Rmu_sc0001630.1_g000013

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001630.1
OG0000195
Physical Location & Seq
Forward (+)
87381 .. 88448
1068 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001630.1_g000013.1.cds

Sequence Viewer

Length: 1068 bp
atgagcaacaaagtttctatagtggaggttatcaagaatggaatacatatgccaagagtcctatgccttgttacaaccaagcttatgccttgttacaaccaagcttgtgccttgtgtaattctccgtggcattcaccatttgagtgttctttgagatttgaatacccggattttatgcaagagtatgagtacaagatggggatgtataaagagacatgtgtacccgaagcatatccacaaaagcaagcttttgagcctaggaagccatcacttgaagaacaacttgctcaattggaagcctccaatgctcaattgcaagcctcccaagctcaatgtctagcctcccaagctcggttgcatgctaaattggaagccttcaatgctcaattgcaagcttctcaagaaatgatttcacattacaatgagcaacttgagcctagtcttgcacaagagtcaccattcaccatttgtcatgagcaagattctttctttgatcaagtggagcccaattcaagagaaggagtatattttaagcatcatgagcaagagttgcctcttcaagatcgagagagtgatgttcatgtacaagaaagtgtgcttggttatggaaatttggaagcaagtgggttgagagactacacttcggaggaatcggtgcaatattggaaatctgatcttcacaatgaagaagagaaatatgaagatgattccgaagaagaggatagcttgtttagtgaggaggatgtggagcttgaagacttagaccatattcccttaattgttgaggccgatattcctaaggaggaagaaaatccttcaataccttgtgatgatgaagaaattgaagagcctaggactttctctcctcccatatccattgagatccatcatgagcttcccaaggtggagagtagaacgttgaacacttatgtacttaatgaaaagattgagcttaaggtacttctacctctcaatccaccgtttagtgatcaatgtttctacaatgaggtgatgtattggaaaggaattggagcacttgcactcaacctttcccatcactctcaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

355

Amino Acids

41.0

Weight (kDa)

4.48

Isoelectric Point (pI)

68.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 917
AclWI GGATC 1 cut(s) 877
AcsI RAATTY 1 cut(s) 610
AfaI GTAC 5 cut(s) 191, 222, 585, 933, 960
AfiI CCNNNNNNNGG 1 cut(s) 351
AflII CTTAAG 1 cut(s) 953
AflIII ACRYGT 1 cut(s) 215
AgsI TTSAA 9 cut(s) 161, 275, 379, 513, 560, 755, 819, 845, 922
AjuI GAANNNNNNNTTGG 2 cut(s) 582, 614
Alw21I GWGCWC 1 cut(s) 1036
Alw26I GTCTC 2 cut(s) 206, 627
AlwI GGATC 1 cut(s) 877
AoxI GGCC 1 cut(s) 786
ApoI RAATTY 1 cut(s) 610
AspA2I CCTAGG 2 cut(s) 257, 851
AsuC2I CCSGG 1 cut(s) 167
AsuHPI GGTGA 4 cut(s) 126, 447, 454, 1021
AvrII CCTAGG 2 cut(s) 257, 851
AxyI CCTNAGG 1 cut(s) 798
BaeI ACNNNNGTAYC 2 cut(s) 204, 237
BanII GRGCYC 1 cut(s) 507
BbsI GAAGAC 1 cut(s) 762
Bbv12I GWGCWC 1 cut(s) 1036
BccI CCATC 4 cut(s) 190, 274, 894, 1062
BclI TGATCA 2 cut(s) 493, 988
BcnI CCSGG 1 cut(s) 167
BcoDI GTCTC 2 cut(s) 206, 627
BfaI CTAG 4 cut(s) 258, 338, 438, 852
BfmI CTRYAG 1 cut(s) 18
BfrI CTTAAG 1 cut(s) 953
BlnI CCTAGG 2 cut(s) 257, 851
Bme1390I CCNGG 1 cut(s) 167
BmiI GGNNCC 1 cut(s) 504
BmrFI CCNGG 1 cut(s) 167
BmsI GCATC 1 cut(s) 544
BpiI GAAGAC 1 cut(s) 762
BpuEI CTTGAG 2 cut(s) 384, 452
BpuMI CCSGG 1 cut(s) 167
BsaJI CCNNGG 4 cut(s) 125, 257, 851, 900
BsaXI ACNNNNNCTCC 2 cut(s) 847, 877
Bsc4I CCNNNNNNNGG 1 cut(s) 351
Bse21I CCTNAGG 1 cut(s) 798
BseDI CCNNGG 4 cut(s) 125, 257, 851, 900
BseGI GGATG 2 cut(s) 207, 748
BseLI CCNNNNNNNGG 1 cut(s) 351
BseRI GAGGAG 2 cut(s) 752, 855
BshFI GGCC 1 cut(s) 788
BsiHKAI GWGCWC 1 cut(s) 1036
BsiSI CCGG 1 cut(s) 167
BslI CCNNNNNNNGG 1 cut(s) 351
BsmAI GTCTC 2 cut(s) 206, 627
BsmI GAATGC 1 cut(s) 130
BsnI GGCC 1 cut(s) 788
Bsp1286I GDGCHC 2 cut(s) 507, 1036
Bsp1407I TGTACA 1 cut(s) 583
Bsp143I GATC 5 cut(s) 493, 562, 673, 882, 988
BspANI GGCC 1 cut(s) 788
BspHI TCATGA 3 cut(s) 472, 538, 889
BspLI GGNNCC 1 cut(s) 504
BspPI GGATC 1 cut(s) 877
BspQI GCTCTTC 1 cut(s) 840
BspTI CTTAAG 1 cut(s) 953
BsrGI TGTACA 1 cut(s) 583
BssECI CCNNGG 4 cut(s) 125, 257, 851, 900
BssMI GATC 5 cut(s) 493, 562, 673, 882, 988
BssT1I CCWWGG 3 cut(s) 257, 851, 900
Bst4CI ACNGT 1 cut(s) 981
Bst6I CTCTTC 4 cut(s) 561, 684, 711, 840
BstAFI CTTAAG 1 cut(s) 953
BstAPI GCANNNNNTGC 1 cut(s) 550
BstAUI TGTACA 1 cut(s) 583
BstC8I GCNNGC 4 cut(s) 246, 318, 360, 393
BstDEI CTNAG 2 cut(s) 760, 798
BstDSI CCRYGG 1 cut(s) 125
BstF5I GGATG 2 cut(s) 207, 748
BstKTI GATC 5 cut(s) 496, 565, 676, 885, 991
BstMAI GTCTC 2 cut(s) 206, 627
BstMBI GATC 5 cut(s) 493, 562, 673, 882, 988
BstMWI GCNNNNNNNGC 8 cut(s) 262, 305, 326, 347, 380, 433, 541, 550
BstNSI RCATGY 2 cut(s) 219, 362
BstSCI CCNGG 1 cut(s) 165
BstSFI CTRYAG 1 cut(s) 18
BstV2I GAAGAC 1 cut(s) 762
BstX2I RGATCY 1 cut(s) 882
BstYI RGATCY 1 cut(s) 882
Bsu36I CCTNAGG 1 cut(s) 798
BsuRI GGCC 1 cut(s) 788
BtgI CCRYGG 1 cut(s) 125
BtsCI GGATG 2 cut(s) 207, 748
Cac8I GCNNGC 4 cut(s) 246, 318, 360, 393
CciI TCATGA 3 cut(s) 472, 538, 889
Csp6I GTAC 5 cut(s) 190, 221, 584, 932, 959
CviAII CATG 6 cut(s) 216, 359, 473, 539, 581, 890
CviQI GTAC 5 cut(s) 190, 221, 584, 932, 959
DdeI CTNAG 2 cut(s) 760, 798
DpnI GATC 5 cut(s) 495, 564, 675, 884, 990
DpnII GATC 5 cut(s) 493, 562, 673, 882, 988
Eam1104I CTCTTC 4 cut(s) 561, 684, 711, 840
EarI CTCTTC 4 cut(s) 561, 684, 711, 840
Eco130I CCWWGG 3 cut(s) 257, 851, 900
Eco24I GRGCYC 1 cut(s) 507
Eco81I CCTNAGG 1 cut(s) 798
EcoT14I CCWWGG 3 cut(s) 257, 851, 900
EcoT38I GRGCYC 1 cut(s) 507
ErhI CCWWGG 3 cut(s) 257, 851, 900
FaeI CATG 6 cut(s) 219, 362, 476, 542, 584, 893
FalI AAGNNNNNCTT 2 cut(s) 267, 299
FatI CATG 6 cut(s) 215, 358, 472, 538, 580, 889
FauNDI CATATG 1 cut(s) 48
FbaI TGATCA 2 cut(s) 493, 988
FokI GGATG 2 cut(s) 214, 755
FriOI GRGCYC 1 cut(s) 507
FspBI CTAG 4 cut(s) 258, 338, 438, 852
HaeIII GGCC 1 cut(s) 788
HapII CCGG 1 cut(s) 167
Hin1II CATG 6 cut(s) 219, 362, 476, 542, 584, 893
HindIII AAGCTT 4 cut(s) 80, 102, 246, 393
HinfI GANTC 5 cut(s) 57, 452, 482, 650, 707
HpaII CCGG 1 cut(s) 167
HphI GGTGA 4 cut(s) 126, 447, 454, 1021
Hpy166II GTNNAC 1 cut(s) 221
Hpy188I TCNGA 3 cut(s) 646, 673, 712
Hpy188III TCNNGA 8 cut(s) 34, 401, 473, 513, 539, 560, 566, 890
Hpy8I GTNNAC 1 cut(s) 221
HpyAV CCTTC 3 cut(s) 385, 512, 825
HpyCH4III ACNGT 1 cut(s) 981
HpyCH4IV ACGT 1 cut(s) 917
HpyCH4V TGCA 7 cut(s) 178, 316, 358, 391, 446, 658, 1040
HpyF10VI GCNNNNNNNGC 8 cut(s) 262, 305, 326, 347, 380, 433, 541, 550
HpyF3I CTNAG 2 cut(s) 760, 798
HpySE526I ACGT 1 cut(s) 917
Hsp92II CATG 6 cut(s) 219, 362, 476, 542, 584, 893
Ksp22I TGATCA 2 cut(s) 493, 988
Kzo9I GATC 5 cut(s) 493, 562, 673, 882, 988
LguI GCTCTTC 1 cut(s) 840
LmnI GCTCC 3 cut(s) 502, 748, 1031
LpnPI CCDG 1 cut(s) 180
LweI GCATC 1 cut(s) 544
MaeI CTAG 4 cut(s) 258, 338, 438, 852
MaeII ACGT 1 cut(s) 917
MaeIII GTNAC 3 cut(s) 70, 92, 453
MalI GATC 5 cut(s) 495, 564, 675, 884, 990
MboI GATC 5 cut(s) 493, 562, 673, 882, 988
MfeI CAATTG 3 cut(s) 290, 311, 386
MflI RGATCY 1 cut(s) 882
MhlI GDGCHC 2 cut(s) 507, 1036
MlyI GAGTC 2 cut(s) 66, 461
MseI TTAA 4 cut(s) 531, 776, 936, 954
MslI CAYNNNNRTG 2 cut(s) 142, 420
MspCI CTTAAG 1 cut(s) 953
MspI CCGG 1 cut(s) 167
MspR9I CCNGG 1 cut(s) 167
MunI CAATTG 3 cut(s) 290, 311, 386
Mva1269I GAATGC 1 cut(s) 130
MwoI GCNNNNNNNGC 8 cut(s) 262, 305, 326, 347, 380, 433, 541, 550
NciI CCSGG 1 cut(s) 167
NdeI CATATG 1 cut(s) 48
NdeII GATC 5 cut(s) 493, 562, 673, 882, 988
NlaIII CATG 6 cut(s) 219, 362, 476, 542, 584, 893
NlaIV GGNNCC 1 cut(s) 504
NmuCI GTSAC 1 cut(s) 453
NspI RCATGY 2 cut(s) 219, 362
PaeI GCATGC 1 cut(s) 362
PagI TCATGA 3 cut(s) 472, 538, 889
PciI ACATGT 1 cut(s) 215
PciSI GCTCTTC 1 cut(s) 840
PctI GAATGC 1 cut(s) 130
PfeI GAWTC 3 cut(s) 482, 650, 707
PleI GAGTC 2 cut(s) 65, 460
PpsI GAGTC 2 cut(s) 65, 460
PscI ACATGT 1 cut(s) 215
Psp1406I AACGTT 1 cut(s) 917
PspN4I GGNNCC 1 cut(s) 504
PsuI RGATCY 1 cut(s) 882
RsaI GTAC 5 cut(s) 191, 222, 585, 933, 960
RsaNI GTAC 5 cut(s) 190, 221, 584, 932, 959
RseI CAYNNNNRTG 2 cut(s) 142, 420
SapI GCTCTTC 1 cut(s) 840
SaqAI TTAA 4 cut(s) 531, 776, 936, 954
Sau3AI GATC 5 cut(s) 493, 562, 673, 882, 988
SchI GAGTC 2 cut(s) 66, 461
ScrFI CCNGG 1 cut(s) 167
SduI GDGCHC 2 cut(s) 507, 1036
SfaNI GCATC 1 cut(s) 544
SfcI CTRYAG 1 cut(s) 18
SmiMI CAYNNNNRTG 2 cut(s) 142, 420
SmlI CTYRAG 3 cut(s) 399, 431, 953
SmoI CTYRAG 3 cut(s) 399, 431, 953
SphI GCATGC 1 cut(s) 362
SspI AATATT 1 cut(s) 662
SspMI CTAG 4 cut(s) 258, 338, 438, 852
StyD4I CCNGG 1 cut(s) 165
StyI CCWWGG 3 cut(s) 257, 851, 900
TaaI ACNGT 1 cut(s) 981
TaiI ACGT 1 cut(s) 920
TaqI TCGA 1 cut(s) 565
TatI WGTACW 3 cut(s) 189, 583, 931
TfiI GAWTC 3 cut(s) 482, 650, 707
Tru1I TTAA 4 cut(s) 531, 776, 936, 954
Tru9I TTAA 4 cut(s) 531, 776, 936, 954
TseFI GTSAC 1 cut(s) 453
Tsp45I GTSAC 1 cut(s) 453
TspDTI ATGAA 5 cut(s) 569, 699, 714, 849, 954
TspGWI ACGGA 1 cut(s) 114
Vha464I CTTAAG 1 cut(s) 953
XapI RAATTY 1 cut(s) 610
XceI RCATGY 2 cut(s) 219, 362
XmaJI CCTAGG 2 cut(s) 257, 851
XspI CTAG 4 cut(s) 258, 338, 438, 852
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.