Rmu_sc0000897.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000897.1
OG0000195
Physical Location & Seq
Forward (+)
131602 .. 132540
939 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000897.1_g000016.1.cds

Sequence Viewer

Length: 939 bp
atggatcggtggaactatggatgggaagacccgtggggatatgagcaagaaagtttatatggtggaggttatcaagcttatgagcctaggaaggaattcgttgaaggactactagctcaattgcaagcctcccaagctaggatttcacaagaaaccacggttcccgaagcatatcctcatgagcaagcatatgagtctaggaagccttcccttgaagaaatactagctcaattgcaagcctctcaagctctattgcaggcctcccaagctcgattgcaagtttctcaagagatgctcatacattccaatgagcaacttgaggcgagtcttgcacaagagccacccttcacaatttttcatgagcatgaatctttctttgaccaagtggagcctatttcaagagaaaatgtacatgtcaagcatcttgagcaagagtcgtttatgaaaattgaagatgattatagtgatgttgatgtacaagaaagtgggcttggttatgaaagttccaatgcaagtggggtgagagactactcttcggcggaatgggtacaatctaagcttccaaatgaaggggagatacttgaagatgattccgaagaagaggatggcttgtctaatgaggaggatgcggagtttgaagtcctacaccataatcccttattcattgaggaggatgcggagcttcaagtcatatatcataatcctttattcattgaggccgatgttcccaaggaggaagagagtcaagcaatggtttgtgatgatgaagaagttgaagagccaaagactttctctcctcctacatccatggagatccatcatgagcttctcaaggtggagagtaaaacattgagcacttatgttcttaatgagaggattgggatcaaggtacttttacctcccaatccaccattaagtggtcaatgttttttacaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

312

Amino Acids

35.7

Weight (kDa)

4.23

Isoelectric Point (pI)

66.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 917
AciI CCGC 3 cut(s) 539, 629, 677
AclWI GGATC 3 cut(s) 12, 808, 890
AcsI RAATTY 1 cut(s) 95
AfaI GTAC 4 cut(s) 411, 477, 549, 891
AfiI CCNNNNNNNGG 3 cut(s) 138, 569, 917
AflIII ACRYGT 1 cut(s) 412
AgsI TTSAA 8 cut(s) 104, 215, 399, 452, 584, 638, 686, 776
AjuI GAANNNNNNNTTGG 2 cut(s) 474, 506
AluBI AGCT 9 cut(s) 77, 116, 137, 227, 248, 269, 559, 682, 826
AluI AGCT 9 cut(s) 77, 116, 137, 227, 248, 269, 559, 682, 826
Alw21I GWGCWC 1 cut(s) 857
Alw26I GTCTC 1 cut(s) 519
AlwI GGATC 3 cut(s) 12, 808, 890
AoxI GGCC 2 cut(s) 258, 717
ApoI RAATTY 1 cut(s) 95
Asp700I GAANNNNTTC 1 cut(s) 95
AspA2I CCTAGG 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 532
AvrII CCTAGG 1 cut(s) 86
BarI GAAGNNNNNNTAC 2 cut(s) 561, 593
BbsI GAAGAC 1 cut(s) 33
Bbv12I GWGCWC 1 cut(s) 857
BccI CCATC 3 cut(s) 15, 599, 825
BcoDI GTCTC 1 cut(s) 519
BfaI CTAG 5 cut(s) 87, 113, 138, 198, 224
BlnI CCTAGG 1 cut(s) 86
BmiI GGNNCC 2 cut(s) 162, 390
BmsI GCATC 4 cut(s) 282, 430, 616, 664
BpiI GAAGAC 1 cut(s) 33
BpuEI CTTGAG 5 cut(s) 228, 270, 338, 446, 815
BsaBI GATNNNNATC 1 cut(s) 881
BsaJI CCNNGG 5 cut(s) 32, 86, 156, 729, 807
BsaXI ACNNNNNCTCC 2 cut(s) 778, 808
Bsc4I CCNNNNNNNGG 3 cut(s) 138, 569, 917
Bse3DI GCAATG 1 cut(s) 756
Bse8I GATNNNNATC 1 cut(s) 881
BseDI CCNNGG 5 cut(s) 32, 86, 156, 729, 807
BseGI GGATG 5 cut(s) 26, 610, 631, 679, 803
BseJI GATNNNNATC 1 cut(s) 881
BseLI CCNNNNNNNGG 3 cut(s) 138, 569, 917
BseMI GCAATG 1 cut(s) 756
BseRI GAGGAG 3 cut(s) 635, 683, 786
BshFI GGCC 2 cut(s) 260, 719
BsiHKAI GWGCWC 1 cut(s) 857
BslI CCNNNNNNNGG 3 cut(s) 138, 569, 917
BsmAI GTCTC 1 cut(s) 519
BsnI GGCC 2 cut(s) 260, 719
Bsp1286I GDGCHC 1 cut(s) 857
Bsp1407I TGTACA 2 cut(s) 409, 475
Bsp143I GATC 3 cut(s) 4, 813, 882
Bsp19I CCATGG 1 cut(s) 807
BspACI CCGC 3 cut(s) 539, 629, 677
BspANI GGCC 2 cut(s) 260, 719
BspHI TCATGA 3 cut(s) 178, 358, 820
BspLI GGNNCC 2 cut(s) 162, 390
BspPI GGATC 3 cut(s) 12, 808, 890
BspQI GCTCTTC 1 cut(s) 771
BsrDI GCAATG 1 cut(s) 756
BsrGI TGTACA 2 cut(s) 409, 475
BssECI CCNNGG 5 cut(s) 32, 86, 156, 729, 807
BssMI GATC 3 cut(s) 4, 813, 882
BssT1I CCWWGG 3 cut(s) 86, 729, 807
Bst4CI ACNGT 1 cut(s) 160
Bst6I CTCTTC 4 cut(s) 538, 594, 732, 771
BstAUI TGTACA 2 cut(s) 409, 475
BstC8I GCNNGC 4 cut(s) 126, 186, 237, 258
BstDEI CTNAG 1 cut(s) 555
BstDSI CCRYGG 3 cut(s) 32, 156, 807
BstF5I GGATG 5 cut(s) 26, 610, 631, 679, 803
BstKTI GATC 3 cut(s) 7, 816, 885
BstMAI GTCTC 1 cut(s) 519
BstMBI GATC 3 cut(s) 4, 813, 882
BstMWI GCNNNNNNNGC 5 cut(s) 134, 245, 266, 329, 427
BstNSI RCATGY 1 cut(s) 416
BstV2I GAAGAC 1 cut(s) 33
BstX2I RGATCY 1 cut(s) 813
BstYI RGATCY 1 cut(s) 813
BsuRI GGCC 2 cut(s) 260, 719
BtgI CCRYGG 3 cut(s) 32, 156, 807
BtsCI GGATG 5 cut(s) 26, 610, 631, 679, 803
Cac8I GCNNGC 4 cut(s) 126, 186, 237, 258
CciI TCATGA 3 cut(s) 178, 358, 820
Csp6I GTAC 4 cut(s) 410, 476, 548, 890
CspCI CAANNNNNGTGG 2 cut(s) 496, 531
CviAII CATG 6 cut(s) 179, 359, 365, 413, 808, 821
CviQI GTAC 4 cut(s) 410, 476, 548, 890
DdeI CTNAG 1 cut(s) 555
DpnI GATC 3 cut(s) 6, 815, 884
DpnII GATC 3 cut(s) 4, 813, 882
Eam1104I CTCTTC 4 cut(s) 538, 594, 732, 771
EarI CTCTTC 4 cut(s) 538, 594, 732, 771
EciI GGCGGA 1 cut(s) 554
Eco130I CCWWGG 3 cut(s) 86, 729, 807
Eco147I AGGCCT 1 cut(s) 260
EcoRI GAATTC 1 cut(s) 95
EcoT14I CCWWGG 3 cut(s) 86, 729, 807
ErhI CCWWGG 3 cut(s) 86, 729, 807
FaeI CATG 6 cut(s) 182, 362, 368, 416, 811, 824
FatI CATG 6 cut(s) 178, 358, 364, 412, 807, 820
FauNDI CATATG 1 cut(s) 190
FokI GGATG 5 cut(s) 33, 617, 638, 686, 790
FspBI CTAG 5 cut(s) 87, 113, 138, 198, 224
HaeIII GGCC 2 cut(s) 260, 719
Hin1II CATG 6 cut(s) 182, 362, 368, 416, 811, 824
HindIII AAGCTT 2 cut(s) 75, 557
HinfI GANTC 6 cut(s) 194, 325, 368, 434, 590, 742
HphI GGTGA 1 cut(s) 532
Hpy188I TCNGA 1 cut(s) 595
Hpy188III TCNNGA 7 cut(s) 164, 179, 287, 359, 399, 425, 821
HpyAV CCTTC 5 cut(s) 85, 98, 216, 355, 563
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 6 cut(s) 124, 235, 256, 277, 332, 512
HpyF10VI GCNNNNNNNGC 5 cut(s) 134, 245, 266, 329, 427
HpyF3I CTNAG 1 cut(s) 555
Hsp92II CATG 6 cut(s) 182, 362, 368, 416, 811, 824
Kzo9I GATC 3 cut(s) 4, 813, 882
LguI GCTCTTC 1 cut(s) 771
LmnI GCTCC 2 cut(s) 388, 679
LpnPI CCDG 1 cut(s) 242
LweI GCATC 4 cut(s) 282, 430, 616, 664
MaeI CTAG 5 cut(s) 87, 113, 138, 198, 224
MalI GATC 3 cut(s) 6, 815, 884
MboI GATC 3 cut(s) 4, 813, 882
MfeI CAATTG 2 cut(s) 119, 230
MflI RGATCY 1 cut(s) 813
MhlI GDGCHC 1 cut(s) 857
MluCI AATT 5 cut(s) 95, 119, 230, 351, 447
MlyI GAGTC 4 cut(s) 203, 334, 443, 751
MroXI GAANNNNTTC 1 cut(s) 95
MseI TTAA 2 cut(s) 867, 914
MslI CAYNNNNRTG 2 cut(s) 306, 363
MunI CAATTG 2 cut(s) 119, 230
MwoI GCNNNNNNNGC 5 cut(s) 134, 245, 266, 329, 427
NcoI CCATGG 1 cut(s) 807
NdeI CATATG 1 cut(s) 190
NdeII GATC 3 cut(s) 4, 813, 882
NlaIII CATG 6 cut(s) 182, 362, 368, 416, 811, 824
NlaIV GGNNCC 2 cut(s) 162, 390
NspI RCATGY 1 cut(s) 416
PagI TCATGA 3 cut(s) 178, 358, 820
PceI AGGCCT 1 cut(s) 260
PciI ACATGT 1 cut(s) 412
PciSI GCTCTTC 1 cut(s) 771
PdmI GAANNNNTTC 1 cut(s) 95
PfeI GAWTC 2 cut(s) 368, 590
PflMI CCANNNNNTGG 1 cut(s) 917
PleI GAGTC 4 cut(s) 202, 333, 442, 750
PpsI GAGTC 4 cut(s) 202, 333, 442, 750
PscI ACATGT 1 cut(s) 412
PspN4I GGNNCC 2 cut(s) 162, 390
PsuI RGATCY 1 cut(s) 813
RsaI GTAC 4 cut(s) 411, 477, 549, 891
RsaNI GTAC 4 cut(s) 410, 476, 548, 890
RseI CAYNNNNRTG 2 cut(s) 306, 363
SapI GCTCTTC 1 cut(s) 771
SaqAI TTAA 2 cut(s) 867, 914
Sau3AI GATC 3 cut(s) 4, 813, 882
SchI GAGTC 4 cut(s) 203, 334, 443, 751
SduI GDGCHC 1 cut(s) 857
SfaNI GCATC 4 cut(s) 282, 430, 616, 664
SmiMI CAYNNNNRTG 2 cut(s) 306, 363
SmlI CTYRAG 5 cut(s) 243, 285, 317, 425, 830
SmoI CTYRAG 5 cut(s) 243, 285, 317, 425, 830
Sse9I AATT 5 cut(s) 95, 119, 230, 351, 447
SseBI AGGCCT 1 cut(s) 260
SsiI CCGC 3 cut(s) 539, 629, 677
SspMI CTAG 5 cut(s) 87, 113, 138, 198, 224
StuI AGGCCT 1 cut(s) 260
StyI CCWWGG 3 cut(s) 86, 729, 807
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 1 cut(s) 271
TasI AATT 5 cut(s) 95, 119, 230, 351, 447
TatI WGTACW 2 cut(s) 409, 475
TfiI GAWTC 2 cut(s) 368, 590
Tru1I TTAA 2 cut(s) 867, 914
Tru9I TTAA 2 cut(s) 867, 914
TspDTI ATGAA 8 cut(s) 347, 381, 458, 513, 582, 652, 700, 780
Van91I CCANNNNNTGG 1 cut(s) 917
XapI RAATTY 1 cut(s) 95
XceI RCATGY 1 cut(s) 416
XmaJI CCTAGG 1 cut(s) 86
XmnI GAANNNNTTC 1 cut(s) 95
XspI CTAG 5 cut(s) 87, 113, 138, 198, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.