Rmu_sc0003416.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003416.1
OG0000195
Physical Location & Seq
Forward (+)
9007 .. 10326
1320 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003416.1_g000002.1.cds

Sequence Viewer

Length: 1320 bp
atggatcgatggagttatggatgggatgatcgtaggggatatgagcaacaaagttataatggtgaaggctatcaagaatggaatacatatgccgagagtcctatgccttgttacaaccaaccttgtgctttatgtaattctccgtggcattcaccttttgattgctcattgagatttgagtacccggattttatgcgagaatacgagtacaagatgggcatgtatcaagacacatttatacccgaggcatatccacaagagcaagcttttgagcataggaagccatcacttgaagaacaacttgctcaattggaagcctccaatgctcaattccaagcctcccaagctcaatgtctagcctcccaagctcggttgcatgctaaattggaagccttttatgctcaattgcaagcttctcaagaaatgatttcacattccaatgagcaacttgagcctagtcttgcacaagagccaccactcaccatttgtcatgaccaagattctttctttgatcaagtggagcctaattcaagagaaggagtatattttgagcatcatgagcaagagttgcctcttcaagatcgagagagtgatgttcatgtacaagaaggtgtgcttggttatggaaaatttgaagcaagtgggttgagagactacacttcggaggaaccggtgcaatattggaaatctaatcttcacaatgaagaagagaaatatgaagatgattctgaagaagaggatagcttgtttagtgagggggatgtggagcttgaagagctagaccatattcccttaattgttgaggccgatattcccaaggaggaagagagtcctttaatacattgtaatgataaagaagttgaagagacaaaggttttctctcctcccacatccacagagatccctcatgtgcttcccaaggtggagagtagaacgttgagcacttatgtacttaatgagaagattgagcttaaggtacttttacctctcaatccaccattaagtggtcaatgtttctacaatgaggtgatggattggaaaggaagtggagcacttgcactcaccctttcccatcactctcaagagattctaccacctattgttcctatgagcatcatttctaatccacttgagaatgagaaggcaaggatattggctcctagaagaaaaattgagaagaagaggaaaattaagaagctacacttttgctcaccatttggaatattcataggtagctcttggccttgcctctatgacacatcaaggagtcccttagcccctaacaatagggtggtcgcacttgagaagtatccaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

439

Amino Acids

50.75

Weight (kDa)

4.68

Isoelectric Point (pI)

64.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 57
AccB7I CCANNNNNTGG 1 cut(s) 1004
AclI AACGTT 1 cut(s) 935
AclWI GGATC 2 cut(s) 12, 895
AcsI RAATTY 1 cut(s) 629
AcuI CTGAAG 1 cut(s) 750
AfaI GTAC 5 cut(s) 182, 209, 603, 951, 978
AfiI CCNNNNNNNGG 2 cut(s) 369, 1004
AflII CTTAAG 1 cut(s) 971
AgeI ACCGGT 1 cut(s) 670
AgsI TTSAA 6 cut(s) 293, 531, 578, 635, 773, 863
AjuI GAANNNNNNNTTGG 4 cut(s) 314, 346, 600, 632
Alw21I GWGCWC 2 cut(s) 944, 1054
Alw26I GTCTC 2 cut(s) 645, 860
AlwI GGATC 2 cut(s) 12, 895
Ama87I CYCGRG 1 cut(s) 242
AoxI GGCC 2 cut(s) 804, 1241
ApoI RAATTY 1 cut(s) 629
AsiGI ACCGGT 1 cut(s) 670
AsuC2I CCSGG 1 cut(s) 185
AsuHPI GGTGA 6 cut(s) 74, 144, 472, 1039, 1054, 1203
AvaI CYCGRG 1 cut(s) 242
Bbv12I GWGCWC 2 cut(s) 944, 1054
BccI CCATC 6 cut(s) 3, 15, 208, 292, 1024, 1080
BciVI GTATCC 1 cut(s) 1320
BclI TGATCA 1 cut(s) 511
BcnI CCSGG 1 cut(s) 185
BcoDI GTCTC 2 cut(s) 645, 860
BfaI CTAG 4 cut(s) 356, 456, 779, 1161
BfrI CTTAAG 1 cut(s) 971
BfuI GTATCC 1 cut(s) 1320
Bme1390I CCNGG 1 cut(s) 185
BmeT110I CYCGRG 1 cut(s) 242
BmiI GGNNCC 3 cut(s) 522, 669, 1158
BmrFI CCNGG 1 cut(s) 185
BmsI GCATC 2 cut(s) 562, 1122
Bpu10I CCTNAGC 1 cut(s) 1273
BpuEI CTTGAG 4 cut(s) 402, 470, 1065, 1151
BpuMI CCSGG 1 cut(s) 185
Bsa29I ATCGAT 1 cut(s) 7
BsaJI CCNNGG 4 cut(s) 143, 243, 816, 918
BsaWI WCCGGW 1 cut(s) 670
Bsc4I CCNNNNNNNGG 2 cut(s) 369, 1004
Bse118I RCCGGY 1 cut(s) 670
BseCI ATCGAT 1 cut(s) 7
BseDI CCNNGG 4 cut(s) 143, 243, 816, 918
BseGI GGATG 4 cut(s) 26, 31, 766, 890
BseLI CCNNNNNNNGG 2 cut(s) 369, 1004
BseRI GAGGAG 1 cut(s) 873
BshFI GGCC 2 cut(s) 806, 1243
BshTI ACCGGT 1 cut(s) 670
BshVI ATCGAT 1 cut(s) 7
BsiHKAI GWGCWC 2 cut(s) 944, 1054
BsiHKCI CYCGRG 1 cut(s) 242
BsiSI CCGG 2 cut(s) 185, 671
BslFI GGGAC 1 cut(s) 1254
BslI CCNNNNNNNGG 2 cut(s) 369, 1004
BsmAI GTCTC 2 cut(s) 645, 860
BsmFI GGGAC 1 cut(s) 1254
BsmI GAATGC 1 cut(s) 148
BsnI GGCC 2 cut(s) 806, 1243
BsoBI CYCGRG 1 cut(s) 242
Bsp1286I GDGCHC 2 cut(s) 944, 1054
Bsp1407I TGTACA 1 cut(s) 601
Bsp143I GATC 5 cut(s) 4, 28, 511, 580, 900
BspANI GGCC 2 cut(s) 806, 1243
BspDI ATCGAT 1 cut(s) 7
BspHI TCATGA 2 cut(s) 490, 556
BspLI GGNNCC 3 cut(s) 522, 669, 1158
BspPI GGATC 2 cut(s) 12, 895
BspQI GCTCTTC 1 cut(s) 768
BspTI CTTAAG 1 cut(s) 971
BsrFI RCCGGY 1 cut(s) 670
BsrGI TGTACA 1 cut(s) 601
BssAI RCCGGY 1 cut(s) 670
BssECI CCNNGG 4 cut(s) 143, 243, 816, 918
BssMI GATC 5 cut(s) 4, 28, 511, 580, 900
BssT1I CCWWGG 2 cut(s) 816, 918
Bst6I CTCTTC 7 cut(s) 579, 702, 729, 768, 819, 858, 1175
BstAFI CTTAAG 1 cut(s) 971
BstAPI GCANNNNNTGC 1 cut(s) 568
BstAUI TGTACA 1 cut(s) 601
BstC8I GCNNGC 3 cut(s) 264, 378, 411
BstDEI CTNAG 1 cut(s) 1273
BstDSI CCRYGG 1 cut(s) 143
BstF5I GGATG 4 cut(s) 26, 31, 766, 890
BstKTI GATC 5 cut(s) 7, 31, 514, 583, 903
BstMAI GTCTC 2 cut(s) 645, 860
BstMBI GATC 5 cut(s) 4, 28, 511, 580, 900
BstMWI GCNNNNNNNGC 9 cut(s) 280, 323, 344, 365, 398, 451, 559, 568, 775
BstNSI RCATGY 2 cut(s) 223, 380
BstSCI CCNGG 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 900
BstYI RGATCY 1 cut(s) 900
Bsu15I ATCGAT 1 cut(s) 7
BsuI GTATCC 1 cut(s) 1320
BsuRI GGCC 2 cut(s) 806, 1243
BsuTUI ATCGAT 1 cut(s) 7
BtgI CCRYGG 1 cut(s) 143
BtsCI GGATG 4 cut(s) 26, 31, 766, 890
Cac8I GCNNGC 3 cut(s) 264, 378, 411
CciI TCATGA 2 cut(s) 490, 556
Cfr10I RCCGGY 1 cut(s) 670
ClaI ATCGAT 1 cut(s) 7
Csp6I GTAC 5 cut(s) 181, 208, 602, 950, 977
CspAI ACCGGT 1 cut(s) 670
CviAII CATG 6 cut(s) 220, 377, 491, 557, 599, 908
CviQI GTAC 5 cut(s) 181, 208, 602, 950, 977
DdeI CTNAG 1 cut(s) 1273
DpnI GATC 5 cut(s) 6, 30, 513, 582, 902
DpnII GATC 5 cut(s) 4, 28, 511, 580, 900
Eam1104I CTCTTC 7 cut(s) 579, 702, 729, 768, 819, 858, 1175
EarI CTCTTC 7 cut(s) 579, 702, 729, 768, 819, 858, 1175
Eco130I CCWWGG 2 cut(s) 816, 918
Eco57I CTGAAG 1 cut(s) 750
Eco88I CYCGRG 1 cut(s) 242
EcoT14I CCWWGG 2 cut(s) 816, 918
ErhI CCWWGG 2 cut(s) 816, 918
FaeI CATG 6 cut(s) 223, 380, 494, 560, 602, 911
FalI AAGNNNNNCTT 6 cut(s) 285, 317, 600, 632, 1187, 1219
FaqI GGGAC 1 cut(s) 1254
FatI CATG 6 cut(s) 219, 376, 490, 556, 598, 907
FauNDI CATATG 1 cut(s) 88
FbaI TGATCA 1 cut(s) 511
FokI GGATG 4 cut(s) 33, 38, 773, 877
FspBI CTAG 4 cut(s) 356, 456, 779, 1161
HaeIII GGCC 2 cut(s) 806, 1243
HapII CCGG 2 cut(s) 185, 671
Hin1II CATG 6 cut(s) 223, 380, 494, 560, 602, 911
HindIII AAGCTT 2 cut(s) 264, 411
HinfI GANTC 6 cut(s) 97, 500, 725, 829, 1087, 1267
HpaII CCGG 2 cut(s) 185, 671
HphI GGTGA 6 cut(s) 74, 144, 472, 1039, 1054, 1203
Hpy188I TCNGA 2 cut(s) 664, 730
Hpy188III TCNNGA 9 cut(s) 74, 227, 419, 491, 531, 557, 578, 584, 1082
HpyAV CCTTC 4 cut(s) 59, 530, 602, 1135
HpyCH4IV ACGT 1 cut(s) 935
HpyCH4V TGCA 5 cut(s) 376, 409, 464, 676, 1058
HpyF10VI GCNNNNNNNGC 9 cut(s) 280, 323, 344, 365, 398, 451, 559, 568, 775
HpyF3I CTNAG 1 cut(s) 1273
HpySE526I ACGT 1 cut(s) 935
Hsp92II CATG 6 cut(s) 223, 380, 494, 560, 602, 911
Ksp22I TGATCA 1 cut(s) 511
Kzo9I GATC 5 cut(s) 4, 28, 511, 580, 900
LguI GCTCTTC 1 cut(s) 768
LmnI GCTCC 4 cut(s) 520, 766, 1049, 1162
LpnPI CCDG 2 cut(s) 198, 684
LweI GCATC 2 cut(s) 562, 1122
MaeI CTAG 4 cut(s) 356, 456, 779, 1161
MaeII ACGT 1 cut(s) 935
MaeIII GTNAC 1 cut(s) 110
MalI GATC 5 cut(s) 6, 30, 513, 582, 902
MboI GATC 5 cut(s) 4, 28, 511, 580, 900
MfeI CAATTG 2 cut(s) 308, 404
MflI RGATCY 1 cut(s) 900
MhlI GDGCHC 2 cut(s) 944, 1054
MlyI GAGTC 3 cut(s) 106, 838, 1276
MseI TTAA 6 cut(s) 794, 836, 954, 972, 1001, 1191
MslI CAYNNNNRTG 2 cut(s) 438, 846
MspCI CTTAAG 1 cut(s) 971
MspI CCGG 2 cut(s) 185, 671
MspR9I CCNGG 1 cut(s) 185
MunI CAATTG 2 cut(s) 308, 404
Mva1269I GAATGC 1 cut(s) 148
MwoI GCNNNNNNNGC 9 cut(s) 280, 323, 344, 365, 398, 451, 559, 568, 775
NciI CCSGG 1 cut(s) 185
NdeI CATATG 1 cut(s) 88
NdeII GATC 5 cut(s) 4, 28, 511, 580, 900
NlaIII CATG 6 cut(s) 223, 380, 494, 560, 602, 911
NlaIV GGNNCC 3 cut(s) 522, 669, 1158
NmeAIII GCCGAG 1 cut(s) 118
NspI RCATGY 2 cut(s) 223, 380
PaeI GCATGC 1 cut(s) 380
PagI TCATGA 2 cut(s) 490, 556
PciSI GCTCTTC 1 cut(s) 768
PctI GAATGC 1 cut(s) 148
PfeI GAWTC 3 cut(s) 500, 725, 1087
PflMI CCANNNNNTGG 1 cut(s) 1004
PinAI ACCGGT 1 cut(s) 670
PleI GAGTC 3 cut(s) 105, 837, 1275
PpsI GAGTC 3 cut(s) 105, 837, 1275
PsiI TTATAA 1 cut(s) 57
Psp1406I AACGTT 1 cut(s) 935
PspN4I GGNNCC 3 cut(s) 522, 669, 1158
PsuI RGATCY 1 cut(s) 900
RsaI GTAC 5 cut(s) 182, 209, 603, 951, 978
RsaNI GTAC 5 cut(s) 181, 208, 602, 950, 977
RseI CAYNNNNRTG 2 cut(s) 438, 846
SapI GCTCTTC 1 cut(s) 768
SaqAI TTAA 6 cut(s) 794, 836, 954, 972, 1001, 1191
Sau3AI GATC 5 cut(s) 4, 28, 511, 580, 900
SchI GAGTC 3 cut(s) 106, 838, 1276
ScrFI CCNGG 1 cut(s) 185
SduI GDGCHC 2 cut(s) 944, 1054
SfaNI GCATC 2 cut(s) 562, 1122
SmiMI CAYNNNNRTG 2 cut(s) 438, 846
SmlI CTYRAG 6 cut(s) 417, 449, 971, 1080, 1130, 1301
SmoI CTYRAG 6 cut(s) 417, 449, 971, 1080, 1130, 1301
SphI GCATGC 1 cut(s) 380
SspI AATATT 2 cut(s) 680, 1224
SspMI CTAG 4 cut(s) 356, 456, 779, 1161
StyD4I CCNGG 1 cut(s) 183
StyI CCWWGG 2 cut(s) 816, 918
TaiI ACGT 1 cut(s) 938
TaqI TCGA 2 cut(s) 7, 583
TatI WGTACW 3 cut(s) 207, 601, 949
TfiI GAWTC 3 cut(s) 500, 725, 1087
Tru1I TTAA 6 cut(s) 794, 836, 954, 972, 1001, 1191
Tru9I TTAA 6 cut(s) 794, 836, 954, 972, 1001, 1191
TspDTI ATGAA 4 cut(s) 587, 717, 732, 1216
TspGWI ACGGA 1 cut(s) 132
Van91I CCANNNNNTGG 1 cut(s) 1004
Vha464I CTTAAG 1 cut(s) 971
XapI RAATTY 1 cut(s) 629
XceI RCATGY 2 cut(s) 223, 380
XspI CTAG 4 cut(s) 356, 456, 779, 1161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.