Rmu_sc0006912.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006912.1
OG0000195
Physical Location & Seq
Reverse (-)
27172 .. 28215
1044 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006912.1_g000005.1.cds

Sequence Viewer

Length: 1044 bp
atgcaagaatatgagtacaagatgggcatgtatcaagagacatttgtaccagaggcatatccacaagagcaagcttttgagcctaggaagccatcacttgaagaacaactagctcaattggaagcctctaatgctcaattgcaagcctcccaagctcgattgcatgctaaattggaagccttcaatgctcaattgcaagcttctcaagaaatgacttcacattccaatgagcaacttgagcctagtgttgcacaagagccacccttcaccatttctcatgagcaagagtctttctttgaccaagtggagctttctttaagagaagtgtattatgagcatcatgagcaagaattgcctattcaagatcgagagggtggtgttcatgtacaaaaaagtgagcttggttatgaaagttccaatgcaagtacgatgagagactacattttggaggaatcggtgcaatattggaactctaatcttcacaatgaagaagagaaatatgaagatgattctgaagaagaggatagcttgtttagtgaggaggatgtagagcttgaagacttacaccatgatcccttaattgttgaggtcgatattcccaaggaggaagaaagtccttcaataccttgtgatgatgaagaaattgaagagccaaggattttctctcctcccgcatccatggagatccatcatgagcttcccatggtggagagtagaacgttgagcacttatgtacttaatgagaagattgagcttaaggtacttttacctctcaatccaccatttagtgaccattgtttttacaatgaggtgatggattggaaaggaagtggagcacttgcactcaacccttcacatcacactcaagagcttctaccacctattgttcctacgagcatcatttctacaccacttttgaaggagagggcaagattggctcctacaagaaaaattgagaagaagaggaagattaagaagctacacttttggtcatccattggaatcttcatggatagctcttggtcttgcctctatgacatctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

347

Amino Acids

40.26

Weight (kDa)

4.53

Isoelectric Point (pI)

63.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 672
AclI AACGTT 1 cut(s) 719
AclWI GGATC 2 cut(s) 566, 679
AcuI CTGAAG 1 cut(s) 534
AfaI GTAC 6 cut(s) 17, 48, 387, 427, 735, 762
AflII CTTAAG 1 cut(s) 755
AgsI TTSAA 7 cut(s) 101, 184, 362, 557, 621, 647, 919
Alw21I GWGCWC 2 cut(s) 728, 838
Alw26I GTCTC 2 cut(s) 32, 429
AlwI GGATC 2 cut(s) 566, 679
AspA2I CCTAGG 1 cut(s) 83
AsuHPI GGTGA 2 cut(s) 259, 823
AvrII CCTAGG 1 cut(s) 83
BaeI ACNNNNGTAYC 2 cut(s) 30, 63
BbsI GAAGAC 1 cut(s) 564
Bbv12I GWGCWC 2 cut(s) 728, 838
BccI CCATC 4 cut(s) 16, 100, 696, 808
BcoDI GTCTC 2 cut(s) 32, 429
BfaI CTAG 3 cut(s) 84, 110, 243
BfrI CTTAAG 1 cut(s) 755
BlnI CCTAGG 1 cut(s) 83
BmiI GGNNCC 1 cut(s) 939
BmsI GCATC 3 cut(s) 346, 683, 906
BpiI GAAGAC 1 cut(s) 564
BpuEI CTTGAG 3 cut(s) 189, 257, 849
BsaJI CCNNGG 5 cut(s) 83, 600, 653, 678, 702
BseDI CCNNGG 5 cut(s) 83, 600, 653, 678, 702
BseGI GGATG 3 cut(s) 550, 674, 992
BseRI GAGGAG 2 cut(s) 554, 657
BsiHKAI GWGCWC 2 cut(s) 728, 838
BsmAI GTCTC 2 cut(s) 32, 429
Bsp1286I GDGCHC 2 cut(s) 728, 838
Bsp1407I TGTACA 1 cut(s) 385
Bsp143I GATC 3 cut(s) 364, 571, 684
Bsp19I CCATGG 2 cut(s) 678, 702
BspACI CCGC 1 cut(s) 672
BspHI TCATGA 3 cut(s) 277, 340, 691
BspLI GGNNCC 1 cut(s) 939
BspPI GGATC 2 cut(s) 566, 679
BspQI GCTCTTC 1 cut(s) 642
BspTI CTTAAG 1 cut(s) 755
BsrGI TGTACA 1 cut(s) 385
BssECI CCNNGG 5 cut(s) 83, 600, 653, 678, 702
BssMI GATC 3 cut(s) 364, 571, 684
BssT1I CCWWGG 5 cut(s) 83, 600, 653, 678, 702
Bst6I CTCTTC 4 cut(s) 486, 513, 642, 956
BstAFI CTTAAG 1 cut(s) 755
BstAPI GCANNNNNTGC 1 cut(s) 352
BstAUI TGTACA 1 cut(s) 385
BstC8I GCNNGC 4 cut(s) 72, 144, 165, 198
BstDSI CCRYGG 2 cut(s) 678, 702
BstF5I GGATG 3 cut(s) 550, 674, 992
BstKTI GATC 3 cut(s) 367, 574, 687
BstMAI GTCTC 2 cut(s) 32, 429
BstMBI GATC 3 cut(s) 364, 571, 684
BstMWI GCNNNNNNNGC 8 cut(s) 88, 131, 152, 185, 238, 343, 352, 935
BstNSI RCATGY 2 cut(s) 31, 167
BstV2I GAAGAC 1 cut(s) 564
BstX2I RGATCY 1 cut(s) 684
BstYI RGATCY 1 cut(s) 684
BtgI CCRYGG 2 cut(s) 678, 702
BtsCI GGATG 3 cut(s) 550, 674, 992
Cac8I GCNNGC 4 cut(s) 72, 144, 165, 198
CciI TCATGA 3 cut(s) 277, 340, 691
Csp6I GTAC 6 cut(s) 16, 47, 386, 426, 734, 761
CviQI GTAC 6 cut(s) 16, 47, 386, 426, 734, 761
DpnI GATC 3 cut(s) 366, 573, 686
DpnII GATC 3 cut(s) 364, 571, 684
Eam1104I CTCTTC 4 cut(s) 486, 513, 642, 956
EarI CTCTTC 4 cut(s) 486, 513, 642, 956
Eco130I CCWWGG 5 cut(s) 83, 600, 653, 678, 702
Eco57I CTGAAG 1 cut(s) 534
EcoT14I CCWWGG 5 cut(s) 83, 600, 653, 678, 702
ErhI CCWWGG 5 cut(s) 83, 600, 653, 678, 702
FalI AAGNNNNNCTT 4 cut(s) 294, 326, 968, 1000
FauI CCCGC 1 cut(s) 679
FokI GGATG 3 cut(s) 557, 661, 979
FspBI CTAG 3 cut(s) 84, 110, 243
HindIII AAGCTT 2 cut(s) 72, 198
HinfI GANTC 4 cut(s) 287, 452, 509, 1002
HphI GGTGA 2 cut(s) 259, 823
Hpy188I TCNGA 1 cut(s) 514
Hpy188III TCNNGA 8 cut(s) 35, 206, 278, 341, 362, 368, 692, 866
HpyAV CCTTC 5 cut(s) 190, 274, 627, 861, 913
HpyCH4IV ACGT 1 cut(s) 719
HpyCH4V TGCA 8 cut(s) 4, 142, 163, 196, 251, 422, 460, 842
HpyF10VI GCNNNNNNNGC 8 cut(s) 88, 131, 152, 185, 238, 343, 352, 935
HpySE526I ACGT 1 cut(s) 719
Kzo9I GATC 3 cut(s) 364, 571, 684
LguI GCTCTTC 1 cut(s) 642
LmnI GCTCC 3 cut(s) 307, 833, 943
LpnPI CCDG 1 cut(s) 63
LweI GCATC 3 cut(s) 346, 683, 906
MaeI CTAG 3 cut(s) 84, 110, 243
MaeII ACGT 1 cut(s) 719
MaeIII GTNAC 1 cut(s) 788
MalI GATC 3 cut(s) 366, 573, 686
MboI GATC 3 cut(s) 364, 571, 684
MfeI CAATTG 3 cut(s) 116, 137, 191
MflI RGATCY 1 cut(s) 684
MhlI GDGCHC 2 cut(s) 728, 838
MluCI AATT 8 cut(s) 116, 137, 170, 191, 350, 579, 642, 951
MlyI GAGTC 1 cut(s) 296
MseI TTAA 5 cut(s) 317, 578, 738, 756, 972
MslI CAYNNNNRTG 1 cut(s) 225
MspCI CTTAAG 1 cut(s) 755
MunI CAATTG 3 cut(s) 116, 137, 191
MwoI GCNNNNNNNGC 8 cut(s) 88, 131, 152, 185, 238, 343, 352, 935
NcoI CCATGG 2 cut(s) 678, 702
NdeII GATC 3 cut(s) 364, 571, 684
NlaIV GGNNCC 1 cut(s) 939
NmuCI GTSAC 1 cut(s) 788
NspI RCATGY 2 cut(s) 31, 167
PaeI GCATGC 1 cut(s) 167
PagI TCATGA 3 cut(s) 277, 340, 691
PciSI GCTCTTC 1 cut(s) 642
PfeI GAWTC 3 cut(s) 452, 509, 1002
PleI GAGTC 1 cut(s) 295
PpsI GAGTC 1 cut(s) 295
Psp1406I AACGTT 1 cut(s) 719
PspN4I GGNNCC 1 cut(s) 939
PsuI RGATCY 1 cut(s) 684
RsaI GTAC 6 cut(s) 17, 48, 387, 427, 735, 762
RsaNI GTAC 6 cut(s) 16, 47, 386, 426, 734, 761
RseI CAYNNNNRTG 1 cut(s) 225
SapI GCTCTTC 1 cut(s) 642
SaqAI TTAA 5 cut(s) 317, 578, 738, 756, 972
Sau3AI GATC 3 cut(s) 364, 571, 684
SchI GAGTC 1 cut(s) 296
SduI GDGCHC 2 cut(s) 728, 838
SfaNI GCATC 3 cut(s) 346, 683, 906
SmiMI CAYNNNNRTG 1 cut(s) 225
SmlI CTYRAG 4 cut(s) 204, 236, 755, 864
SmoI CTYRAG 4 cut(s) 204, 236, 755, 864
SphI GCATGC 1 cut(s) 167
Sse9I AATT 8 cut(s) 116, 137, 170, 191, 350, 579, 642, 951
SsiI CCGC 1 cut(s) 672
SspI AATATT 1 cut(s) 464
SspMI CTAG 3 cut(s) 84, 110, 243
StyI CCWWGG 5 cut(s) 83, 600, 653, 678, 702
TaiI ACGT 1 cut(s) 722
TaqI TCGA 3 cut(s) 157, 367, 591
TasI AATT 8 cut(s) 116, 137, 170, 191, 350, 579, 642, 951
TatI WGTACW 3 cut(s) 15, 385, 733
TfiI GAWTC 3 cut(s) 452, 509, 1002
Tru1I TTAA 5 cut(s) 317, 578, 738, 756, 972
Tru9I TTAA 5 cut(s) 317, 578, 738, 756, 972
TseFI GTSAC 1 cut(s) 788
Tsp45I GTSAC 1 cut(s) 788
TspDTI ATGAA 6 cut(s) 371, 423, 501, 516, 651, 997
Vha464I CTTAAG 1 cut(s) 755
XceI RCATGY 2 cut(s) 31, 167
XmaJI CCTAGG 1 cut(s) 83
XspI CTAG 3 cut(s) 84, 110, 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.