Rmu_sc0001939.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001939.1
OG0000195
Physical Location & Seq
Reverse (-)
9736 .. 10839
1104 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001939.1_g000003.1.cds

Sequence Viewer

Length: 1035 bp
atggtgtctgaaggatatccacatgagcaagcgtatgagtctaggaagccttctcttgaagaattgctagctcaattgcaagcgtcccaagctcgattgcaagcttctcaagaaatacttatacataccaatgagcaacttgagactagtcttgcacaagagccaccattcaccatttatgagcatgaatctttctttgaccaagtggagcctatttcaagagaagaagtgtatattgagcatcttgagcaagaatcctttatgcaagttgaaaatgatgatagtgatgttgatgtacaagaaattgagcttggttatgaaagtttcaatgcaagtgaggtgagagactacactttggaggaatgggtgcaatattggaaatctaagcttccaaatggaggagagatatttgaagatgattccgaagaagatgatgtcttgtctagtgaggaggatgcagagcttgaattcatcgaggaggatgcagagcttcaagtcatataccataatcctttattcattgaggttaatgttcccaaggaggaagagagtccttcaatactttgtgattgtcaagaaattgaagagccaaagactttcttgcctcccaaatccatagagatccttcatgagcttcccaaggtggagagtagaacattgagcacttatgtttttaatgagaggattgggatcaaggtacttttacctctcaatccaccattaagtggtcaatgtttctacaatgaggtgatggattggaaaggaaaacttgcactcaacccttcccgtcatactcaagagcttctaccacctattattcctatgagcatcatttctacaccacttgaaaaggagaaggtaaggatattggctcctagaagaaaaattgagaagaagaggaaaattaagaagctacacttttgctcgccatttggaatattcataggtagttcttggtcttgcctctatgatacatcaaggagtccattagcgccgaacaatagggtggtcatacttgagaagtatccaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

344

Amino Acids

39.86

Weight (kDa)

4.53

Isoelectric Point (pI)

71.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 725
AclWI GGATC 2 cut(s) 616, 698
AcsI RAATTY 1 cut(s) 467
AcuI CTGAAG 1 cut(s) 30
AfaI GTAC 2 cut(s) 297, 699
AfiI CCNNNNNNNGG 2 cut(s) 398, 725
AhlI ACTAGT 1 cut(s) 146
AjuI GAANNNNNNNTTGG 2 cut(s) 294, 326
Alw21I GWGCWC 1 cut(s) 665
Alw26I GTCTC 2 cut(s) 137, 339
AlwI GGATC 2 cut(s) 616, 698
ApoI RAATTY 1 cut(s) 467
AspLEI GCGC 1 cut(s) 994
AsuHPI GGTGA 3 cut(s) 163, 352, 760
AsuNHI GCTAGC 1 cut(s) 67
Bbv12I GWGCWC 1 cut(s) 665
BccI CCATC 1 cut(s) 745
BcgI CGANNNNNNTGC 2 cut(s) 464, 498
BciVI GTATCC 1 cut(s) 1035
BcoDI GTCTC 2 cut(s) 137, 339
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 5 cut(s) 42, 68, 147, 444, 876
BfoI RGCGCY 1 cut(s) 995
BfuI GTATCC 1 cut(s) 1035
BmiI GGNNCC 2 cut(s) 210, 873
BmsI GCATC 4 cut(s) 250, 445, 472, 837
BmtI GCTAGC 1 cut(s) 71
BpuEI CTTGAG 4 cut(s) 93, 161, 266, 780
BsaBI GATNNNNATC 1 cut(s) 689
BsaJI CCNNGG 2 cut(s) 537, 639
Bsc4I CCNNNNNNNGG 2 cut(s) 398, 725
Bse8I GATNNNNATC 1 cut(s) 689
BseDI CCNNGG 2 cut(s) 537, 639
BseGI GGATG 2 cut(s) 460, 487
BseJI GATNNNNATC 1 cut(s) 689
BseLI CCNNNNNNNGG 2 cut(s) 398, 725
BseRI GAGGAG 3 cut(s) 414, 464, 491
BsiHKAI GWGCWC 1 cut(s) 665
BslFI GGGAC 1 cut(s) 70
BslI CCNNNNNNNGG 2 cut(s) 398, 725
BsmAI GTCTC 2 cut(s) 137, 339
BsmFI GGGAC 1 cut(s) 70
Bsp1286I GDGCHC 1 cut(s) 665
Bsp1407I TGTACA 1 cut(s) 295
Bsp143I GATC 2 cut(s) 621, 690
BspHI TCATGA 1 cut(s) 628
BspLI GGNNCC 2 cut(s) 210, 873
BspOI GCTAGC 1 cut(s) 71
BspPI GGATC 2 cut(s) 616, 698
BspQI GCTCTTC 1 cut(s) 579
BsrGI TGTACA 1 cut(s) 295
BssECI CCNNGG 2 cut(s) 537, 639
BssMI GATC 2 cut(s) 621, 690
BssT1I CCWWGG 2 cut(s) 537, 639
Bst6I CTCTTC 3 cut(s) 540, 579, 890
BstAUI TGTACA 1 cut(s) 295
BstC8I GCNNGC 5 cut(s) 30, 69, 81, 102, 926
BstDEI CTNAG 1 cut(s) 384
BstF5I GGATG 2 cut(s) 460, 487
BstH2I RGCGCY 1 cut(s) 995
BstHHI GCGC 1 cut(s) 994
BstKTI GATC 2 cut(s) 624, 693
BstMAI GTCTC 2 cut(s) 137, 339
BstMBI GATC 2 cut(s) 621, 690
BstMWI GCNNNNNNNGC 2 cut(s) 89, 247
BstX2I RGATCY 1 cut(s) 621
BstYI RGATCY 1 cut(s) 621
BsuI GTATCC 1 cut(s) 1035
BtsCI GGATG 2 cut(s) 460, 487
Cac8I GCNNGC 5 cut(s) 30, 69, 81, 102, 926
CciI TCATGA 1 cut(s) 628
CfoI GCGC 1 cut(s) 994
CseI GACGC 1 cut(s) 72
Csp6I GTAC 2 cut(s) 296, 698
CviAII CATG 3 cut(s) 23, 185, 629
CviQI GTAC 2 cut(s) 296, 698
DdeI CTNAG 1 cut(s) 384
DpnI GATC 2 cut(s) 623, 692
DpnII GATC 2 cut(s) 621, 690
Eam1104I CTCTTC 3 cut(s) 540, 579, 890
EarI CTCTTC 3 cut(s) 540, 579, 890
Eco130I CCWWGG 2 cut(s) 537, 639
Eco32I GATATC 1 cut(s) 17
Eco57I CTGAAG 1 cut(s) 30
EcoRI GAATTC 1 cut(s) 467
EcoRV GATATC 1 cut(s) 17
EcoT14I CCWWGG 2 cut(s) 537, 639
ErhI CCWWGG 2 cut(s) 537, 639
FaeI CATG 3 cut(s) 26, 188, 632
FalI AAGNNNNNCTT 8 cut(s) 102, 134, 584, 616, 753, 785, 902, 934
FaqI GGGAC 1 cut(s) 70
FatI CATG 3 cut(s) 22, 184, 628
FokI GGATG 2 cut(s) 467, 494
FspBI CTAG 5 cut(s) 42, 68, 147, 444, 876
GlaI GCGC 1 cut(s) 993
HaeII RGCGCY 1 cut(s) 995
HgaI GACGC 1 cut(s) 72
HhaI GCGC 1 cut(s) 994
Hin1II CATG 3 cut(s) 26, 188, 632
Hin6I GCGC 1 cut(s) 992
HinP1I GCGC 1 cut(s) 992
HindIII AAGCTT 2 cut(s) 102, 386
HinfI GANTC 6 cut(s) 38, 188, 254, 419, 550, 982
HphI GGTGA 3 cut(s) 163, 352, 760
Hpy188I TCNGA 2 cut(s) 10, 424
Hpy188III TCNNGA 7 cut(s) 56, 110, 219, 245, 575, 629, 797
HpyAV CCTTC 6 cut(s) 5, 60, 564, 635, 792, 850
HpyCH4V TGCA 9 cut(s) 79, 100, 155, 265, 332, 370, 458, 485, 773
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 247
HpyF3I CTNAG 1 cut(s) 384
Hsp92II CATG 3 cut(s) 26, 188, 632
HspAI GCGC 1 cut(s) 992
Kzo9I GATC 2 cut(s) 621, 690
LguI GCTCTTC 1 cut(s) 579
LmnI GCTCC 2 cut(s) 208, 877
LweI GCATC 4 cut(s) 250, 445, 472, 837
MaeI CTAG 5 cut(s) 42, 68, 147, 444, 876
MalI GATC 2 cut(s) 623, 692
MboI GATC 2 cut(s) 621, 690
MfeI CAATTG 1 cut(s) 74
MflI RGATCY 1 cut(s) 621
MhlI GDGCHC 1 cut(s) 665
MluCI AATT 7 cut(s) 62, 74, 303, 467, 579, 885, 903
MlyI GAGTC 3 cut(s) 47, 559, 991
MseI TTAA 4 cut(s) 528, 675, 722, 906
MslI CAYNNNNRTG 1 cut(s) 129
MunI CAATTG 1 cut(s) 74
MwoI GCNNNNNNNGC 2 cut(s) 89, 247
NdeII GATC 2 cut(s) 621, 690
NheI GCTAGC 1 cut(s) 67
NlaIII CATG 3 cut(s) 26, 188, 632
NlaIV GGNNCC 2 cut(s) 210, 873
PagI TCATGA 1 cut(s) 628
PciSI GCTCTTC 1 cut(s) 579
PfeI GAWTC 3 cut(s) 188, 254, 419
PflMI CCANNNNNTGG 1 cut(s) 725
PleI GAGTC 3 cut(s) 46, 558, 990
PpsI GAGTC 3 cut(s) 46, 558, 990
PspN4I GGNNCC 2 cut(s) 210, 873
PsuI RGATCY 1 cut(s) 621
RsaI GTAC 2 cut(s) 297, 699
RsaNI GTAC 2 cut(s) 296, 698
RseI CAYNNNNRTG 1 cut(s) 129
SapI GCTCTTC 1 cut(s) 579
SaqAI TTAA 4 cut(s) 528, 675, 722, 906
Sau3AI GATC 2 cut(s) 621, 690
SchI GAGTC 3 cut(s) 47, 559, 991
SduI GDGCHC 1 cut(s) 665
SfaNI GCATC 4 cut(s) 250, 445, 472, 837
SmiMI CAYNNNNRTG 1 cut(s) 129
SmlI CTYRAG 5 cut(s) 108, 140, 245, 795, 1016
SmoI CTYRAG 5 cut(s) 108, 140, 245, 795, 1016
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 7 cut(s) 62, 74, 303, 467, 579, 885, 903
SspI AATATT 2 cut(s) 374, 939
SspMI CTAG 5 cut(s) 42, 68, 147, 444, 876
StyI CCWWGG 2 cut(s) 537, 639
TaqI TCGA 2 cut(s) 94, 474
TasI AATT 7 cut(s) 62, 74, 303, 467, 579, 885, 903
TatI WGTACW 1 cut(s) 295
TfiI GAWTC 3 cut(s) 188, 254, 419
Tru1I TTAA 4 cut(s) 528, 675, 722, 906
Tru9I TTAA 4 cut(s) 528, 675, 722, 906
TspDTI ATGAA 6 cut(s) 201, 333, 460, 508, 617, 931
Van91I CCANNNNNTGG 1 cut(s) 725
XapI RAATTY 1 cut(s) 467
XspI CTAG 5 cut(s) 42, 68, 147, 444, 876
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.