Rmu_sc0002799.1_g000012

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002799.1
OG0000195
Physical Location & Seq
Reverse (-)
81791 .. 83182
1392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002799.1_g000012.1.cds

Sequence Viewer

Length: 1392 bp
atggatcggtggaactatggatggaaagacccatggggatgtgagcaagaaagtttttatggtggaggtcatcaagtgtggaattctcatgcggcgggttctatgtcctcttgcaatgaaatttgtgctttgtgtaattctccttggcattcaccttttgagtgctctttgagatttgagtgcccgaattttatgcaagagcgtgagtacacgatagacatgtatcaagagacatttgtacccgacgcatatccacaagatgaagcttatgagcctagtaaggaatttgttgacggactactagctcaattgcatgcctcccaagctctattacaagcctctcaagttagtatttcacaagagaccatggttcccgaagcatatcctcatgagcaagcgtatgagtctaggaagccttctcttgaagaattgctagctcaattgcaagcttcccaagcccaattgcaagcctcacaagctcaattgcaagcttctcaagaaatgcttgcacattccaatgagcaacttgaagcaagttttgcacaagagccacccttcgctatttatgagcataaatctttctttgaccaagtggagcctatttcaagagaaaatgtacatgtcaaacatcttgagcaagagtcgtttatgcaaattgaagatgattatagtgatgttgatgtacaagaaattgagcttggttatgaaagttccaatgcaagtggggtgagagactactcttcggcggaatgggtacaatctaagcttccaaatgaaggggagatacttgaagatgattccgaagaagaggatagcttgtcaattaaggaggatgcggagcttgaagtcatacaccatgatcccttaatcgttgaggtcgatattcccaaggagaaagagagtccttcaataccttgtgatgatgaagaaattgaagagccaaggactttctctcctcccacatccacggaaatccatcatgagcttcctaaggtggattgtagaatattgagcacttacattcttaatgagaggattgagatcaaggtacttttacctctcaatccaccattaagtggtcaatgtttctacaatgaggtgatggattggaaaggaagtgaacctcttgcacttaacatttcccatcactcgcaagagcttctaccacctattgttcctatgagcatcatttctacaccacttgagaaggagaaggcaaggagattgatctatagtagaaaaatagagaagaatgggaatattaagaagctacacttttggccaccaattggagtattcttatgtagctcttggtcttgcctctatgatacatcaatgagtcctttagccccaaacaatagggtgctcgtacttgagaagtatccaccttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

463

Amino Acids

52.93

Weight (kDa)

4.5

Isoelectric Point (pI)

68.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 1076, 1289
AciI CCGC 4 cut(s) 92, 95, 746, 836
AclWI GGATC 2 cut(s) 12, 854
AcoI YGGCCR 1 cut(s) 1280
AcsI RAATTY 4 cut(s) 82, 120, 187, 284
AfaI GTAC 7 cut(s) 209, 240, 618, 684, 756, 1050, 1371
AfiI CCNNNNNNNGG 3 cut(s) 776, 1076, 1289
AflIII ACRYGT 2 cut(s) 219, 619
AgsI TTSAA 8 cut(s) 425, 530, 606, 659, 791, 845, 909, 935
AjuI GAANNNNNNNTTGG 2 cut(s) 681, 713
Alw21I GWGCWC 3 cut(s) 167, 1016, 1368
Alw26I GTCTC 3 cut(s) 224, 356, 726
AlwI GGATC 2 cut(s) 12, 854
AoxI GGCC 1 cut(s) 1280
ApoI RAATTY 4 cut(s) 82, 120, 187, 284
AsuHPI GGTGA 3 cut(s) 144, 739, 1111
AsuNHI GCTAGC 1 cut(s) 433
AxyI CCTNAGG 1 cut(s) 990
BaeGI GKGCMC 1 cut(s) 185
BaeI ACNNNNGTAYC 2 cut(s) 222, 255
BalI TGGCCA 1 cut(s) 1282
BarI GAAGNNNNNNTAC 2 cut(s) 768, 800
Bbv12I GWGCWC 3 cut(s) 167, 1016, 1368
BccI CCATC 4 cut(s) 15, 984, 1096, 1152
BcgI CGANNNNNNTGC 2 cut(s) 175, 209
BciVI GTATCC 1 cut(s) 1392
BcoDI GTCTC 3 cut(s) 224, 356, 726
BfaI CTAG 4 cut(s) 276, 302, 408, 434
BfmI CTRYAG 1 cut(s) 1231
BfuI GTATCC 1 cut(s) 1392
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
BmiI GGNNCC 2 cut(s) 372, 597
BmsI GCATC 2 cut(s) 823, 1194
BmtI GCTAGC 1 cut(s) 437
BpuEI CTTGAG 4 cut(s) 327, 480, 653, 1223
BsaBI GATNNNNATC 1 cut(s) 1040
BsaI GGTCTC 1 cut(s) 356
BsaJI CCNNGG 6 cut(s) 32, 143, 366, 888, 941, 966
BsaXI ACNNNNNCTCC 2 cut(s) 937, 967
Bsc4I CCNNNNNNNGG 3 cut(s) 776, 1076, 1289
Bse21I CCTNAGG 1 cut(s) 990
Bse3DI GCAATG 1 cut(s) 121
Bse8I GATNNNNATC 1 cut(s) 1040
BseDI CCNNGG 6 cut(s) 32, 143, 366, 888, 941, 966
BseGI GGATG 4 cut(s) 26, 44, 838, 962
BseJI GATNNNNATC 1 cut(s) 1040
BseLI CCNNNNNNNGG 3 cut(s) 776, 1076, 1289
BseMI GCAATG 1 cut(s) 121
BseRI GAGGAG 1 cut(s) 945
BseSI GKGCMC 1 cut(s) 185
BshFI GGCC 1 cut(s) 1282
BsiHKAI GWGCWC 3 cut(s) 167, 1016, 1368
BslI CCNNNNNNNGG 3 cut(s) 776, 1076, 1289
BsmAI GTCTC 3 cut(s) 224, 356, 726
BsmI GAATGC 1 cut(s) 148
BsnI GGCC 1 cut(s) 1282
Bso31I GGTCTC 1 cut(s) 356
Bsp1286I GDGCHC 4 cut(s) 167, 185, 1016, 1368
Bsp1407I TGTACA 2 cut(s) 616, 682
Bsp143I GATC 4 cut(s) 4, 859, 1041, 1227
Bsp19I CCATGG 2 cut(s) 32, 366
BspACI CCGC 4 cut(s) 92, 95, 746, 836
BspANI GGCC 1 cut(s) 1282
BspHI TCATGA 2 cut(s) 388, 979
BspLI GGNNCC 2 cut(s) 372, 597
BspOI GCTAGC 1 cut(s) 437
BspPI GGATC 2 cut(s) 12, 854
BspQI GCTCTTC 1 cut(s) 930
BspTNI GGTCTC 1 cut(s) 356
BsrDI GCAATG 1 cut(s) 121
BsrGI TGTACA 2 cut(s) 616, 682
BssECI CCNNGG 6 cut(s) 32, 143, 366, 888, 941, 966
BssMI GATC 4 cut(s) 4, 859, 1041, 1227
BssT1I CCWWGG 5 cut(s) 32, 143, 366, 888, 941
Bst6I CTCTTC 3 cut(s) 745, 801, 930
BstAPI GCANNNNNTGC 1 cut(s) 539
BstAUI TGTACA 2 cut(s) 616, 682
BstC8I GCNNGC 7 cut(s) 315, 396, 435, 447, 468, 489, 507
BstDEI CTNAG 2 cut(s) 762, 990
BstDSI CCRYGG 3 cut(s) 32, 366, 966
BstF5I GGATG 4 cut(s) 26, 44, 838, 962
BstKTI GATC 4 cut(s) 7, 862, 1044, 1230
BstMAI GTCTC 3 cut(s) 224, 356, 726
BstMBI GATC 4 cut(s) 4, 859, 1041, 1227
BstMWI GCNNNNNNNGC 4 cut(s) 323, 455, 476, 539
BstNSI RCATGY 3 cut(s) 223, 317, 623
BstSFI CTRYAG 1 cut(s) 1231
BstSLI GKGCMC 1 cut(s) 185
Bsu36I CCTNAGG 1 cut(s) 990
BsuI GTATCC 1 cut(s) 1392
BsuRI GGCC 1 cut(s) 1282
BtgI CCRYGG 3 cut(s) 32, 366, 966
BtsCI GGATG 4 cut(s) 26, 44, 838, 962
Cac8I GCNNGC 7 cut(s) 315, 396, 435, 447, 468, 489, 507
CciI TCATGA 2 cut(s) 388, 979
CseI GACGC 1 cut(s) 254
Csp6I GTAC 7 cut(s) 208, 239, 617, 683, 755, 1049, 1370
CspCI CAANNNNNGTGG 2 cut(s) 703, 738
CviAII CATG 9 cut(s) 33, 89, 220, 314, 367, 389, 620, 857, 980
CviQI GTAC 7 cut(s) 208, 239, 617, 683, 755, 1049, 1370
DdeI CTNAG 2 cut(s) 762, 990
DpnI GATC 4 cut(s) 6, 861, 1043, 1229
DpnII GATC 4 cut(s) 4, 859, 1041, 1227
EaeI YGGCCR 1 cut(s) 1280
Eam1104I CTCTTC 3 cut(s) 745, 801, 930
EarI CTCTTC 3 cut(s) 745, 801, 930
EciI GGCGGA 1 cut(s) 761
Eco130I CCWWGG 5 cut(s) 32, 143, 366, 888, 941
Eco31I GGTCTC 1 cut(s) 356
Eco81I CCTNAGG 1 cut(s) 990
EcoRI GAATTC 1 cut(s) 82
EcoT14I CCWWGG 5 cut(s) 32, 143, 366, 888, 941
ErhI CCWWGG 5 cut(s) 32, 143, 366, 888, 941
FaeI CATG 9 cut(s) 36, 92, 223, 317, 370, 392, 623, 860, 983
FalI AAGNNNNNCTT 4 cut(s) 489, 521, 1259, 1291
FatI CATG 9 cut(s) 32, 88, 219, 313, 366, 388, 619, 856, 979
FauI CCCGC 1 cut(s) 88
Fnu4HI GCNGC 1 cut(s) 93
FokI GGATG 4 cut(s) 33, 51, 845, 949
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 4 cut(s) 276, 302, 408, 434
GluI GCNGC 1 cut(s) 93
HaeIII GGCC 1 cut(s) 1282
HgaI GACGC 1 cut(s) 254
Hin1II CATG 9 cut(s) 36, 92, 223, 317, 370, 392, 623, 860, 983
HincII GTYRAC 1 cut(s) 292
HindII GTYRAC 1 cut(s) 292
HindIII AAGCTT 4 cut(s) 264, 447, 489, 764
HinfI GANTC 5 cut(s) 404, 641, 797, 901, 1339
HphI GGTGA 3 cut(s) 144, 739, 1111
Hpy166II GTNNAC 3 cut(s) 210, 292, 1121
Hpy188I TCNGA 1 cut(s) 802
Hpy188III TCNNGA 8 cut(s) 227, 374, 389, 422, 497, 606, 632, 980
Hpy8I GTNNAC 3 cut(s) 210, 292, 1121
Hpy99I CGWCG 1 cut(s) 248
HpyAV CCTTC 6 cut(s) 426, 565, 770, 915, 1201, 1207
HpyF10VI GCNNNNNNNGC 4 cut(s) 323, 455, 476, 539
HpyF3I CTNAG 2 cut(s) 762, 990
Hsp92II CATG 9 cut(s) 36, 92, 223, 317, 370, 392, 623, 860, 983
Kzo9I GATC 4 cut(s) 4, 859, 1041, 1227
LguI GCTCTTC 1 cut(s) 930
LmnI GCTCC 2 cut(s) 595, 838
LweI GCATC 2 cut(s) 823, 1194
MaeI CTAG 4 cut(s) 276, 302, 408, 434
MalI GATC 4 cut(s) 6, 861, 1043, 1229
MboI GATC 4 cut(s) 4, 859, 1041, 1227
MboII GAAGA 9 cut(s) 437, 671, 732, 803, 815, 818, 938, 947, 1261
MfeI CAATTG 5 cut(s) 308, 440, 461, 482, 1287
MhlI GDGCHC 4 cut(s) 167, 185, 1016, 1368
MlsI TGGCCA 1 cut(s) 1282
MluNI TGGCCA 1 cut(s) 1282
MlyI GAGTC 4 cut(s) 413, 650, 910, 1348
Mox20I TGGCCA 1 cut(s) 1282
MscI TGGCCA 1 cut(s) 1282
MseI TTAA 6 cut(s) 825, 866, 1026, 1073, 1134, 1263
MslI CAYNNNNRTG 2 cut(s) 37, 516
Msp20I TGGCCA 1 cut(s) 1282
MunI CAATTG 5 cut(s) 308, 440, 461, 482, 1287
Mva1269I GAATGC 1 cut(s) 148
MwoI GCNNNNNNNGC 4 cut(s) 323, 455, 476, 539
NcoI CCATGG 2 cut(s) 32, 366
NdeII GATC 4 cut(s) 4, 859, 1041, 1227
NheI GCTAGC 1 cut(s) 433
NlaIII CATG 9 cut(s) 36, 92, 223, 317, 370, 392, 623, 860, 983
NlaIV GGNNCC 2 cut(s) 372, 597
NspI RCATGY 3 cut(s) 223, 317, 623
PaeI GCATGC 1 cut(s) 317
PagI TCATGA 2 cut(s) 388, 979
PciI ACATGT 2 cut(s) 219, 619
PciSI GCTCTTC 1 cut(s) 930
PcsI WCGNNNNNNNCGW 1 cut(s) 876
PctI GAATGC 1 cut(s) 148
PfeI GAWTC 1 cut(s) 797
PflMI CCANNNNNTGG 2 cut(s) 1076, 1289
PkrI GCNGC 1 cut(s) 94
PleI GAGTC 4 cut(s) 412, 649, 909, 1347
PpsI GAGTC 4 cut(s) 412, 649, 909, 1347
PscI ACATGT 2 cut(s) 219, 619
PspN4I GGNNCC 2 cut(s) 372, 597
RsaI GTAC 7 cut(s) 209, 240, 618, 684, 756, 1050, 1371
RsaNI GTAC 7 cut(s) 208, 239, 617, 683, 755, 1049, 1370
RseI CAYNNNNRTG 2 cut(s) 37, 516
SapI GCTCTTC 1 cut(s) 930
SaqAI TTAA 6 cut(s) 825, 866, 1026, 1073, 1134, 1263
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 4 cut(s) 4, 859, 1041, 1227
SchI GAGTC 4 cut(s) 413, 650, 910, 1348
SduI GDGCHC 4 cut(s) 167, 185, 1016, 1368
SfaNI GCATC 2 cut(s) 823, 1194
SfcI CTRYAG 1 cut(s) 1231
SmiMI CAYNNNNRTG 2 cut(s) 37, 516
SmlI CTYRAG 5 cut(s) 342, 495, 632, 1202, 1373
SmoI CTYRAG 5 cut(s) 342, 495, 632, 1202, 1373
SphI GCATGC 1 cut(s) 317
SsiI CCGC 4 cut(s) 92, 95, 746, 836
SspI AATATT 2 cut(s) 1008, 1261
SspMI CTAG 4 cut(s) 276, 302, 408, 434
StyI CCWWGG 5 cut(s) 32, 143, 366, 888, 941
TaqI TCGA 1 cut(s) 879
TatI WGTACW 3 cut(s) 207, 616, 682
TauI GCSGC 1 cut(s) 95
TfiI GAWTC 1 cut(s) 797
Tru1I TTAA 6 cut(s) 825, 866, 1026, 1073, 1134, 1263
Tru9I TTAA 6 cut(s) 825, 866, 1026, 1073, 1134, 1263
TspDTI ATGAA 5 cut(s) 132, 276, 720, 789, 939
TspGWI ACGGA 2 cut(s) 309, 983
Van91I CCANNNNNTGG 2 cut(s) 1076, 1289
XapI RAATTY 4 cut(s) 82, 120, 187, 284
XceI RCATGY 3 cut(s) 223, 317, 623
XspI CTAG 4 cut(s) 276, 302, 408, 434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.