(s) 118
TfiI GAWTC 2 cut(s) 344, 479
Tru1I TTAA 4 cut(s) 756, 803, 924, 993
Tru9I TTAA 4 cut(s) 756, 803, 924, 993
TspDTI ATGAA 7 cut(s) 63, 323, 357, 589, 669, 864, 1018
Van91I CCANNNNNTGG 1 cut(s) 806
XapI RAATTY 1 cut(s) 71
XceI RCATGY 2 cut(s) 10, 125
XmnI GAANNNNTTC 1 cut(s) 71
XspI CTAG 3 cut(s) 89, 135, 504
Zsp2I ATGCAT 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.