Rmu_sc0002858.1_g000033

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002858.1
OG0000195
Physical Location & Seq
Forward (+)
128612 .. 129349
738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002858.1_g000033.1.cds

Sequence Viewer

Length: 651 bp
atggttcccgaagcatatgctcatgagcaagcatatgagtctaggaagccttctcttgaagaattgctagctcaattgcaagcgtctcaagctcgattgcaagcttctcaagaaatacttatacataccaatgagcaacttgagactagtgttgcacaagagtcaccattcaccatttatgagcatgaatctttctttgaccaagtggagcctatttcaagagaagaagtgtatatcgagcatcttgagcatgaatcctttatgcaagttgaaaatgatgatagtgatgttgatgttcaagaaattgagcttggagagatatttgaagatgattctgaagaagaggatgtcttgtctagtgaggaggatgtggatcttgaagtcatacaccataatcccttattcatcgaggaggatgcggagcttgaagtcatacaccataatcccttattcattgaggtagatattcccatggaggaagagagtccttcaatactttgtgatgatgaagaaattgaagagccaaggactttctctcctcccacatccatggagatccatcatgagtttcccaaggtggagagtagaatgttgagcacttatgttattcatgagaagattgagatcaaggtagttttacctcccaattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

216

Amino Acids

25.12

Weight (kDa)

4.09

Isoelectric Point (pI)

83.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 419
AclWI GGATC 2 cut(s) 381, 550
AcuI CTGAAG 1 cut(s) 357
AgsI TTSAA 9 cut(s) 59, 219, 272, 299, 326, 380, 428, 492, 518
AhlI ACTAGT 1 cut(s) 146
AjuI GAANNNNNNNTTGG 2 cut(s) 294, 326
AluBI AGCT 5 cut(s) 71, 92, 104, 310, 424
AluI AGCT 5 cut(s) 71, 92, 104, 310, 424
Alw21I GWGCWC 1 cut(s) 599
Alw26I GTCTC 2 cut(s) 90, 137
AlwI GGATC 2 cut(s) 381, 550
AsuHPI GGTGA 2 cut(s) 156, 163
AsuNHI GCTAGC 1 cut(s) 67
Bbv12I GWGCWC 1 cut(s) 599
BccI CCATC 1 cut(s) 567
BcgI CGANNNNNNTGC 3 cut(s) 33, 398, 432
BcoDI GTCTC 2 cut(s) 90, 137
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 4 cut(s) 42, 68, 147, 357
BmiI GGNNCC 2 cut(s) 6, 210
BmsI GCATC 2 cut(s) 250, 406
BmtI GCTAGC 1 cut(s) 71
BpuEI CTTGAG 4 cut(s) 72, 93, 161, 266
BsaBI GATNNNNATC 2 cut(s) 372, 623
BsaJI CCNNGG 4 cut(s) 471, 524, 549, 573
BsaXI ACNNNNNCTCC 2 cut(s) 520, 550
Bse8I GATNNNNATC 2 cut(s) 372, 623
BseDI CCNNGG 4 cut(s) 471, 524, 549, 573
BseGI GGATG 4 cut(s) 352, 373, 421, 545
BseJI GATNNNNATC 2 cut(s) 372, 623
BseRI GAGGAG 3 cut(s) 377, 425, 528
BsiHKAI GWGCWC 1 cut(s) 599
BsmAI GTCTC 2 cut(s) 90, 137
BsmBI CGTCTC 1 cut(s) 90
Bsp1286I GDGCHC 1 cut(s) 599
Bsp143I GATC 3 cut(s) 373, 555, 624
Bsp19I CCATGG 2 cut(s) 471, 549
BspACI CCGC 1 cut(s) 419
BspHI TCATGA 3 cut(s) 22, 562, 610
BspLI GGNNCC 2 cut(s) 6, 210
BspOI GCTAGC 1 cut(s) 71
BspPI GGATC 2 cut(s) 381, 550
BspQI GCTCTTC 1 cut(s) 513
BssECI CCNNGG 4 cut(s) 471, 524, 549, 573
BssMI GATC 3 cut(s) 373, 555, 624
BssT1I CCWWGG 4 cut(s) 471, 524, 549, 573
Bst6I CTCTTC 3 cut(s) 336, 474, 513
BstC8I GCNNGC 4 cut(s) 30, 69, 81, 102
BstDSI CCRYGG 2 cut(s) 471, 549
BstF5I GGATG 4 cut(s) 352, 373, 421, 545
BstKTI GATC 3 cut(s) 376, 558, 627
BstMAI GTCTC 2 cut(s) 90, 137
BstMBI GATC 3 cut(s) 373, 555, 624
BstMWI GCNNNNNNNGC 2 cut(s) 89, 247
BstX2I RGATCY 2 cut(s) 373, 555
BstXI CCANNNNNNTGG 1 cut(s) 550
BstYI RGATCY 2 cut(s) 373, 555
BtgI CCRYGG 2 cut(s) 471, 549
BtsCI GGATG 4 cut(s) 352, 373, 421, 545
Cac8I GCNNGC 4 cut(s) 30, 69, 81, 102
CciI TCATGA 3 cut(s) 22, 562, 610
CseI GACGC 1 cut(s) 72
CviAII CATG 7 cut(s) 23, 185, 251, 472, 550, 563, 611
CviJI RGCY 8 cut(s) 49, 71, 92, 104, 211, 310, 424, 523
CviKI_1 RGCY 8 cut(s) 49, 71, 92, 104, 211, 310, 424, 523
DpnI GATC 3 cut(s) 375, 557, 626
DpnII GATC 3 cut(s) 373, 555, 624
Eam1104I CTCTTC 3 cut(s) 336, 474, 513
EarI CTCTTC 3 cut(s) 336, 474, 513
Eco130I CCWWGG 4 cut(s) 471, 524, 549, 573
Eco57I CTGAAG 1 cut(s) 357
EcoT14I CCWWGG 4 cut(s) 471, 524, 549, 573
ErhI CCWWGG 4 cut(s) 471, 524, 549, 573
Esp3I CGTCTC 1 cut(s) 90
FaeI CATG 7 cut(s) 26, 188, 254, 475, 553, 566, 614
FalI AAGNNNNNCTT 2 cut(s) 102, 134
FatI CATG 7 cut(s) 22, 184, 250, 471, 549, 562, 610
FauNDI CATATG 2 cut(s) 16, 34
FokI GGATG 4 cut(s) 359, 380, 428, 532
FspBI CTAG 4 cut(s) 42, 68, 147, 357
HgaI GACGC 1 cut(s) 72
Hin1II CATG 7 cut(s) 26, 188, 254, 475, 553, 566, 614
HindIII AAGCTT 1 cut(s) 102
HinfI GANTC 6 cut(s) 38, 161, 188, 254, 332, 484
HphI GGTGA 2 cut(s) 156, 163
Hpy188I TCNGA 1 cut(s) 337
HpyAV CCTTC 2 cut(s) 60, 498
HpyCH4V TGCA 4 cut(s) 79, 100, 155, 265
HpyF10VI GCNNNNNNNGC 2 cut(s) 89, 247
Hsp92II CATG 7 cut(s) 26, 188, 254, 475, 553, 566, 614
Kzo9I GATC 3 cut(s) 373, 555, 624
LguI GCTCTTC 1 cut(s) 513
LmnI GCTCC 2 cut(s) 208, 421
LweI GCATC 2 cut(s) 250, 406
MaeI CTAG 4 cut(s) 42, 68, 147, 357
MaeIII GTNAC 1 cut(s) 162
MalI GATC 3 cut(s) 375, 557, 626
MboI GATC 3 cut(s) 373, 555, 624
MboII GAAGA 9 cut(s) 71, 236, 338, 350, 353, 491, 521, 530, 628
MfeI CAATTG 2 cut(s) 74, 646
MflI RGATCY 2 cut(s) 373, 555
MhlI GDGCHC 1 cut(s) 599
MluCI AATT 5 cut(s) 62, 74, 303, 513, 646
MlyI GAGTC 3 cut(s) 47, 170, 493
MnlI CCTC 9 cut(s) 337, 355, 358, 403, 406, 451, 469, 549, 651
MslI CAYNNNNRTG 2 cut(s) 129, 548
MunI CAATTG 2 cut(s) 74, 646
MwoI GCNNNNNNNGC 2 cut(s) 89, 247
NcoI CCATGG 2 cut(s) 471, 549
NdeI CATATG 2 cut(s) 16, 34
NdeII GATC 3 cut(s) 373, 555, 624
NheI GCTAGC 1 cut(s) 67
NlaIII CATG 7 cut(s) 26, 188, 254, 475, 553, 566, 614
NlaIV GGNNCC 2 cut(s) 6, 210
NmuCI GTSAC 1 cut(s) 162
PagI TCATGA 3 cut(s) 22, 562, 610
PciSI GCTCTTC 1 cut(s) 513
PfeI GAWTC 3 cut(s) 188, 254, 332
PleI GAGTC 3 cut(s) 46, 169, 492
PpsI GAGTC 3 cut(s) 46, 169, 492
PspN4I GGNNCC 2 cut(s) 6, 210
PsuI RGATCY 2 cut(s) 373, 555
RseI CAYNNNNRTG 2 cut(s) 129, 548
SapI GCTCTTC 1 cut(s) 513
Sau3AI GATC 3 cut(s) 373, 555, 624
SchI GAGTC 3 cut(s) 47, 170, 493
SduI GDGCHC 1 cut(s) 599
SetI ASST 9 cut(s) 73, 94, 106, 312, 426, 462, 579, 633, 643
SfaNI GCATC 2 cut(s) 250, 406
SmiMI CAYNNNNRTG 2 cut(s) 129, 548
SmlI CTYRAG 4 cut(s) 87, 108, 140, 245
SmoI CTYRAG 4 cut(s) 87, 108, 140, 245
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 5 cut(s) 62, 74, 303, 513, 646
SsiI CCGC 1 cut(s) 419
SspMI CTAG 4 cut(s) 42, 68, 147, 357
StyI CCWWGG 4 cut(s) 471, 524, 549, 573
TaqI TCGA 3 cut(s) 94, 237, 408
TasI AATT 5 cut(s) 62, 74, 303, 513, 646
TfiI GAWTC 3 cut(s) 188, 254, 332
TseFI GTSAC 1 cut(s) 162
Tsp45I GTSAC 1 cut(s) 162
TspDTI ATGAA 6 cut(s) 201, 267, 394, 442, 522, 599
XspI CTAG 4 cut(s) 42, 68, 147, 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.