Rmu_ssc0000398.1_g000023

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000398.1
OG0000195
Physical Location & Seq
Forward (+)
69751 .. 70851
1101 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000398.1_g000023.1.cds

Sequence Viewer

Length: 993 bp
atgggcatgtatcaagagacatttgtacccgaggcatatccacaagagcaagcttttgagcctcgaaagccatcacttgaagaacaactagctcaattggaagcctctaatgatcaattgcaagcctctcaagctcaatgtctagcttcccaagcccgattgcatgctaaattgcaagccttcaatgctcaattgcaagcttctcaagaaatgacttcacattccaatgagcaacttgatcctagttttgcacaagagccacccttcaccatttctcatgagcaagagtctttctttgaccaagtggagccttctttaagaggagtgcattatgagcatcacgagcaagaattgcctattcaagatcgagagagtgatgttcatgtacaagaaagtgtgcttggttatggaaatttggaagcaagtggtgaggaggaggcggagcttgaagaggtacaccatgatcccttaatccttgaggctgatattcccaaggaggaagagaatcctttaatgcactgtaatgataaagaagttcaagagacaagggttttctctcctcccacatccaaggagattcatcatgagattcccaaggtagagagtagaacattgagcacttatgttcttaatgagaaaattgagattaaagtacttttacctctcaatccaccattaagtggtcaatgcttctacaatgaggtgatggattggaaaggaagtggagcacttgcactcactatttcccatcacactcaagagtttctaccaccaattgttcctatgagaattatttctacgccacttgagaaggatgaggcaaggttggctcctagaagaaaaattgagaagaagagaaagattaagaagctgcacttttggtcaccaattgcaatattcatgggtagctcttggccttgcctctatgacatgtcaaggagtcccttagtcccaaacaatagggtggtcgcacttgaaaagtatccaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

330

Amino Acids

37.77

Weight (kDa)

5.04

Isoelectric Point (pI)

60.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 680
AciI CCGC 1 cut(s) 440
AclWI GGATC 2 cut(s) 233, 458
AcsI RAATTY 1 cut(s) 412
AfaI GTAC 4 cut(s) 27, 387, 456, 654
AfiI CCNNNNNNNGG 1 cut(s) 680
AflIII ACRYGT 1 cut(s) 930
AgsI TTSAA 6 cut(s) 80, 184, 362, 449, 539, 977
AjuI GAANNNNNNNTTGG 2 cut(s) 384, 416
AluBI AGCT 8 cut(s) 53, 92, 134, 146, 200, 445, 871, 909
AluI AGCT 8 cut(s) 53, 92, 134, 146, 200, 445, 871, 909
Alw21I GWGCWC 2 cut(s) 620, 730
Alw26I GTCTC 2 cut(s) 11, 536
AlwI GGATC 2 cut(s) 233, 458
Ama87I CYCGRG 1 cut(s) 29
AoxI GGCC 1 cut(s) 914
ApeKI GCWGC 1 cut(s) 871
ApoI RAATTY 1 cut(s) 412
Asp700I GAANNNNTTC 1 cut(s) 793
AsuHPI GGTGA 4 cut(s) 259, 440, 715, 876
AvaI CYCGRG 1 cut(s) 29
BaeI ACNNNNGTAYC 2 cut(s) 9, 42
BauI CACGAG 1 cut(s) 341
Bbv12I GWGCWC 2 cut(s) 620, 730
BbvI GCAGC 1 cut(s) 858
BccI CCATC 3 cut(s) 79, 700, 756
BciVI GTATCC 1 cut(s) 993
BclI TGATCA 1 cut(s) 112
BcoDI GTCTC 2 cut(s) 11, 536
BfaI CTAG 4 cut(s) 89, 143, 243, 834
BfuI GTATCC 1 cut(s) 993
BisI GCNGC 1 cut(s) 872
BlsI GCNGC 1 cut(s) 873
BmcAI AGTACT 1 cut(s) 654
BmeT110I CYCGRG 1 cut(s) 29
BmiI GGNNCC 2 cut(s) 309, 831
BmsI GCATC 1 cut(s) 346
BpuEI CTTGAG 5 cut(s) 114, 189, 497, 741, 827
BsaJI CCNNGG 4 cut(s) 30, 492, 570, 594
Bsc4I CCNNNNNNNGG 1 cut(s) 680
BseDI CCNNGG 4 cut(s) 30, 492, 570, 594
BseGI GGATG 2 cut(s) 566, 820
BseLI CCNNNNNNNGG 1 cut(s) 680
BseRI GAGGAG 4 cut(s) 336, 446, 449, 549
BseXI GCAGC 1 cut(s) 858
BsgI GTGCAG 1 cut(s) 857
BshFI GGCC 1 cut(s) 916
BsiHKAI GWGCWC 2 cut(s) 620, 730
BsiHKCI CYCGRG 1 cut(s) 29
BslFI GGGAC 2 cut(s) 927, 935
BslI CCNNNNNNNGG 1 cut(s) 680
BsmAI GTCTC 2 cut(s) 11, 536
BsmFI GGGAC 2 cut(s) 927, 935
BsnI GGCC 1 cut(s) 916
BsoBI CYCGRG 1 cut(s) 29
Bsp1286I GDGCHC 2 cut(s) 620, 730
Bsp1407I TGTACA 1 cut(s) 385
Bsp143I GATC 4 cut(s) 112, 238, 364, 463
BspACI CCGC 1 cut(s) 440
BspANI GGCC 1 cut(s) 916
BspHI TCATGA 2 cut(s) 277, 583
BspLI GGNNCC 2 cut(s) 309, 831
BspPI GGATC 2 cut(s) 233, 458
BsrGI TGTACA 1 cut(s) 385
BssECI CCNNGG 4 cut(s) 30, 492, 570, 594
BssMI GATC 4 cut(s) 112, 238, 364, 463
BssSI CACGAG 1 cut(s) 341
BssT1I CCWWGG 3 cut(s) 492, 570, 594
Bst2BI CACGAG 1 cut(s) 341
Bst4CI ACNGT 1 cut(s) 521
Bst6I CTCTTC 3 cut(s) 444, 495, 848
BstAPI GCANNNNNTGC 1 cut(s) 352
BstAUI TGTACA 1 cut(s) 385
BstC8I GCNNGC 5 cut(s) 51, 123, 165, 177, 198
BstDEI CTNAG 1 cut(s) 946
BstEII GGTNACC 1 cut(s) 882
BstF5I GGATG 2 cut(s) 566, 820
BstKTI GATC 4 cut(s) 115, 241, 367, 466
BstMAI GTCTC 2 cut(s) 11, 536
BstMBI GATC 4 cut(s) 112, 238, 364, 463
BstMWI GCNNNNNNNGC 8 cut(s) 67, 131, 152, 185, 334, 343, 352, 827
BstNSI RCATGY 3 cut(s) 10, 167, 934
BstPI GGTNACC 1 cut(s) 882
BstV1I GCAGC 1 cut(s) 858
BsuI GTATCC 1 cut(s) 993
BsuRI GGCC 1 cut(s) 916
BtsCI GGATG 2 cut(s) 566, 820
BtsIMutI CAGTG 1 cut(s) 517
Cac8I GCNNGC 5 cut(s) 51, 123, 165, 177, 198
CciI TCATGA 2 cut(s) 277, 583
Csp6I GTAC 4 cut(s) 26, 386, 455, 653
CviAII CATG 8 cut(s) 7, 164, 278, 383, 461, 584, 901, 931
CviQI GTAC 4 cut(s) 26, 386, 455, 653
DdeI CTNAG 1 cut(s) 946
DpnI GATC 4 cut(s) 114, 240, 366, 465
DpnII GATC 4 cut(s) 112, 238, 364, 463
Eam1104I CTCTTC 3 cut(s) 444, 495, 848
EarI CTCTTC 3 cut(s) 444, 495, 848
EciI GGCGGA 1 cut(s) 455
Eco130I CCWWGG 3 cut(s) 492, 570, 594
Eco88I CYCGRG 1 cut(s) 29
Eco91I GGTNACC 1 cut(s) 882
EcoO65I GGTNACC 1 cut(s) 882
EcoT14I CCWWGG 3 cut(s) 492, 570, 594
ErhI CCWWGG 3 cut(s) 492, 570, 594
FaeI CATG 8 cut(s) 10, 167, 281, 386, 464, 587, 904, 934
FalI AAGNNNNNCTT 2 cut(s) 860, 892
FaqI GGGAC 2 cut(s) 927, 935
FatI CATG 8 cut(s) 6, 163, 277, 382, 460, 583, 900, 930
FbaI TGATCA 1 cut(s) 112
Fnu4HI GCNGC 1 cut(s) 872
FokI GGATG 2 cut(s) 553, 827
Fsp4HI GCNGC 1 cut(s) 872
FspBI CTAG 4 cut(s) 89, 143, 243, 834
GluI GCNGC 1 cut(s) 872
HaeIII GGCC 1 cut(s) 916
Hin1II CATG 8 cut(s) 10, 167, 281, 386, 464, 587, 904, 934
HindIII AAGCTT 2 cut(s) 51, 198
HinfI GANTC 5 cut(s) 287, 505, 577, 589, 940
HphI GGTGA 4 cut(s) 259, 440, 715, 876
Hpy166II GTNNAC 1 cut(s) 457
Hpy188III TCNNGA 9 cut(s) 14, 206, 278, 341, 362, 368, 539, 584, 758
Hpy8I GTNNAC 1 cut(s) 457
HpyAV CCTTC 4 cut(s) 190, 274, 321, 805
HpyCH4III ACNGT 1 cut(s) 521
HpyF10VI GCNNNNNNNGC 8 cut(s) 67, 131, 152, 185, 334, 343, 352, 827
HpyF3I CTNAG 1 cut(s) 946
Hsp92II CATG 8 cut(s) 10, 167, 281, 386, 464, 587, 904, 934
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 4 cut(s) 112, 238, 364, 463
LmnI GCTCC 4 cut(s) 307, 442, 725, 835
Lsp1109I GCAGC 1 cut(s) 858
LweI GCATC 1 cut(s) 346
MaeI CTAG 4 cut(s) 89, 143, 243, 834
MaeIII GTNAC 1 cut(s) 882
MalI GATC 4 cut(s) 114, 240, 366, 465
MboI GATC 4 cut(s) 112, 238, 364, 463
MboII GAAGA 6 cut(s) 92, 461, 512, 849, 862, 865
MfeI CAATTG 5 cut(s) 95, 116, 191, 774, 888
MhlI GDGCHC 2 cut(s) 620, 730
MlyI GAGTC 2 cut(s) 296, 949
MroXI GAANNNNTTC 1 cut(s) 793
MseI TTAA 7 cut(s) 317, 470, 512, 630, 648, 677, 864
MslI CAYNNNNRTG 2 cut(s) 225, 522
MunI CAATTG 5 cut(s) 95, 116, 191, 774, 888
MwoI GCNNNNNNNGC 8 cut(s) 67, 131, 152, 185, 334, 343, 352, 827
NdeII GATC 4 cut(s) 112, 238, 364, 463
NlaIII CATG 8 cut(s) 10, 167, 281, 386, 464, 587, 904, 934
NlaIV GGNNCC 2 cut(s) 309, 831
NmuCI GTSAC 1 cut(s) 882
NspI RCATGY 3 cut(s) 10, 167, 934
PaeI GCATGC 1 cut(s) 167
PagI TCATGA 2 cut(s) 277, 583
PciI ACATGT 1 cut(s) 930
PdmI GAANNNNTTC 1 cut(s) 793
PfeI GAWTC 3 cut(s) 505, 577, 589
PflMI CCANNNNNTGG 1 cut(s) 680
PkrI GCNGC 1 cut(s) 873
PleI GAGTC 2 cut(s) 295, 948
PpsI GAGTC 2 cut(s) 295, 948
PscI ACATGT 1 cut(s) 930
PspEI GGTNACC 1 cut(s) 882
PspN4I GGNNCC 2 cut(s) 309, 831
RsaI GTAC 4 cut(s) 27, 387, 456, 654
RsaNI GTAC 4 cut(s) 26, 386, 455, 653
RseI CAYNNNNRTG 2 cut(s) 225, 522
SaqAI TTAA 7 cut(s) 317, 470, 512, 630, 648, 677, 864
SatI GCNGC 1 cut(s) 872
Sau3AI GATC 4 cut(s) 112, 238, 364, 463
ScaI AGTACT 1 cut(s) 654
SchI GAGTC 2 cut(s) 296, 949
SduI GDGCHC 2 cut(s) 620, 730
SfaNI GCATC 1 cut(s) 346
SmiMI CAYNNNNRTG 2 cut(s) 225, 522
SmlI CTYRAG 5 cut(s) 129, 204, 476, 756, 806
SmoI CTYRAG 5 cut(s) 129, 204, 476, 756, 806
SphI GCATGC 1 cut(s) 167
SsiI CCGC 1 cut(s) 440
SspI AATATT 1 cut(s) 897
SspMI CTAG 4 cut(s) 89, 143, 243, 834
StyI CCWWGG 3 cut(s) 492, 570, 594
TaaI ACNGT 1 cut(s) 521
TaqI TCGA 2 cut(s) 64, 367
TatI WGTACW 2 cut(s) 385, 652
TfiI GAWTC 3 cut(s) 505, 577, 589
Tru1I TTAA 7 cut(s) 317, 470, 512, 630, 648, 677, 864
Tru9I TTAA 7 cut(s) 317, 470, 512, 630, 648, 677, 864
TscAI CASTG 1 cut(s) 524
TseFI GTSAC 1 cut(s) 882
TseI GCWGC 1 cut(s) 871
Tsp45I GTSAC 1 cut(s) 882
TspDTI ATGAA 3 cut(s) 371, 569, 889
TspRI CASTG 1 cut(s) 524
Van91I CCANNNNNTGG 1 cut(s) 680
XapI RAATTY 1 cut(s) 412
XceI RCATGY 3 cut(s) 10, 167, 934
XmnI GAANNNNTTC 1 cut(s) 793
XspI CTAG 4 cut(s) 89, 143, 243, 834
ZrmI AGTACT 1 cut(s) 654
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.