Rmu_sc0002652.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002652.1
OG0000195
Physical Location & Seq
Reverse (-)
2962 .. 4395
1434 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002652.1_g000001.1.cds

Sequence Viewer

Length: 1434 bp
atggatcaatggagctatggatgggaagacccaaggggatatgagcaagaaagtttttatggtggaggtcatcaagtgtggaattctcatgcgatcggttctatgtcttcttgcaatgaaacttgtgctttttgtaattctccttggcattcatcttttgagtgctctttgagatttgagtgcccggattttatgcaagagtgtgagtacaagatgggcatgtatcaagagacatttatacccaatgcatatccacaagaagaagcttatgagcctagtaaggaatttgttgacggactactagctcaattgcacgcctcccaagctctattacaagcctctcaagttagtatttcacaagagaccatggttcctgaagcatatcctcatgagcaagcatatgagtctaggaggtcttctcttgaagaattgctagctcaattgcaagcttcccaatctcacttgcaatcctcacaagctcgattgcaagcttctcaagagatgcttatacattccaatgagcaacttaaggctagtcttgcacaagagccacccttcactatttatgagcatgaatctttctttgaccaagtggagcctatttcaagagaagaagtgtatatcaagcatcttgagcaagagtcttttatgcaagttgaaaataatgatagtgatgttgatgtacaacatagtgagcttggttatgaaagtttcaatgcacgtggggtgagtgactacaattcggaagaatgggtccaattttggaaatctaagcttccaaatggagaggagatgcttgaagatgattccgaagaagatgatgtcttatctagcgaggaggatacggaatttgaagttatacaccataatcccttgttcatcgaggaggatacagagcttgagatcatgcaccataatcccttattcattgaggtcgatattcccatggaagaagagagtccttcaatactttgtgacgatgaagaaattgaagagctaaggactttctctcctcctacatccaaggagatccatcatgagcttcccaaagtggattgtagaatatttgttcttaatgcgaggattgagatcaaggtatttttacctcccaatccaccatttagtggtcaatgtttctacaatgaggtgatggattggaaaggaaatggagcacttgcactcaccatttcccatcactttcaagagcttctaccacctattgttcctatgagcatcaattctacaccacttgagaaggacaaggcaaggatagctcctagaagaaaaattgagaagaggaagattaagaagctatacttttggccaccaaatggagtattcttatgtagctcttggtcttgtctctatgacacatcgaagagtcccttagccccaaacaatagggtggtcgtacttgagaagtatccaccttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

477

Amino Acids

55.18

Weight (kDa)

4.54

Isoelectric Point (pI)

70.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000195)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g25780 FvH4_6g25920
rosa_chinensis RchiOBHm_Chr1g0366971 RchiOBHm_Chr1g0372841 RchiOBHm_Chr2g0146841 RchiOBHm_Chr2g0154821 RchiOBHm_Chr2g0159611 RchiOBHm_Chr3g0452071 RchiOBHm_Chr3g0453731 RchiOBHm_Chr3g0457891 RchiOBHm_Chr3g0471041 RchiOBHm_Chr3g0473741 RchiOBHm_Chr4g0427761 RchiOBHm_Chr5g0041301 RchiOBHm_Chr5g0076511 RchiOBHm_Chr6g0281431 RchiOBHm_Chr7g0180511
rosa_multiflora Rmu_sc0000082.1_g000052 Rmu_sc0000125.1_g000058 Rmu_sc0000147.1_g000108 Rmu_sc0000210.1_g000011 Rmu_sc0000229.1_g000006 Rmu_sc0000245.1_g000013 Rmu_sc0000897.1_g000016 Rmu_sc0001059.1_g000005 Rmu_sc0001336.1_g000059 Rmu_sc0001464.1_g000025 Rmu_sc0001630.1_g000013 Rmu_sc0001790.1_g000012 Rmu_sc0001939.1_g000003 Rmu_sc0002132.1_g000013 Rmu_sc0002235.1_g000008 Rmu_sc0002235.1_g000022 Rmu_sc0002548.1_g000030 Rmu_sc0002564.1_g000018 Rmu_sc0002652.1_g000001 Rmu_sc0002759.1_g000007 Rmu_sc0002759.1_g000011 Rmu_sc0002799.1_g000012 Rmu_sc0002858.1_g000033 Rmu_sc0002882.1_g000041 Rmu_sc0003032.1_g000030 Rmu_sc0003033.1_g000041 Rmu_sc0003044.1_g000038 Rmu_sc0003072.1_g000004 Rmu_sc0003264.1_g000025 Rmu_sc0003304.1_g000034 Rmu_sc0003416.1_g000002 Rmu_sc0003613.1_g000010 Rmu_sc0003762.1_g000009 Rmu_sc0003776.1_g000028 Rmu_sc0003859.1_g000025 Rmu_sc0004553.1_g000014 Rmu_sc0004866.1_g000002 Rmu_sc0004941.1_g000047 Rmu_sc0005777.1_g000002 Rmu_sc0005958.1_g000001 Rmu_sc0006573.1_g000001 Rmu_sc0006912.1_g000005 Rmu_sc0006968.1_g000002 Rmu_sc0006986.1_g000020 Rmu_sc0007258.1_g000016 Rmu_sc0007803.1_g000001 Rmu_sc0008479.1_g000003 Rmu_sc0008506.1_g000012 Rmu_sc0009199.1_g000005 Rmu_sc0009431.1_g000008 Rmu_sc0009611.1_g000005 Rmu_sc0014287.1_g000001 Rmu_sc0014768.1_g000001 Rmu_sc0020577.1_g000001 Rmu_sc0028131.1_g000001 Rmu_sc0029371.1_g000001 Rmu_sc0034219.1_g000001 Rmu_ssc0000252.1_g000026 Rmu_ssc0000252.1_g000027 Rmu_ssc0000398.1_g000023 Rmu_ssc0000482.1_g000020
rosa_roxburghii Rroxscaffold_158G00443700 Rroxscaffold_1G00001910 Rroxscaffold_1G00001960 Rroxscaffold_1G00002400 Rroxscaffold_1G00015110 Rroxscaffold_1G00015140 Rroxscaffold_1G00028870 Rroxscaffold_1G00028930 Rroxscaffold_1G00031320 Rroxscaffold_1G00031990 Rroxscaffold_1G00060310 Rroxscaffold_1G00063330 Rroxscaffold_1G00071570 Rroxscaffold_2G00084360 Rroxscaffold_2G00084370 Rroxscaffold_2G00088550 Rroxscaffold_2G00088560 Rroxscaffold_2G00089850 Rroxscaffold_2G00095470 Rroxscaffold_2G00103510 Rroxscaffold_2G00114380 Rroxscaffold_2G00119580 Rroxscaffold_2G00122990 Rroxscaffold_2G00125720 Rroxscaffold_3G00223380 Rroxscaffold_3G00230410 Rroxscaffold_3G00233640 Rroxscaffold_3G00234580 Rroxscaffold_3G00241070 Rroxscaffold_4G00282590 Rroxscaffold_4G00309420 Rroxscaffold_4G00309430 Rroxscaffold_4G00314030 Rroxscaffold_4G00314610 Rroxscaffold_4G00316420 Rroxscaffold_4G00319130 Rroxscaffold_4G00319140 Rroxscaffold_4G00319350 Rroxscaffold_4G00324170 Rroxscaffold_4G00324230 Rroxscaffold_5G00346540 Rroxscaffold_5G00346580 Rroxscaffold_5G00346790 Rroxscaffold_5G00349270 Rroxscaffold_5G00350530 Rroxscaffold_5G00373500 Rroxscaffold_5G00378950 Rroxscaffold_5G00378960 Rroxscaffold_5G00381870 Rroxscaffold_6G00388230 Rroxscaffold_6G00389700 Rroxscaffold_6G00389810 Rroxscaffold_6G00391690 Rroxscaffold_6G00391820 Rroxscaffold_6G00391830 Rroxscaffold_6G00393500 Rroxscaffold_6G00396180 Rroxscaffold_6G00396460 Rroxscaffold_6G00418900 Rroxscaffold_6G00423330 Rroxscaffold_7G00173340 Rroxscaffold_7G00176630 Rroxscaffold_7G00181910 Rroxscaffold_7G00191850 Rroxscaffold_7G00199230 Rroxscaffold_7G00199250 Rroxscaffold_7G00203720 Rroxscaffold_7G00204410 Rroxscaffold_7G00204420 Rroxscaffold_7G00212090 Rroxscaffold_7G00215450
rosa_rugosa Rorug07G0321500
rosa_samantha Rh3BG349100 Rh4AG240700
rosa_wichuraiana Rw0G011180 Rw1G003000 Rw5G028290 Rw6G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 1124, 1331
AclWI GGATC 2 cut(s) 12, 1024
AcoI YGGCCR 1 cut(s) 1322
AcsI RAATTY 3 cut(s) 82, 284, 848
AcuI CTGAAG 1 cut(s) 396
AcvI CACGTG 1 cut(s) 722
AfaI GTAC 3 cut(s) 209, 684, 1413
AfiI CCNNNNNNNGG 2 cut(s) 1124, 1331
AflII CTTAAG 1 cut(s) 527
AgsI TTSAA 9 cut(s) 425, 606, 659, 715, 800, 854, 966, 992, 1202
Alw21I GWGCWC 2 cut(s) 167, 1174
Alw26I GTCTC 3 cut(s) 224, 356, 1367
AlwI GGATC 2 cut(s) 12, 1024
AoxI GGCC 1 cut(s) 1322
ApoI RAATTY 3 cut(s) 82, 284, 848
AspS9I GGNCC 1 cut(s) 754
AsuC2I CCSGG 1 cut(s) 185
AsuHPI GGTGA 3 cut(s) 739, 1159, 1174
AsuNHI GCTAGC 1 cut(s) 433
AvaII GGWCC 1 cut(s) 754
BaeGI GKGCMC 1 cut(s) 185
BalI TGGCCA 1 cut(s) 1324
BbrPI CACGTG 1 cut(s) 722
BbsI GAAGAC 3 cut(s) 33, 99, 408
Bbv12I GWGCWC 2 cut(s) 167, 1174
BccI CCATC 5 cut(s) 15, 208, 1041, 1144, 1200
BciVI GTATCC 3 cut(s) 835, 883, 1434
BcnI CCSGG 1 cut(s) 185
BcoDI GTCTC 3 cut(s) 224, 356, 1367
BfaI CTAG 7 cut(s) 276, 302, 408, 434, 534, 831, 1278
BfrI CTTAAG 1 cut(s) 527
BfuI GTATCC 3 cut(s) 835, 883, 1434
Bme1390I CCNGG 1 cut(s) 185
Bme18I GGWCC 1 cut(s) 754
BmgT120I GGNCC 1 cut(s) 754
BmiI GGNNCC 3 cut(s) 372, 597, 755
BmrFI CCNGG 1 cut(s) 185
BmsI GCATC 4 cut(s) 492, 637, 783, 1242
BmtI GCTAGC 1 cut(s) 437
BpiI GAAGAC 3 cut(s) 33, 99, 408
BplI GAGNNNNNCTC 2 cut(s) 403, 435
Bpu10I CCTNAGC 2 cut(s) 998, 1387
BpuEI CTTGAG 5 cut(s) 327, 480, 653, 920, 1271
BpuMI CCSGG 1 cut(s) 185
BsaAI YACGTR 1 cut(s) 722
BsaBI GATNNNNATC 1 cut(s) 1088
BsaI GGTCTC 1 cut(s) 356
BsaJI CCNNGG 5 cut(s) 32, 143, 366, 945, 1023
BsaXI ACNNNNNCTCC 2 cut(s) 994, 1024
Bsc4I CCNNNNNNNGG 2 cut(s) 1124, 1331
Bse3DI GCAATG 1 cut(s) 121
Bse8I GATNNNNATC 1 cut(s) 1088
BseDI CCNNGG 5 cut(s) 32, 143, 366, 945, 1023
BseGI GGATG 2 cut(s) 26, 1019
BseJI GATNNNNATC 1 cut(s) 1088
BseLI CCNNNNNNNGG 2 cut(s) 1124, 1331
BseMI GCAATG 1 cut(s) 121
BseRI GAGGAG 4 cut(s) 803, 851, 899, 1002
BseSI GKGCMC 1 cut(s) 185
Bsh1285I CGRYCG 1 cut(s) 96
BshFI GGCC 1 cut(s) 1324
BsiEI CGRYCG 1 cut(s) 96
BsiHKAI GWGCWC 2 cut(s) 167, 1174
BsiSI CCGG 1 cut(s) 185
BslFI GGGAC 1 cut(s) 1368
BslI CCNNNNNNNGG 2 cut(s) 1124, 1331
BsmAI GTCTC 3 cut(s) 224, 356, 1367
BsmFI GGGAC 1 cut(s) 1368
BsmI GAATGC 1 cut(s) 148
BsnI GGCC 1 cut(s) 1324
Bso31I GGTCTC 1 cut(s) 356
Bsp1286I GDGCHC 3 cut(s) 167, 185, 1174
Bsp1407I TGTACA 1 cut(s) 682
Bsp143I GATC 5 cut(s) 4, 93, 903, 1029, 1089
Bsp19I CCATGG 2 cut(s) 366, 945
BspANI GGCC 1 cut(s) 1324
BspHI TCATGA 2 cut(s) 388, 1036
BspLI GGNNCC 3 cut(s) 372, 597, 755
BspOI GCTAGC 1 cut(s) 437
BspPI GGATC 2 cut(s) 12, 1024
BspQI GCTCTTC 1 cut(s) 987
BspTI CTTAAG 1 cut(s) 527
BspTNI GGTCTC 1 cut(s) 356
BsrDI GCAATG 1 cut(s) 121
BsrGI TGTACA 1 cut(s) 682
BssECI CCNNGG 5 cut(s) 32, 143, 366, 945, 1023
BssMI GATC 5 cut(s) 4, 93, 903, 1029, 1089
BssT1I CCWWGG 5 cut(s) 32, 143, 366, 945, 1023
Bst6I CTCTTC 4 cut(s) 948, 987, 1289, 1373
BstAFI CTTAAG 1 cut(s) 527
BstAUI TGTACA 1 cut(s) 682
BstBAI YACGTR 1 cut(s) 722
BstC8I GCNNGC 5 cut(s) 315, 396, 435, 447, 489
BstDEI CTNAG 3 cut(s) 771, 998, 1387
BstDSI CCRYGG 2 cut(s) 366, 945
BstF5I GGATG 2 cut(s) 26, 1019
BstKTI GATC 5 cut(s) 7, 96, 906, 1032, 1092
BstMAI GTCTC 3 cut(s) 224, 356, 1367
BstMBI GATC 5 cut(s) 4, 93, 903, 1029, 1089
BstMCI CGRYCG 1 cut(s) 96
BstMWI GCNNNNNNNGC 4 cut(s) 323, 539, 634, 1271
BstNSI RCATGY 1 cut(s) 223
BstSCI CCNGG 1 cut(s) 183
BstSLI GKGCMC 1 cut(s) 185
BstV2I GAAGAC 3 cut(s) 33, 99, 408
BstX2I RGATCY 1 cut(s) 1029
BstYI RGATCY 1 cut(s) 1029
BsuI GTATCC 3 cut(s) 835, 883, 1434
BsuRI GGCC 1 cut(s) 1324
BtgI CCRYGG 2 cut(s) 366, 945
BtsCI GGATG 2 cut(s) 26, 1019
Cac8I GCNNGC 5 cut(s) 315, 396, 435, 447, 489
CciI TCATGA 2 cut(s) 388, 1036
Cfr13I GGNCC 1 cut(s) 754
Csp6I GTAC 3 cut(s) 208, 683, 1412
CspCI CAANNNNNGTGG 2 cut(s) 703, 738
CviAII CATG 8 cut(s) 89, 220, 367, 389, 572, 907, 946, 1037
CviQI GTAC 3 cut(s) 208, 683, 1412
DdeI CTNAG 3 cut(s) 771, 998, 1387
DpnI GATC 5 cut(s) 6, 95, 905, 1031, 1091
DpnII GATC 5 cut(s) 4, 93, 903, 1029, 1089
EaeI YGGCCR 1 cut(s) 1322
Eam1104I CTCTTC 4 cut(s) 948, 987, 1289, 1373
EarI CTCTTC 4 cut(s) 948, 987, 1289, 1373
Eco130I CCWWGG 5 cut(s) 32, 143, 366, 945, 1023
Eco31I GGTCTC 1 cut(s) 356
Eco47I GGWCC 1 cut(s) 754
Eco57I CTGAAG 1 cut(s) 396
Eco72I CACGTG 1 cut(s) 722
EcoRI GAATTC 1 cut(s) 82
EcoT14I CCWWGG 5 cut(s) 32, 143, 366, 945, 1023
EcoT22I ATGCAT 1 cut(s) 250
ErhI CCWWGG 5 cut(s) 32, 143, 366, 945, 1023
FaeI CATG 8 cut(s) 92, 223, 370, 392, 575, 910, 949, 1040
FalI AAGNNNNNCTT 6 cut(s) 489, 521, 1301, 1333, 1370, 1402
FaqI GGGAC 1 cut(s) 1368
FatI CATG 8 cut(s) 88, 219, 366, 388, 571, 906, 945, 1036
FauNDI CATATG 1 cut(s) 400
FokI GGATG 2 cut(s) 33, 1006
FspBI CTAG 7 cut(s) 276, 302, 408, 434, 534, 831, 1278
HaeIII GGCC 1 cut(s) 1324
HapII CCGG 1 cut(s) 185
Hin1II CATG 8 cut(s) 92, 223, 370, 392, 575, 910, 949, 1040
HincII GTYRAC 1 cut(s) 292
HindII GTYRAC 1 cut(s) 292
HindIII AAGCTT 4 cut(s) 264, 447, 489, 773
HinfI GANTC 6 cut(s) 404, 575, 641, 806, 958, 1381
HpaII CCGG 1 cut(s) 185
HphI GGTGA 3 cut(s) 739, 1159, 1174
Hpy166II GTNNAC 1 cut(s) 292
Hpy188I TCNGA 2 cut(s) 745, 811
Hpy188III TCNNGA 9 cut(s) 227, 374, 389, 422, 497, 606, 632, 1037, 1202
Hpy8I GTNNAC 1 cut(s) 292
HpyAV CCTTC 3 cut(s) 565, 972, 1249
HpyCH4IV ACGT 1 cut(s) 721
HpyF10VI GCNNNNNNNGC 4 cut(s) 323, 539, 634, 1271
HpyF3I CTNAG 3 cut(s) 771, 998, 1387
HpySE526I ACGT 1 cut(s) 721
Hsp92II CATG 8 cut(s) 92, 223, 370, 392, 575, 910, 949, 1040
Kzo9I GATC 5 cut(s) 4, 93, 903, 1029, 1089
LguI GCTCTTC 1 cut(s) 987
LmnI GCTCC 4 cut(s) 12, 595, 1169, 1279
LpnPI CCDG 2 cut(s) 198, 387
LweI GCATC 4 cut(s) 492, 637, 783, 1242
MaeI CTAG 7 cut(s) 276, 302, 408, 434, 534, 831, 1278
MaeII ACGT 1 cut(s) 721
MaeIII GTNAC 2 cut(s) 731, 974
MalI GATC 5 cut(s) 6, 95, 905, 1031, 1091
MboI GATC 5 cut(s) 4, 93, 903, 1029, 1089
MfeI CAATTG 2 cut(s) 308, 440
MflI RGATCY 1 cut(s) 1029
MhlI GDGCHC 3 cut(s) 167, 185, 1174
MlsI TGGCCA 1 cut(s) 1324
MluNI TGGCCA 1 cut(s) 1324
MlyI GAGTC 4 cut(s) 413, 650, 967, 1390
Mox20I TGGCCA 1 cut(s) 1324
Mph1103I ATGCAT 1 cut(s) 250
MscI TGGCCA 1 cut(s) 1324
MseI TTAA 4 cut(s) 528, 1074, 1305, 1432
MslI CAYNNNNRTG 1 cut(s) 516
Msp20I TGGCCA 1 cut(s) 1324
MspCI CTTAAG 1 cut(s) 527
MspI CCGG 1 cut(s) 185
MspR9I CCNGG 1 cut(s) 185
MunI CAATTG 2 cut(s) 308, 440
Mva1269I GAATGC 1 cut(s) 148
MwoI GCNNNNNNNGC 4 cut(s) 323, 539, 634, 1271
NciI CCSGG 1 cut(s) 185
NcoI CCATGG 2 cut(s) 366, 945
NdeI CATATG 1 cut(s) 400
NdeII GATC 5 cut(s) 4, 93, 903, 1029, 1089
NheI GCTAGC 1 cut(s) 433
NlaIII CATG 8 cut(s) 92, 223, 370, 392, 575, 910, 949, 1040
NlaIV GGNNCC 3 cut(s) 372, 597, 755
NmuCI GTSAC 2 cut(s) 731, 974
NsiI ATGCAT 1 cut(s) 250
NspI RCATGY 1 cut(s) 223
PagI TCATGA 2 cut(s) 388, 1036
PciSI GCTCTTC 1 cut(s) 987
PctI GAATGC 1 cut(s) 148
PfeI GAWTC 2 cut(s) 575, 806
PflMI CCANNNNNTGG 2 cut(s) 1124, 1331
Ple19I CGATCG 1 cut(s) 96
PleI GAGTC 4 cut(s) 412, 649, 966, 1389
PmaCI CACGTG 1 cut(s) 722
PmlI CACGTG 1 cut(s) 722
PpsI GAGTC 4 cut(s) 412, 649, 966, 1389
Ppu21I YACGTR 1 cut(s) 722
PspCI CACGTG 1 cut(s) 722
PspN4I GGNNCC 3 cut(s) 372, 597, 755
PspPI GGNCC 1 cut(s) 754
PsuI RGATCY 1 cut(s) 1029
PvuI CGATCG 1 cut(s) 96
RsaI GTAC 3 cut(s) 209, 684, 1413
RsaNI GTAC 3 cut(s) 208, 683, 1412
RseI CAYNNNNRTG 1 cut(s) 516
SapI GCTCTTC 1 cut(s) 987
SaqAI TTAA 4 cut(s) 528, 1074, 1305, 1432
Sau3AI GATC 5 cut(s) 4, 93, 903, 1029, 1089
Sau96I GGNCC 1 cut(s) 754
SchI GAGTC 4 cut(s) 413, 650, 967, 1390
ScrFI CCNGG 1 cut(s) 185
SduI GDGCHC 3 cut(s) 167, 185, 1174
SfaNI GCATC 4 cut(s) 492, 637, 783, 1242
SinI GGWCC 1 cut(s) 754
SmiMI CAYNNNNRTG 1 cut(s) 516
SmlI CTYRAG 7 cut(s) 342, 495, 527, 632, 899, 1250, 1415
SmoI CTYRAG 7 cut(s) 342, 495, 527, 632, 899, 1250, 1415
SspI AATATT 1 cut(s) 1065
SspMI CTAG 7 cut(s) 276, 302, 408, 434, 534, 831, 1278
StyD4I CCNGG 1 cut(s) 183
StyI CCWWGG 5 cut(s) 32, 143, 366, 945, 1023
TaiI ACGT 1 cut(s) 724
TaqI TCGA 4 cut(s) 481, 882, 936, 1376
TatI WGTACW 2 cut(s) 207, 682
TfiI GAWTC 2 cut(s) 575, 806
Tru1I TTAA 4 cut(s) 528, 1074, 1305, 1432
Tru9I TTAA 4 cut(s) 528, 1074, 1305, 1432
TseFI GTSAC 2 cut(s) 731, 974
Tsp45I GTSAC 2 cut(s) 731, 974
TspDTI ATGAA 7 cut(s) 132, 141, 588, 720, 868, 916, 996
TspGWI ACGGA 2 cut(s) 309, 860
Van91I CCANNNNNTGG 2 cut(s) 1124, 1331
Vha464I CTTAAG 1 cut(s) 527
VpaK11BI GGWCC 1 cut(s) 754
XapI RAATTY 3 cut(s) 82, 284, 848
XceI RCATGY 1 cut(s) 223
XspI CTAG 7 cut(s) 276, 302, 408, 434, 534, 831, 1278
Zsp2I ATGCAT 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.